Journal: Molecular Metabolism

Article Title: Chaperone-mediated autophagy dysregulation during aging impairs hepatic fatty acid oxidation via accumulation of NCoR1

doi: 10.1016/j.molmet.2023.101784

Figure Lengend Snippet: Gene-specific primers used in qRT-PCR.

Article Snippet: Western blots were probed with the following antibodies: NCoR1 (#5948), PKM2 (#4053) from Cell Signaling Technology; β-actin (sc-47778), α-tubulin (sc-5286), PPARα (sc-398394), and Lamin B (sc-374015) from Santa Cruz Biotechnology; LAMP2A (ab18528) from Abcam; PLIN2 (NB110-40877) and Hsc70 (NB120-2788) from Novus Biologicals; LAMP1 (1d4b) from DSHB.

Techniques: Sequencing

Journal: bioRxiv

Article Title: Lysine tRNA fragments and miR-194-5p co-regulate hepatic steatosis via β-Klotho and Perilipin 2

doi: 10.1101/2023.09.06.556514

Figure Lengend Snippet: A. Fixed Hep G2 cells exposed to 0,0.5, or 1 mM OA for 48 hours showed increasing Nile Red accumulation reflecting TG content (red, Nile Red; blue, DAPI). B. Quantification of Nile Red signals in these cells by plate reader measurement, n=3 experiments. C. RT-qPCR measurements of PLIN2 mRNA levels normalized to ribosomal protein RPL19 show OA-induced dose-related enhancement of LD formation. D. PLIN2 protein levels increase under OA treatment. E. AM132 treatment reduced Plin2 (but not Plin3 or Plin5) mRNA levels compared to Ctrl mice; RT-qPCR normalized to b-actin (n=5-8 per group). In panels B, C, E, average ± SD, one-way ANOVA with Tukey’s correction for multiple comparisons, * p <0.05, ** p <0.01, *** p <0.001, ****p<0.0001.

Article Snippet: HEK293T cells were seeded in 24-well plates, and 24 hours later co-transfected with 500 ng psiCHECKTM-2 Vector (Promega) containing the 3’UTR of human PLIN2 gene downstream to the Renilla luciferase gene, and with 500 ng plasmid expressing either miR-194-5p or a scrambled sequence as control (MR01 backbone, GeneCopoeia).

Techniques: Quantitative RT-PCR

Journal: bioRxiv

Article Title: Lysine tRNA fragments and miR-194-5p co-regulate hepatic steatosis via β-Klotho and Perilipin 2

doi: 10.1101/2023.09.06.556514

Figure Lengend Snippet: A. The predicted binding sites of miR-194-5p in murine and human PLIN2 mRNAs (upper and lower sections). B. RT-qPCR validation of RNA-seq presents elevated miR-194-5p levels in AM132 compared to control mice (n=8 per group, RNA-seq in ). C, D, E. miR-194-5p decline in steatotic Hep G2 cells following 48h, 72h and one week exposure to OA. RT-qPCR measurements normalized to SNORD47, 2-3 experiments each. F. Sustained PLIN2 mRNA levels following miR-194-5p KD in non-steatotic cells. G . Elevated (∼20%) PLIN2 mRNA levels following KD in steatotic Hep G2 cells. In panels F-G PLIN2 was measured by RT-qPCR and normalized to RPL19, 3 experiments each . H. PLIN2 protein increases following miR-194-5p KD in steatotic Hep G2 cells. I. Blot quantification of panel H, normalized to a-tubulin. J. Decreased luciferase activity in HEK293T cells co-transfected with plasmids expressing human PLIN2 3’UTR and miR-194-5p or a scrambled sequence. In panels B-G, I, J, average ±SD, student’s t-test, * p <0.05, ** p <0.01, *** p <0.001.

Article Snippet: HEK293T cells were seeded in 24-well plates, and 24 hours later co-transfected with 500 ng psiCHECKTM-2 Vector (Promega) containing the 3’UTR of human PLIN2 gene downstream to the Renilla luciferase gene, and with 500 ng plasmid expressing either miR-194-5p or a scrambled sequence as control (MR01 backbone, GeneCopoeia).

Techniques: Binding Assay, Quantitative RT-PCR, Biomarker Discovery, RNA Sequencing, Control, Luciferase, Activity Assay, Transfection, Expressing, Sequencing

Journal: Chinese Medicine

Article Title: Zhishi Xiebai Guizhi Decoction modulates hypoxia and lipid toxicity to alleviate pulmonary vascular remodeling of pulmonary hypertension in rats

doi: 10.1186/s13020-024-01039-0

Figure Lengend Snippet: ZXGD regulated lipid metabolism to reduce cell lipid toxicity in rats with PH. A – C , H Concentration of TC, LDL-C and HDL-C (n = 6) in serum as well as decadienyl- l -carnitine (n = 3) in lung tissue were examined by ELISA and Biochemical kit. D – F Expression levels of PPARγ, PLA2 and PLIN2 in lung tissue were detected using Western blot (n = 6). G Count of lipid droplets in PASMCs was assessed with Oil red O staining, and statistical data were obtained. * p < 0.05, ** p < 0.01, *** p < 0.001 vs control, # p < 0.05, ## p < 0.01, ### p < 0.001 vs PH or PDGF-BB

Article Snippet: The methods in extraction, separation, and transferring membranes of protein samples from lung tissues and PASMCs were performed according to our previous study [ ], further incubation with the following primary antibodies: Caspase 3, Caspase 9, PLA2, PPARγ, IL-1β, IL-10 (Bioss, Beijing, China); Bax, HIF-1α, PLIN2 (Boster, Wuhan, China); PCNA (Wanleibio, Shenyang, China); IL-6 (Beyotime, Shanghai, China); Caspase 8, Bcl-2, β-actin (ABclonal, Wuhan, China) for overnight at 4 °C and subsequently incubated with secondary antibodies (goat anti-rabbit IgG, Bioss, Beijing, China) for 1h at room temperature.

