phox2b Search Results


94
Thermo Fisher gene exp phox2b rn01413076 mh
Molecular changes following ETO administration in the retrotrapezoid nucleus (RTN), the solitary tract nucleus (NTS), and the medial hypothalamus (MH) of female and male rats. (A–C) Quantitative PCR analysis of Nmb , transcription factor <t>Phox2b</t> , and proton‐sensing channels, Gpr4 and Task2 , in the RTN (A), NTS (B), and MH (C) of females and males. Naive males showed higher expression levels of Nmb and Gpr4 in the RTN (A) and Phox2b , Gpr4 , and Pgr in the NTS (B) compared with females. Following lesion or ETO treatment, Nmb expression was significantly reduced in both SHAM‐ and ETO‐treated animals compared with naive controls, in males and females (A). ETO‐treated females showed upregulation of Task2 and Gpr4 mRNA levels in the RTN (A), and downregulation of Phox2b and Task2 mRNA levels in the NTS (B), consistent with the observed recovery of the CO 2 chemoreflex. No significant changes were observed in the MH (C). In males, no significant transcriptional changes were detected in the RTN, NTS, or MH, except for the reduction of Nmb in the RTN. Graphs show mean ± SD with individual values represented as 2 −ΔCt with all statistical analyses performed on ΔCt values. Comparisons between naive males and females were analyzed using unpaired t ‐tests or Mann–Whitney U tests, whereas differences among experimental groups within each sex were analyzed using one‐way ANOVA (Tukey post hoc) or Kruskal–Wallis ANOVA (Dunn's post hoc). * p < 0.05, ** p < 0.01, *** p < 0.001.
Gene Exp Phox2b Rn01413076 Mh, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/Gene+Exp%2E+Phox2b%2C+Rn01413076_mH/pmc12984012-200-7--1
Average 94 stars, based on 1 article reviews
gene exp phox2b rn01413076 mh - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Jackson Laboratory phox2b cre jackson laboratory
Data and Software Availability
Phox2b Cre Jackson Laboratory, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/cre+phox2b/pmc07271821-861-104-106
Average 86 stars, based on 1 article reviews
phox2b cre jackson laboratory - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology mouse polyclonal anti phox2b antibody
Data and Software Availability
Mouse Polyclonal Anti Phox2b Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/Phox2b+Antibody/pmc12273499-77-25-30
Average 93 stars, based on 1 article reviews
mouse polyclonal anti phox2b antibody - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Proteintech rabbit anti phox2b
a Rosa FTLG allele used for intersectional transgenic labeling of boutons from <t>vGlut2/Phox2b</t> interneurons (left) and schematic of the results (right). b Coronal sections through the hindbrain of a Phox2b::Flpo ; vGlut2::Cre ; Rosa FTLG mouse at P4, showing synaptic boutons (black) from vGlut2/Phox2b interneurons in relation to motor nuclei (ChAT + , blue) at low (left), and higher (middle) magnifications, and close-ups of boutons (green) on motoneurons (right), which are either Phox2b + (purple) or Phox2b − (blue). c (left) Strategy for mono-synaptically restricted transsynaptic labeling of premotor neurons from the posterior digastric muscle (PD) in a Phox2b::Cre ; Rosa nlsLacZ mouse, with G-deleted rabies virus (RV) encoding mCherry and complemented by a G-encoding helper HSV virus ( HSV-YFP - G ), and summary of the results. (right panel) The only seed neurons are Acc7 motoneurons, double-labeled by the HSV-G and RV-mCherry viruses. d , e Coronal sections through the hindbrain at P8 showing labeled premotor neurons (black on the left panels) in the IRt ( d ) and Peri5 ( e ), which for the most part (72.7% ± 3.5 SEM, n = 4 animals) express Phox2b (right panels). AD anterior digastric, IRt intermediate reticular formation, nTS nucleus of the solitary tract, PD posterior digastric, Peri5 peritrigeminal area, RF reticular formation, RTN retrotrapezoid nucleus. Scale bars, b 1 mm for the left column, c 250 μm, d , e 500 μm.
Rabbit Anti Phox2b, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/PHOX2B+Antibody/pmc08563905-181-52-61
Average 93 stars, based on 1 article reviews
rabbit anti phox2b - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
R&D Systems goat anti phox2b
a Rosa FTLG allele used for intersectional transgenic labeling of boutons from <t>vGlut2/Phox2b</t> interneurons (left) and schematic of the results (right). b Coronal sections through the hindbrain of a Phox2b::Flpo ; vGlut2::Cre ; Rosa FTLG mouse at P4, showing synaptic boutons (black) from vGlut2/Phox2b interneurons in relation to motor nuclei (ChAT + , blue) at low (left), and higher (middle) magnifications, and close-ups of boutons (green) on motoneurons (right), which are either Phox2b + (purple) or Phox2b − (blue). c (left) Strategy for mono-synaptically restricted transsynaptic labeling of premotor neurons from the posterior digastric muscle (PD) in a Phox2b::Cre ; Rosa nlsLacZ mouse, with G-deleted rabies virus (RV) encoding mCherry and complemented by a G-encoding helper HSV virus ( HSV-YFP - G ), and summary of the results. (right panel) The only seed neurons are Acc7 motoneurons, double-labeled by the HSV-G and RV-mCherry viruses. d , e Coronal sections through the hindbrain at P8 showing labeled premotor neurons (black on the left panels) in the IRt ( d ) and Peri5 ( e ), which for the most part (72.7% ± 3.5 SEM, n = 4 animals) express Phox2b (right panels). AD anterior digastric, IRt intermediate reticular formation, nTS nucleus of the solitary tract, PD posterior digastric, Peri5 peritrigeminal area, RF reticular formation, RTN retrotrapezoid nucleus. Scale bars, b 1 mm for the left column, c 250 μm, d , e 500 μm.
Goat Anti Phox2b, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/Human%2FMouse+PHOX2B+Antibody/pmc12305073-168-4-7
Average 93 stars, based on 1 article reviews
goat anti phox2b - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc rabbit anti phox2b
a Rosa FTLG allele used for intersectional transgenic labeling of boutons from <t>vGlut2/Phox2b</t> interneurons (left) and schematic of the results (right). b Coronal sections through the hindbrain of a Phox2b::Flpo ; vGlut2::Cre ; Rosa FTLG mouse at P4, showing synaptic boutons (black) from vGlut2/Phox2b interneurons in relation to motor nuclei (ChAT + , blue) at low (left), and higher (middle) magnifications, and close-ups of boutons (green) on motoneurons (right), which are either Phox2b + (purple) or Phox2b − (blue). c (left) Strategy for mono-synaptically restricted transsynaptic labeling of premotor neurons from the posterior digastric muscle (PD) in a Phox2b::Cre ; Rosa nlsLacZ mouse, with G-deleted rabies virus (RV) encoding mCherry and complemented by a G-encoding helper HSV virus ( HSV-YFP - G ), and summary of the results. (right panel) The only seed neurons are Acc7 motoneurons, double-labeled by the HSV-G and RV-mCherry viruses. d , e Coronal sections through the hindbrain at P8 showing labeled premotor neurons (black on the left panels) in the IRt ( d ) and Peri5 ( e ), which for the most part (72.7% ± 3.5 SEM, n = 4 animals) express Phox2b (right panels). AD anterior digastric, IRt intermediate reticular formation, nTS nucleus of the solitary tract, PD posterior digastric, Peri5 peritrigeminal area, RF reticular formation, RTN retrotrapezoid nucleus. Scale bars, b 1 mm for the left column, c 250 μm, d , e 500 μm.
Rabbit Anti Phox2b, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/PHOX2B+Antibody/pmc03774606-138-17-30
Average 93 stars, based on 1 article reviews
rabbit anti phox2b - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

92
OriGene human phox2b
a Rosa FTLG allele used for intersectional transgenic labeling of boutons from <t>vGlut2/Phox2b</t> interneurons (left) and schematic of the results (right). b Coronal sections through the hindbrain of a Phox2b::Flpo ; vGlut2::Cre ; Rosa FTLG mouse at P4, showing synaptic boutons (black) from vGlut2/Phox2b interneurons in relation to motor nuclei (ChAT + , blue) at low (left), and higher (middle) magnifications, and close-ups of boutons (green) on motoneurons (right), which are either Phox2b + (purple) or Phox2b − (blue). c (left) Strategy for mono-synaptically restricted transsynaptic labeling of premotor neurons from the posterior digastric muscle (PD) in a Phox2b::Cre ; Rosa nlsLacZ mouse, with G-deleted rabies virus (RV) encoding mCherry and complemented by a G-encoding helper HSV virus ( HSV-YFP - G ), and summary of the results. (right panel) The only seed neurons are Acc7 motoneurons, double-labeled by the HSV-G and RV-mCherry viruses. d , e Coronal sections through the hindbrain at P8 showing labeled premotor neurons (black on the left panels) in the IRt ( d ) and Peri5 ( e ), which for the most part (72.7% ± 3.5 SEM, n = 4 animals) express Phox2b (right panels). AD anterior digastric, IRt intermediate reticular formation, nTS nucleus of the solitary tract, PD posterior digastric, Peri5 peritrigeminal area, RF reticular formation, RTN retrotrapezoid nucleus. Scale bars, b 1 mm for the left column, c 250 μm, d , e 500 μm.
Human Phox2b, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/PHOX2B+(NM_003924)+Human+Untagged+Clone/pm38431667-273-3-8
Average 92 stars, based on 1 article reviews
human phox2b - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

92
Novus Biologicals polyclonal rabbit anti phox2b
a Rosa FTLG allele used for intersectional transgenic labeling of boutons from <t>vGlut2/Phox2b</t> interneurons (left) and schematic of the results (right). b Coronal sections through the hindbrain of a Phox2b::Flpo ; vGlut2::Cre ; Rosa FTLG mouse at P4, showing synaptic boutons (black) from vGlut2/Phox2b interneurons in relation to motor nuclei (ChAT + , blue) at low (left), and higher (middle) magnifications, and close-ups of boutons (green) on motoneurons (right), which are either Phox2b + (purple) or Phox2b − (blue). c (left) Strategy for mono-synaptically restricted transsynaptic labeling of premotor neurons from the posterior digastric muscle (PD) in a Phox2b::Cre ; Rosa nlsLacZ mouse, with G-deleted rabies virus (RV) encoding mCherry and complemented by a G-encoding helper HSV virus ( HSV-YFP - G ), and summary of the results. (right panel) The only seed neurons are Acc7 motoneurons, double-labeled by the HSV-G and RV-mCherry viruses. d , e Coronal sections through the hindbrain at P8 showing labeled premotor neurons (black on the left panels) in the IRt ( d ) and Peri5 ( e ), which for the most part (72.7% ± 3.5 SEM, n = 4 animals) express Phox2b (right panels). AD anterior digastric, IRt intermediate reticular formation, nTS nucleus of the solitary tract, PD posterior digastric, Peri5 peritrigeminal area, RF reticular formation, RTN retrotrapezoid nucleus. Scale bars, b 1 mm for the left column, c 250 μm, d , e 500 μm.
Polyclonal Rabbit Anti Phox2b, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/PHOX2B+Antibody/pmc09101578-197-8-12
Average 92 stars, based on 1 article reviews
polyclonal rabbit anti phox2b - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