Techniques: Concentration Assay, Enzyme-linked Immunosorbent Assay, Expressing, Western Blot, Staining, Control

Journal: Chinese Medicine

Article Title: Zhishi Xiebai Guizhi Decoction modulates hypoxia and lipid toxicity to alleviate pulmonary vascular remodeling of pulmonary hypertension in rats

doi: 10.1186/s13020-024-01039-0

Figure Lengend Snippet: ZXGD modulated HIF-1α mediated pulmonary vascular remodeling. A Expression level of HIF-1α in lung tissue of rats was tested with PCR (n = 3). B Expression level of HIF-1α in PASMCs transfected with siRNA (n = 6). C Effects of ZXGD on viability of PASMCs transfected with HIF-1α siRNA was examined by MTT (n = 6). D – G Levels of IL-6, IL-10, LDL-C and decadienyl- l -carnitine in PASMCs transfected with HIF-1α siRNA. H – K Expression level of HIF-1α, Caspase-3, PCNA, PLIN2 in PASMCs transfected with HIF-1α siRNA (n ≥ 3). * p < 0.05, *** p < 0.001 vs control, # p < 0.05, ## p < 0.01, ### p < 0.001 vs PH or PDGF-BB

Article Snippet: The methods in extraction, separation, and transferring membranes of protein samples from lung tissues and PASMCs were performed according to our previous study [ ], further incubation with the following primary antibodies: Caspase 3, Caspase 9, PLA2, PPARγ, IL-1β, IL-10 (Bioss, Beijing, China); Bax, HIF-1α, PLIN2 (Boster, Wuhan, China); PCNA (Wanleibio, Shenyang, China); IL-6 (Beyotime, Shanghai, China); Caspase 8, Bcl-2, β-actin (ABclonal, Wuhan, China) for overnight at 4 °C and subsequently incubated with secondary antibodies (goat anti-rabbit IgG, Bioss, Beijing, China) for 1h at room temperature.

Techniques: Expressing, Transfection, Control

Journal: Chinese Medicine

Article Title: Zhishi Xiebai Guizhi Decoction modulates hypoxia and lipid toxicity to alleviate pulmonary vascular remodeling of pulmonary hypertension in rats

doi: 10.1186/s13020-024-01039-0

Figure Lengend Snippet: Effect of neohesperidin and naringin on cell viability, HIF-1α, Caspase3, PLIN2 in PASMCs. A – D Effects of neohesperidin and naringin on PASMCs viability were observed by MTT (n = 6). E – J Expression levels of HIF-1α, Caspase3, PLIN2 in PASMCs were evaluated by Western Blot (n ≥ 3). * p < 0.05, ** p < 0.01, *** p < 0.001 vs control, # p < 0.05, ## p < 0.01, ### p < 0.001 vs PDGF-BB. 5 represents 5 µM, 10 represents 10 µM

Article Snippet: The methods in extraction, separation, and transferring membranes of protein samples from lung tissues and PASMCs were performed according to our previous study [ ], further incubation with the following primary antibodies: Caspase 3, Caspase 9, PLA2, PPARγ, IL-1β, IL-10 (Bioss, Beijing, China); Bax, HIF-1α, PLIN2 (Boster, Wuhan, China); PCNA (Wanleibio, Shenyang, China); IL-6 (Beyotime, Shanghai, China); Caspase 8, Bcl-2, β-actin (ABclonal, Wuhan, China) for overnight at 4 °C and subsequently incubated with secondary antibodies (goat anti-rabbit IgG, Bioss, Beijing, China) for 1h at room temperature.

Techniques: Expressing, Western Blot, Control

Journal: Biomolecules

Article Title: Docosahexaenoic Acid Supplementation in Postnatal Growth Restricted Rats Does Not Normalize Lung Function or PPARγ Activity

doi: 10.3390/biom15040551

Figure Lengend Snippet: PGR and DHA supplementation decreases the expression of PPARγ target gene Plin2. ( A ) Male rat lung Plin2 mRNA levels. ( B ) Female rat lung Plin2 mRNA levels. * p ≤ 0.05 compared to sex-matched control, # p ≤ 0.05 compared to PGR, + p ≤ 0.05 compared to PGR + LoDHA.

Article Snippet: To measure levels of PparγΔ5, we used a custom primer/probe set spanning the exon 4–6 junction (forward, CGAGAAGGAGAAGCTGTTGG; reverse, GCGGTTGATTTGTCTGTTGT; probe, CCCTGGCAAAGCATTTGTAT). mRNA levels of PPARγ target gene, Perilipin 2 (Plin2) was also measured using the following Assay on Demand: Rn01399516_m1.

Techniques: Expressing, Control