96
Elabscience Biotechnology polyclonal rabbit antibodies
a Rosa FTLG allele used for intersectional transgenic labeling of boutons from <t>vGlut2/Phox2b</t> interneurons (left) and schematic of the results (right). b Coronal sections through the hindbrain of a Phox2b::Flpo ; vGlut2::Cre ; Rosa FTLG mouse at P4, showing synaptic boutons (black) from vGlut2/Phox2b interneurons in relation to motor nuclei (ChAT + , blue) at low (left), and higher (middle) magnifications, and close-ups of boutons (green) on motoneurons (right), which are either Phox2b + (purple) or Phox2b − (blue). c (left) Strategy for mono-synaptically restricted transsynaptic labeling of premotor neurons from the posterior digastric muscle (PD) in a Phox2b::Cre ; Rosa nlsLacZ mouse, with G-deleted rabies virus (RV) encoding mCherry and complemented by a G-encoding helper HSV virus ( HSV-YFP - G ), and summary of the results. (right panel) The only seed neurons are Acc7 motoneurons, double-labeled by the HSV-G and RV-mCherry viruses. d , e Coronal sections through the hindbrain at P8 showing labeled premotor neurons (black on the left panels) in the IRt ( d ) and Peri5 ( e ), which for the most part (72.7% ± 3.5 SEM, n = 4 animals) express Phox2b (right panels). AD anterior digastric, IRt intermediate reticular formation, nTS nucleus of the solitary tract, PD posterior digastric, Peri5 peritrigeminal area, RF reticular formation, RTN retrotrapezoid nucleus. Scale bars, b 1 mm for the left column, c 250 μm, d , e 500 μm.
Polyclonal Rabbit Antibodies, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/PHOX2B+Polyclonal+Antibody/pmc10619573-117-19-22
Average 96 stars, based on 1 article reviews
polyclonal rabbit antibodies - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
OriGene primer phox2b f cctgaagatcgacctcacagag r ttttgcccgaggagccgttctt
Checkpoints for the differentiation of parasympathetic neurons (A) Schematic of parasympathetic neuron differentiation protocol. (B) Table of checkpoints that cultures should go through for proper differentiation: hPSC (d0, white arrows point to bright borders), NC (d10, white arrows point to ridges), SCP (d16), and parasympathetic neurons (d30). (C) Phase contrast images of healthy hPSCs (left, white arrows point to bright borders) and unhappy hPSCs with differentiation (right, white arrows point to differentiating cells). (D) Phase contrast images of d10 NC ridges with not enough BMP4 (left), enough BMP4 (middle, white arrows point to ridges), and too much BMP4 (right, white arrows point to blisters). (E) Phase contrast image of seeding density for d1 NC. (F) Immunofluorescent image of d10 NC: DAPI (blue) and SOX10 (red). (G) NC can be directly replated or frozen to produce parasympathetic neurons. (H) Schematic of sympathetic neuron differentiation protocol. (I) Gene expression of SOX10, S100B , and <t>PHOX2B</t> by RT-qPCR for d14 sympathoblasts compared to d16 SCPs. n=4–7 biological replicate. Unpaired two-tailed t test.
Primer Phox2b F Cctgaagatcgacctcacagag R Ttttgcccgaggagccgttctt, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/PHOX2B+Human+qPCR+Primer+Pair/pmc12337169-76-0-7
Average 93 stars, based on 1 article reviews
primer phox2b f cctgaagatcgacctcacagag r ttttgcccgaggagccgttctt - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology phox2b
GD2 and lineage marker expression in TH-MYCN tumors, primary explants and cell lines, and human neuroblastoma cell lines. (a) TH-MYCN +/+ neuroblastomas (NB), previously established and propagated TH-MYCN +/+ and human NB cell lines were examined for surface GD2 expression by flow cytometry in single, live, CD45- cells, and NCAM1+ and CD56+ for mouse and human NBs, respectively. Cell lines were passaged for 3 weeks to assess GD2 stability. (b) Fresh TH-MYCN +/+ tumors were explanted and carried in tissue culture to monitor the GD2+ proportion of tumor cells over time ex vivo. (c) Immunoblot detection of a principal adrenergic marker, <t>Phox2b,</t> principal mesenchymal marker, Yap1, and β-tubulin loading control. IMR5 and SHEP are neuroblastoma cell lines with a predominantly adrenergic or mesenchymal lineage, respectively. TH-MYCN +/+ primary tumors are predominantly adrenergic marker expressing. TH-MYCN +/+ tumor-derived cell lines are largely mesenchymal marker expressing when propagated ex vivo (>3 months, 3000-series cell lines) whereas marker expression is heterogeneous during earlier passage ex vivo (5000-series cell lines). (d) Immunocytochemistry and immunohistochemistry to detect Phox2b and Yap1 from FFPE cell line pellets or primary tumors are shown, concordant with immunoblot results.
Phox2b, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phox2b/Phox2b+Lentiviral+Activation+Particles/pmc09132414-92-40-43
Average 93 stars, based on 1 article reviews
phox2b - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


Molecular changes following ETO administration in the retrotrapezoid nucleus (RTN), the solitary tract nucleus (NTS), and the medial hypothalamus (MH) of female and male rats. (A–C) Quantitative PCR analysis of Nmb , transcription factor Phox2b , and proton‐sensing channels, Gpr4 and Task2 , in the RTN (A), NTS (B), and MH (C) of females and males. Naive males showed higher expression levels of Nmb and Gpr4 in the RTN (A) and Phox2b , Gpr4 , and Pgr in the NTS (B) compared with females. Following lesion or ETO treatment, Nmb expression was significantly reduced in both SHAM‐ and ETO‐treated animals compared with naive controls, in males and females (A). ETO‐treated females showed upregulation of Task2 and Gpr4 mRNA levels in the RTN (A), and downregulation of Phox2b and Task2 mRNA levels in the NTS (B), consistent with the observed recovery of the CO 2 chemoreflex. No significant changes were observed in the MH (C). In males, no significant transcriptional changes were detected in the RTN, NTS, or MH, except for the reduction of Nmb in the RTN. Graphs show mean ± SD with individual values represented as 2 −ΔCt with all statistical analyses performed on ΔCt values. Comparisons between naive males and females were analyzed using unpaired t ‐tests or Mann–Whitney U tests, whereas differences among experimental groups within each sex were analyzed using one‐way ANOVA (Tukey post hoc) or Kruskal–Wallis ANOVA (Dunn's post hoc). * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Acta Physiologica (Oxford, England)

Article Title: Sex Differences in the Effects of Etonogestrel on Respiratory Recovery in an In Vivo Rat Model of Central Chemoreflex Impairment

doi: 10.1111/apha.70194

Figure Lengend Snippet: Molecular changes following ETO administration in the retrotrapezoid nucleus (RTN), the solitary tract nucleus (NTS), and the medial hypothalamus (MH) of female and male rats. (A–C) Quantitative PCR analysis of Nmb , transcription factor Phox2b , and proton‐sensing channels, Gpr4 and Task2 , in the RTN (A), NTS (B), and MH (C) of females and males. Naive males showed higher expression levels of Nmb and Gpr4 in the RTN (A) and Phox2b , Gpr4 , and Pgr in the NTS (B) compared with females. Following lesion or ETO treatment, Nmb expression was significantly reduced in both SHAM‐ and ETO‐treated animals compared with naive controls, in males and females (A). ETO‐treated females showed upregulation of Task2 and Gpr4 mRNA levels in the RTN (A), and downregulation of Phox2b and Task2 mRNA levels in the NTS (B), consistent with the observed recovery of the CO 2 chemoreflex. No significant changes were observed in the MH (C). In males, no significant transcriptional changes were detected in the RTN, NTS, or MH, except for the reduction of Nmb in the RTN. Graphs show mean ± SD with individual values represented as 2 −ΔCt with all statistical analyses performed on ΔCt values. Comparisons between naive males and females were analyzed using unpaired t ‐tests or Mann–Whitney U tests, whereas differences among experimental groups within each sex were analyzed using one‐way ANOVA (Tukey post hoc) or Kruskal–Wallis ANOVA (Dunn's post hoc). * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The assays used were: rat Phox2b (ID: Rn01413076_mH), rat Pgr (ID: Rn01448227_m1), rat Gpr4 (ID: Rn02585915), rat Task2 (ID: Rn01755927), rat Nmb (ID: Rn01478123_m1), and the endogenous control rat Actb (ID: Rn00667869_m1).

Techniques: Real-time Polymerase Chain Reaction, Expressing, MANN-WHITNEY

Data and Software Availability

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression

a Rosa FTLG allele used for intersectional transgenic labeling of boutons from vGlut2/Phox2b interneurons (left) and schematic of the results (right). b Coronal sections through the hindbrain of a Phox2b::Flpo ; vGlut2::Cre ; Rosa FTLG mouse at P4, showing synaptic boutons (black) from vGlut2/Phox2b interneurons in relation to motor nuclei (ChAT + , blue) at low (left), and higher (middle) magnifications, and close-ups of boutons (green) on motoneurons (right), which are either Phox2b + (purple) or Phox2b − (blue). c (left) Strategy for mono-synaptically restricted transsynaptic labeling of premotor neurons from the posterior digastric muscle (PD) in a Phox2b::Cre ; Rosa nlsLacZ mouse, with G-deleted rabies virus (RV) encoding mCherry and complemented by a G-encoding helper HSV virus ( HSV-YFP - G ), and summary of the results. (right panel) The only seed neurons are Acc7 motoneurons, double-labeled by the HSV-G and RV-mCherry viruses. d , e Coronal sections through the hindbrain at P8 showing labeled premotor neurons (black on the left panels) in the IRt ( d ) and Peri5 ( e ), which for the most part (72.7% ± 3.5 SEM, n = 4 animals) express Phox2b (right panels). AD anterior digastric, IRt intermediate reticular formation, nTS nucleus of the solitary tract, PD posterior digastric, Peri5 peritrigeminal area, RF reticular formation, RTN retrotrapezoid nucleus. Scale bars, b 1 mm for the left column, c 250 μm, d , e 500 μm.

Journal: Nature Communications

Article Title: A medullary centre for lapping in mice

doi: 10.1038/s41467-021-26275-y

Figure Lengend Snippet: a Rosa FTLG allele used for intersectional transgenic labeling of boutons from vGlut2/Phox2b interneurons (left) and schematic of the results (right). b Coronal sections through the hindbrain of a Phox2b::Flpo ; vGlut2::Cre ; Rosa FTLG mouse at P4, showing synaptic boutons (black) from vGlut2/Phox2b interneurons in relation to motor nuclei (ChAT + , blue) at low (left), and higher (middle) magnifications, and close-ups of boutons (green) on motoneurons (right), which are either Phox2b + (purple) or Phox2b − (blue). c (left) Strategy for mono-synaptically restricted transsynaptic labeling of premotor neurons from the posterior digastric muscle (PD) in a Phox2b::Cre ; Rosa nlsLacZ mouse, with G-deleted rabies virus (RV) encoding mCherry and complemented by a G-encoding helper HSV virus ( HSV-YFP - G ), and summary of the results. (right panel) The only seed neurons are Acc7 motoneurons, double-labeled by the HSV-G and RV-mCherry viruses. d , e Coronal sections through the hindbrain at P8 showing labeled premotor neurons (black on the left panels) in the IRt ( d ) and Peri5 ( e ), which for the most part (72.7% ± 3.5 SEM, n = 4 animals) express Phox2b (right panels). AD anterior digastric, IRt intermediate reticular formation, nTS nucleus of the solitary tract, PD posterior digastric, Peri5 peritrigeminal area, RF reticular formation, RTN retrotrapezoid nucleus. Scale bars, b 1 mm for the left column, c 250 μm, d , e 500 μm.

Article Snippet: Primary antibodies used were: goat anti- Phox2b (RD system AF4940, diluted 1:100), rabbit anti-peripherin (Abcam ab4666, 1:1000), guinea pig anti-Lmx1b (Müller et al., 2002, 1:1000), goat anti-ChAT (Millipore AB144p), 1:100), chicken anti-βGal (Abcam, ab9361, 1:1000), chicken anti- GFP (Aves Labs, GFP-1020,1:1000), goat anti-ChAT (Millipore, AB144p, 1:100), rabbit anti- GFP (Invitrogen, A11122, 1:1000), rabbit anti- Phox2b (Pattyn et al., 1997,1:500), rat anti-RFP (Chromotek, 5F8, 1:1000), and goat anti-CTB (List Labs, #703, 1:500).

Techniques: Transgenic Assay, Labeling, Virus

a Two schematic hemisections of the embryonic medulla (left) or pons (right), showing the origin of branchiomotor nuclei (Mo5, MoA, and Mo10), Peri5 Phox2b and IRt Phox2b in progenitor (p) domains of the ventricular layer (VL), their settling sites in the mantle layer (ML), and their transcriptional codes. b – d Coronal sections through the pons at E18.5, showing Peri5 Phox2b ( b ) or Peri5 Atoh1 ( c , d ) labeled with the indicated antibody or probe. Peri5 Atoh1 cells co-express Phox2b and Atoh1 (arrowheads in d ). e Coronal sections through Mo5 in a Phox2b::Flpo;Atoh1::Cre ; Fela mouse at P0, showing the doubly recombined (nlsLacZ + ) cells of Peri5 Atoh1 (red). f Coronal section through Mo5 in a Phox2b::Flpo;Atoh1::Cre ; Fela mouse, where Phox2b + motoneurons are GFP + (cyan) and Phox2b + /Atoh1 + neurons are nlsLacZ + (red), counterstained for Lbx1 (gray at low magnification, green in the close-ups). g Coronal section through the pons at E11.5 showing the migrating Phox2b + Mo5 and dB2 precursors (black and brown arrowheads, respectively) and, at their meeting point, Peri5 Atoh1 cells that have switched on Atoh1 . Asterisk: lateral recess of the IVth ventricle (IV). h Coronal sections through nTS (yellow arrowhead) and IRt Phox2b (blue arrowhead) at E18.5, at low magnification (upper) or at high magnification for the IRt (lower), stained with the indicated antibodies. A history of Olig3 expression is revealed by recombination of the histone-GFP ( hGFP ) reporter in the Olig3::Cre ERT2 background (left). Mosaicism is likely due to incomplete induction of Cre. Virtually all cells of IRt Phox2b (98% ± 0.2 SEM, n = 3 animals) co-expressed Lmx1b with Phox2b . i Coronal sections through nTS (brown arrowhead) and IRt Phox2b (blue arrowhead) at indicated stages at low magnification (upper) and high magnification for the IRt (lower), immunostained for Phox2b and in situ hybridized for Cited1 . j Coronal section at E15.5 showing that nTS and IRt Phox2b are separated by the medullary root of the vagus nerve (nX). Sp5 spinal trigeminal tract. k Coronal section through the nTS and IRt Phox2b of an adult, showing the central boutons of epibranchial ganglia (that express Foxg1 and are labeled by SypGFP in a Foxg1 iresCre ; Phox2b::Flpo;Rosa FTLG background) in the nTS, but not IRt Phox2b (left). Magnified details (right). Scale bars, b , c 125 μm, d 50 μm, e , f 100 μm, g , h , j , k 200 μm, and i , 250 μm.

Journal: Nature Communications

Article Title: A medullary centre for lapping in mice

doi: 10.1038/s41467-021-26275-y

Figure Lengend Snippet: a Two schematic hemisections of the embryonic medulla (left) or pons (right), showing the origin of branchiomotor nuclei (Mo5, MoA, and Mo10), Peri5 Phox2b and IRt Phox2b in progenitor (p) domains of the ventricular layer (VL), their settling sites in the mantle layer (ML), and their transcriptional codes. b – d Coronal sections through the pons at E18.5, showing Peri5 Phox2b ( b ) or Peri5 Atoh1 ( c , d ) labeled with the indicated antibody or probe. Peri5 Atoh1 cells co-express Phox2b and Atoh1 (arrowheads in d ). e Coronal sections through Mo5 in a Phox2b::Flpo;Atoh1::Cre ; Fela mouse at P0, showing the doubly recombined (nlsLacZ + ) cells of Peri5 Atoh1 (red). f Coronal section through Mo5 in a Phox2b::Flpo;Atoh1::Cre ; Fela mouse, where Phox2b + motoneurons are GFP + (cyan) and Phox2b + /Atoh1 + neurons are nlsLacZ + (red), counterstained for Lbx1 (gray at low magnification, green in the close-ups). g Coronal section through the pons at E11.5 showing the migrating Phox2b + Mo5 and dB2 precursors (black and brown arrowheads, respectively) and, at their meeting point, Peri5 Atoh1 cells that have switched on Atoh1 . Asterisk: lateral recess of the IVth ventricle (IV). h Coronal sections through nTS (yellow arrowhead) and IRt Phox2b (blue arrowhead) at E18.5, at low magnification (upper) or at high magnification for the IRt (lower), stained with the indicated antibodies. A history of Olig3 expression is revealed by recombination of the histone-GFP ( hGFP ) reporter in the Olig3::Cre ERT2 background (left). Mosaicism is likely due to incomplete induction of Cre. Virtually all cells of IRt Phox2b (98% ± 0.2 SEM, n = 3 animals) co-expressed Lmx1b with Phox2b . i Coronal sections through nTS (brown arrowhead) and IRt Phox2b (blue arrowhead) at indicated stages at low magnification (upper) and high magnification for the IRt (lower), immunostained for Phox2b and in situ hybridized for Cited1 . j Coronal section at E15.5 showing that nTS and IRt Phox2b are separated by the medullary root of the vagus nerve (nX). Sp5 spinal trigeminal tract. k Coronal section through the nTS and IRt Phox2b of an adult, showing the central boutons of epibranchial ganglia (that express Foxg1 and are labeled by SypGFP in a Foxg1 iresCre ; Phox2b::Flpo;Rosa FTLG background) in the nTS, but not IRt Phox2b (left). Magnified details (right). Scale bars, b , c 125 μm, d 50 μm, e , f 100 μm, g , h , j , k 200 μm, and i , 250 μm.

Article Snippet: Primary antibodies used were: goat anti- Phox2b (RD system AF4940, diluted 1:100), rabbit anti-peripherin (Abcam ab4666, 1:1000), guinea pig anti-Lmx1b (Müller et al., 2002, 1:1000), goat anti-ChAT (Millipore AB144p), 1:100), chicken anti-βGal (Abcam, ab9361, 1:1000), chicken anti- GFP (Aves Labs, GFP-1020,1:1000), goat anti-ChAT (Millipore, AB144p, 1:100), rabbit anti- GFP (Invitrogen, A11122, 1:1000), rabbit anti- Phox2b (Pattyn et al., 1997,1:500), rat anti-RFP (Chromotek, 5F8, 1:1000), and goat anti-CTB (List Labs, #703, 1:500).

Techniques: Labeling, Staining, Expressing, In Situ

a Strategy for the transgenic labeling of projections from Peri5 Atoh1 (and RTN) and summary of the results; b – f Coronal ( b – d , f ) or parasagittal ( e ) sections through a P8 hindbrain showing GFP -labeled boutons (black) on motoneurons (blue) at medium (left) and high (right) magnification. g Strategy for the viral tracing of projections from IRt Phox2b and summary of the results (left), and mGFP-labeled infected cells of IRt Phox2b (right); h – l Coronal ( h – j , l ) or parasagittal ( k ) sections through a P56 hindbrain showing the GFP -labeled fibers (black) of IRt Phox2b neurons at low (left) and medium (middle) magnifications, and in extreme close-ups (right), together with Syp-mRuby labeled boutons (yellow) on motoneurons (blue). m schematic for retrograde tracing of premotor neurons for the right posterior digastric muscle, in a Phox2b::Cre ; Rosa SypGFP , and summary of the results. n – q (left) Coronal sections through the hindbrain at P8 showing the mCherry + projections (black) of premotor neurons on the motor nuclei (ChAT + , blue); (right) close-ups on motoneurons receiving double-labeled Syp-GFP / mCherry boutons (yellow). Scale bars, b – f 200 μm for the left column, h – l 500 μm for the left column, n – q 200 μm for the left column.

Journal: Nature Communications

Article Title: A medullary centre for lapping in mice

doi: 10.1038/s41467-021-26275-y

Figure Lengend Snippet: a Strategy for the transgenic labeling of projections from Peri5 Atoh1 (and RTN) and summary of the results; b – f Coronal ( b – d , f ) or parasagittal ( e ) sections through a P8 hindbrain showing GFP -labeled boutons (black) on motoneurons (blue) at medium (left) and high (right) magnification. g Strategy for the viral tracing of projections from IRt Phox2b and summary of the results (left), and mGFP-labeled infected cells of IRt Phox2b (right); h – l Coronal ( h – j , l ) or parasagittal ( k ) sections through a P56 hindbrain showing the GFP -labeled fibers (black) of IRt Phox2b neurons at low (left) and medium (middle) magnifications, and in extreme close-ups (right), together with Syp-mRuby labeled boutons (yellow) on motoneurons (blue). m schematic for retrograde tracing of premotor neurons for the right posterior digastric muscle, in a Phox2b::Cre ; Rosa SypGFP , and summary of the results. n – q (left) Coronal sections through the hindbrain at P8 showing the mCherry + projections (black) of premotor neurons on the motor nuclei (ChAT + , blue); (right) close-ups on motoneurons receiving double-labeled Syp-GFP / mCherry boutons (yellow). Scale bars, b – f 200 μm for the left column, h – l 500 μm for the left column, n – q 200 μm for the left column.

Article Snippet: Primary antibodies used were: goat anti- Phox2b (RD system AF4940, diluted 1:100), rabbit anti-peripherin (Abcam ab4666, 1:1000), guinea pig anti-Lmx1b (Müller et al., 2002, 1:1000), goat anti-ChAT (Millipore AB144p), 1:100), chicken anti-βGal (Abcam, ab9361, 1:1000), chicken anti- GFP (Aves Labs, GFP-1020,1:1000), goat anti-ChAT (Millipore, AB144p, 1:100), rabbit anti- GFP (Invitrogen, A11122, 1:1000), rabbit anti- Phox2b (Pattyn et al., 1997,1:500), rat anti-RFP (Chromotek, 5F8, 1:1000), and goat anti-CTB (List Labs, #703, 1:500).

Techniques: Transgenic Assay, Labeling, Infection, Retrograde Tracing

a (Upper left) Schematic of the viral injection and fiber-optic implantation for stimulation of IRt Phox2b , and transverse section through the hindbrain showing transduced IRt Phox2b neurons and position of optical fiber (OF, asterisk); scale bar 100 μm. (Upper right) Example frames of the mouse face before and during stimulation including DeepLabCut tracked position of the jaw (blue) and tongue (red). (Lower) Individual traces of tracked jaw and tongue position on the Y-axis upon 50 ms stimulation (five trials). b (Upper left) Schematic of the viral injection and fiber-optic implantation for stimulation of Peri5 Atoh1 and transverse section through the hindbrain showing transduced Peri5 Atoh1 neurons and position of optical fiber (asterisk); scale bar 200 μm. (Upper right) Example frames of the mouse face before and during stimulation including DeepLabCut tracked position of jaw (blue). (Lower) Individual traces (five trials) of tracked jaw position on the Y-axis upon 50 ms stimulation. c Individual traces (five trials) of the tracked jaw (left) and tongue (right) position on the Y-axis upon stimulation of IRt Phox2b of increasing length. A repetitive movement is triggered by stimulation beyond 300 ms (arrowhead). d Individual traces (five trials) of tracked jaw position on the Y-axis upon a 1000 ms stimulation of Peri5 Atoh1 . The jaw remains open and quivers non-rhythmically during the stimulus. e (Left) Schematic of viral injection and optical fiber implantation for observation of IRt Phox2b activity, and transverse section through the hindbrain showing transduced IRt Phox2b neurons and position of optical fiber (asterisk); scale bar 100 μm. (Right) Example frames of the mouse face before and during a bout of licking from a lick port (arrowhead), during a photometry recording, including DeepLabCut tracked position of the jaw (blue) and tongue (red). f Example trace of change in bulk fluorescence of IRt Phox2b during a recording session (∼2 min) of unitary licking events and licking bouts (red arrowheads), contact events with the lick port, and movements of the tongue and the jaw on the Y-axis. g (left) Superimposed correlation curves between licking activity and calcium activity (each curve corresponding to one of 15 recording sessions, each 1–5 min, in one mouse) which peaked at 1.2 s after lick port contact; (right) no peak was observed after shuffling the data.

Journal: Nature Communications

Article Title: A medullary centre for lapping in mice

doi: 10.1038/s41467-021-26275-y

Figure Lengend Snippet: a (Upper left) Schematic of the viral injection and fiber-optic implantation for stimulation of IRt Phox2b , and transverse section through the hindbrain showing transduced IRt Phox2b neurons and position of optical fiber (OF, asterisk); scale bar 100 μm. (Upper right) Example frames of the mouse face before and during stimulation including DeepLabCut tracked position of the jaw (blue) and tongue (red). (Lower) Individual traces of tracked jaw and tongue position on the Y-axis upon 50 ms stimulation (five trials). b (Upper left) Schematic of the viral injection and fiber-optic implantation for stimulation of Peri5 Atoh1 and transverse section through the hindbrain showing transduced Peri5 Atoh1 neurons and position of optical fiber (asterisk); scale bar 200 μm. (Upper right) Example frames of the mouse face before and during stimulation including DeepLabCut tracked position of jaw (blue). (Lower) Individual traces (five trials) of tracked jaw position on the Y-axis upon 50 ms stimulation. c Individual traces (five trials) of the tracked jaw (left) and tongue (right) position on the Y-axis upon stimulation of IRt Phox2b of increasing length. A repetitive movement is triggered by stimulation beyond 300 ms (arrowhead). d Individual traces (five trials) of tracked jaw position on the Y-axis upon a 1000 ms stimulation of Peri5 Atoh1 . The jaw remains open and quivers non-rhythmically during the stimulus. e (Left) Schematic of viral injection and optical fiber implantation for observation of IRt Phox2b activity, and transverse section through the hindbrain showing transduced IRt Phox2b neurons and position of optical fiber (asterisk); scale bar 100 μm. (Right) Example frames of the mouse face before and during a bout of licking from a lick port (arrowhead), during a photometry recording, including DeepLabCut tracked position of the jaw (blue) and tongue (red). f Example trace of change in bulk fluorescence of IRt Phox2b during a recording session (∼2 min) of unitary licking events and licking bouts (red arrowheads), contact events with the lick port, and movements of the tongue and the jaw on the Y-axis. g (left) Superimposed correlation curves between licking activity and calcium activity (each curve corresponding to one of 15 recording sessions, each 1–5 min, in one mouse) which peaked at 1.2 s after lick port contact; (right) no peak was observed after shuffling the data.

Article Snippet: Primary antibodies used were: goat anti- Phox2b (RD system AF4940, diluted 1:100), rabbit anti-peripherin (Abcam ab4666, 1:1000), guinea pig anti-Lmx1b (Müller et al., 2002, 1:1000), goat anti-ChAT (Millipore AB144p), 1:100), chicken anti-βGal (Abcam, ab9361, 1:1000), chicken anti- GFP (Aves Labs, GFP-1020,1:1000), goat anti-ChAT (Millipore, AB144p, 1:100), rabbit anti- GFP (Invitrogen, A11122, 1:1000), rabbit anti- Phox2b (Pattyn et al., 1997,1:500), rat anti-RFP (Chromotek, 5F8, 1:1000), and goat anti-CTB (List Labs, #703, 1:500).

Techniques: Injection, Activity Assay, Fluorescence

a Strategy for the retrograde transsynaptic labeling of input neurons to IRt Phox2b with exemplar sites of input. b Bar graph of the relative percentage of monosynaptic input neurons labeled from IRt Phox2b starter neurons, displayed per brain region as defined in the Allen Brain Atlas ( n = 4063 input cells and n = 598 starter cells, from n = 3 animals; individual values as circles; seeding efficiency = 7.4 inputs/starters ± 1.8 SEM). Rabies labeled input neurons were largely (74.5 ± 1.1% SEM) restricted to the medulla (pink, MY) and exhibited a slight but consistent ipsilateral bias (55.6 ± 3.0% SEM). Major sources of these medullary inputs were the intermediate, gigantocellular, and parvocellular reticular nuclei. Inputs from the cortex, midbrain, and pons represented a minority of rabies-labeled neurons (1.6 ± 0.3% SEM, 6.4 ± 0.5% SEM, and 12.3 ± 1.1% SEM respectively). c – g Images at low magnification (left) and high magnification (right) of monosynaptic input neurons in the IRt, Peri5, mesencephalic nucleus of the trigeminal nerve, contralateral superior colliculus, and motor cortex. Green arrowheads: seed neurons; red arrowheads: ( n -1) IRt neurons. CB cerebellum, CNU caudoputamen, CTX cortex, DCN deep cerebellar nucleus, MB midbrain, Mes5 mesencephalic nucleus of the trigeminal nerve, MY myelencephalon, P pons, SC superior colliculus. Scale bar c – g 1 mm.

Journal: Nature Communications

Article Title: A medullary centre for lapping in mice

doi: 10.1038/s41467-021-26275-y

Figure Lengend Snippet: a Strategy for the retrograde transsynaptic labeling of input neurons to IRt Phox2b with exemplar sites of input. b Bar graph of the relative percentage of monosynaptic input neurons labeled from IRt Phox2b starter neurons, displayed per brain region as defined in the Allen Brain Atlas ( n = 4063 input cells and n = 598 starter cells, from n = 3 animals; individual values as circles; seeding efficiency = 7.4 inputs/starters ± 1.8 SEM). Rabies labeled input neurons were largely (74.5 ± 1.1% SEM) restricted to the medulla (pink, MY) and exhibited a slight but consistent ipsilateral bias (55.6 ± 3.0% SEM). Major sources of these medullary inputs were the intermediate, gigantocellular, and parvocellular reticular nuclei. Inputs from the cortex, midbrain, and pons represented a minority of rabies-labeled neurons (1.6 ± 0.3% SEM, 6.4 ± 0.5% SEM, and 12.3 ± 1.1% SEM respectively). c – g Images at low magnification (left) and high magnification (right) of monosynaptic input neurons in the IRt, Peri5, mesencephalic nucleus of the trigeminal nerve, contralateral superior colliculus, and motor cortex. Green arrowheads: seed neurons; red arrowheads: ( n -1) IRt neurons. CB cerebellum, CNU caudoputamen, CTX cortex, DCN deep cerebellar nucleus, MB midbrain, Mes5 mesencephalic nucleus of the trigeminal nerve, MY myelencephalon, P pons, SC superior colliculus. Scale bar c – g 1 mm.

Article Snippet: Primary antibodies used were: goat anti- Phox2b (RD system AF4940, diluted 1:100), rabbit anti-peripherin (Abcam ab4666, 1:1000), guinea pig anti-Lmx1b (Müller et al., 2002, 1:1000), goat anti-ChAT (Millipore AB144p), 1:100), chicken anti-βGal (Abcam, ab9361, 1:1000), chicken anti- GFP (Aves Labs, GFP-1020,1:1000), goat anti-ChAT (Millipore, AB144p, 1:100), rabbit anti- GFP (Invitrogen, A11122, 1:1000), rabbit anti- Phox2b (Pattyn et al., 1997,1:500), rat anti-RFP (Chromotek, 5F8, 1:1000), and goat anti-CTB (List Labs, #703, 1:500).

Techniques: Labeling

Checkpoints for the differentiation of parasympathetic neurons (A) Schematic of parasympathetic neuron differentiation protocol. (B) Table of checkpoints that cultures should go through for proper differentiation: hPSC (d0, white arrows point to bright borders), NC (d10, white arrows point to ridges), SCP (d16), and parasympathetic neurons (d30). (C) Phase contrast images of healthy hPSCs (left, white arrows point to bright borders) and unhappy hPSCs with differentiation (right, white arrows point to differentiating cells). (D) Phase contrast images of d10 NC ridges with not enough BMP4 (left), enough BMP4 (middle, white arrows point to ridges), and too much BMP4 (right, white arrows point to blisters). (E) Phase contrast image of seeding density for d1 NC. (F) Immunofluorescent image of d10 NC: DAPI (blue) and SOX10 (red). (G) NC can be directly replated or frozen to produce parasympathetic neurons. (H) Schematic of sympathetic neuron differentiation protocol. (I) Gene expression of SOX10, S100B , and PHOX2B by RT-qPCR for d14 sympathoblasts compared to d16 SCPs. n=4–7 biological replicate. Unpaired two-tailed t test.

Journal: STAR Protocols

Article Title: Protocol to derive postganglionic parasympathetic neurons using human pluripotent stem cells for electrophysiological and functional assessment

doi: 10.1016/j.xpro.2025.104001

Figure Lengend Snippet: Checkpoints for the differentiation of parasympathetic neurons (A) Schematic of parasympathetic neuron differentiation protocol. (B) Table of checkpoints that cultures should go through for proper differentiation: hPSC (d0, white arrows point to bright borders), NC (d10, white arrows point to ridges), SCP (d16), and parasympathetic neurons (d30). (C) Phase contrast images of healthy hPSCs (left, white arrows point to bright borders) and unhappy hPSCs with differentiation (right, white arrows point to differentiating cells). (D) Phase contrast images of d10 NC ridges with not enough BMP4 (left), enough BMP4 (middle, white arrows point to ridges), and too much BMP4 (right, white arrows point to blisters). (E) Phase contrast image of seeding density for d1 NC. (F) Immunofluorescent image of d10 NC: DAPI (blue) and SOX10 (red). (G) NC can be directly replated or frozen to produce parasympathetic neurons. (H) Schematic of sympathetic neuron differentiation protocol. (I) Gene expression of SOX10, S100B , and PHOX2B by RT-qPCR for d14 sympathoblasts compared to d16 SCPs. n=4–7 biological replicate. Unpaired two-tailed t test.

Article Snippet: Primer: PHOX2B F: CCTGAAGATCGACCTCACAGAG R: TTTTGCCCGAGGAGCCGTTCTT , OriGene , HP207358.

Techniques: Gene Expression, Quantitative RT-PCR, Two Tailed Test

Markers for human pluripotent stem cell-derived parasympathetic neurons (A) Expression of ChAT, VAChT, CHRNB4, and NPY2R by immunofluorescence for d30 parasympathetic neurons derived from either spheroid plating (top) or dissociated plating (bottom). (B) Gene expression of d30 parasympathetic neuron markers ( ASCL1, PHOX2B, PRPH, CHRNA3, ChAT, VAChT, NPY2R ) by RT-qPCR derived either through spheroid plating (left) or dissociated plating (right). n= 5 biological replicates.

Journal: STAR Protocols

Article Title: Protocol to derive postganglionic parasympathetic neurons using human pluripotent stem cells for electrophysiological and functional assessment

doi: 10.1016/j.xpro.2025.104001

Figure Lengend Snippet: Markers for human pluripotent stem cell-derived parasympathetic neurons (A) Expression of ChAT, VAChT, CHRNB4, and NPY2R by immunofluorescence for d30 parasympathetic neurons derived from either spheroid plating (top) or dissociated plating (bottom). (B) Gene expression of d30 parasympathetic neuron markers ( ASCL1, PHOX2B, PRPH, CHRNA3, ChAT, VAChT, NPY2R ) by RT-qPCR derived either through spheroid plating (left) or dissociated plating (right). n= 5 biological replicates.

Article Snippet: Primer: PHOX2B F: CCTGAAGATCGACCTCACAGAG R: TTTTGCCCGAGGAGCCGTTCTT , OriGene , HP207358.

Techniques: Derivative Assay, Expressing, Immunofluorescence, Gene Expression, Quantitative RT-PCR

GD2 and lineage marker expression in TH-MYCN tumors, primary explants and cell lines, and human neuroblastoma cell lines. (a) TH-MYCN +/+ neuroblastomas (NB), previously established and propagated TH-MYCN +/+ and human NB cell lines were examined for surface GD2 expression by flow cytometry in single, live, CD45- cells, and NCAM1+ and CD56+ for mouse and human NBs, respectively. Cell lines were passaged for 3 weeks to assess GD2 stability. (b) Fresh TH-MYCN +/+ tumors were explanted and carried in tissue culture to monitor the GD2+ proportion of tumor cells over time ex vivo. (c) Immunoblot detection of a principal adrenergic marker, Phox2b, principal mesenchymal marker, Yap1, and β-tubulin loading control. IMR5 and SHEP are neuroblastoma cell lines with a predominantly adrenergic or mesenchymal lineage, respectively. TH-MYCN +/+ primary tumors are predominantly adrenergic marker expressing. TH-MYCN +/+ tumor-derived cell lines are largely mesenchymal marker expressing when propagated ex vivo (>3 months, 3000-series cell lines) whereas marker expression is heterogeneous during earlier passage ex vivo (5000-series cell lines). (d) Immunocytochemistry and immunohistochemistry to detect Phox2b and Yap1 from FFPE cell line pellets or primary tumors are shown, concordant with immunoblot results.

Journal: Oncoimmunology

Article Title: TH-MYCN tumors, but not tumor-derived cell lines, are adrenergic lineage, GD2+, and responsive to anti-GD2 antibody therapy

doi: 10.1080/2162402X.2022.2075204

Figure Lengend Snippet: GD2 and lineage marker expression in TH-MYCN tumors, primary explants and cell lines, and human neuroblastoma cell lines. (a) TH-MYCN +/+ neuroblastomas (NB), previously established and propagated TH-MYCN +/+ and human NB cell lines were examined for surface GD2 expression by flow cytometry in single, live, CD45- cells, and NCAM1+ and CD56+ for mouse and human NBs, respectively. Cell lines were passaged for 3 weeks to assess GD2 stability. (b) Fresh TH-MYCN +/+ tumors were explanted and carried in tissue culture to monitor the GD2+ proportion of tumor cells over time ex vivo. (c) Immunoblot detection of a principal adrenergic marker, Phox2b, principal mesenchymal marker, Yap1, and β-tubulin loading control. IMR5 and SHEP are neuroblastoma cell lines with a predominantly adrenergic or mesenchymal lineage, respectively. TH-MYCN +/+ primary tumors are predominantly adrenergic marker expressing. TH-MYCN +/+ tumor-derived cell lines are largely mesenchymal marker expressing when propagated ex vivo (>3 months, 3000-series cell lines) whereas marker expression is heterogeneous during earlier passage ex vivo (5000-series cell lines). (d) Immunocytochemistry and immunohistochemistry to detect Phox2b and Yap1 from FFPE cell line pellets or primary tumors are shown, concordant with immunoblot results.

Article Snippet: Additional antibodies include Ly49H [3D10], and MHC Class II (I-A/I-E) [M5/114.15.2] from eBioscience, IL-15 Rα [888220], ULBP-1 [237104], and NCAM1 [809220] from R&D Systems, TGFβR-1 [RM0016-3A11] from Signalway, ULBP-1 from ThermoFisher Scientific, PGP9.5 [31A3] from Novus Biologicals, YAP1 [G6], and Phox2b [B11] from Santa Cruz Bio.

Techniques: Marker, Expressing, Flow Cytometry, Ex Vivo, Western Blot, Control, Derivative Assay, Immunocytochemistry, Immunohistochemistry