phoretix 1d software Search Results


90
Nonlinear Dynamics phoretix 1d software
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
Phoretix 1d Software, supplied by Nonlinear Dynamics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phoretix 1d software/product/Nonlinear Dynamics
Average 90 stars, based on 1 article reviews
phoretix 1d software - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED 2d gel analysis software phoretix 2005
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
2d Gel Analysis Software Phoretix 2005, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/2d gel analysis software phoretix 2005/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
2d gel analysis software phoretix 2005 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED 1d advanced 4.01 image analysis software
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
1d Advanced 4.01 Image Analysis Software, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1d advanced 4.01 image analysis software/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
1d advanced 4.01 image analysis software - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED 1d gel analysis software
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
1d Gel Analysis Software, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1d gel analysis software/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
1d gel analysis software - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED 1d advanced
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
1d Advanced, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1d advanced/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
1d advanced - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED densitometry software phoretix 1 d
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
Densitometry Software Phoretix 1 D, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/densitometry software phoretix 1 d/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
densitometry software phoretix 1 d - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED 1d, version 3.0, software image analyser
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
1d, Version 3.0, Software Image Analyser, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1d, version 3.0, software image analyser/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
1d, version 3.0, software image analyser - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED 1d pro software
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
1d Pro Software, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1d pro software/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
1d pro software - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED 1 d quantifier software
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
1 D Quantifier Software, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 d quantifier software/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
1 d quantifier software - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Cleaver Scientific phoretix 1d pro software
Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using <t>the</t> <t>Phoretix</t> <t>1D</t> software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.
Phoretix 1d Pro Software, supplied by Cleaver Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phoretix 1d pro software/product/Cleaver Scientific
Average 90 stars, based on 1 article reviews
phoretix 1d pro software - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED 1d software
Immunoblot analyses of thylakoid proteins from VIGS plants. A, Immunoblot analysis of thylakoid proteins loaded on the basis of equal total thylakoid proteins. Aliquots of 2.5 μg (¼ VIGS-GFP), 5 μg (½ VIGS-GFP), 10 μg (VIGS-GFP), and 10 μg (VIGS-TRX m) of total thylakoid proteins were loaded on the gels. Designations of thylakoid membrane protein complexes and their diagnostic components are labeled on the left. Three biological replicates were performed, and similar results were obtained. B, Semiquantitative analysis of thylakoid <t>proteins.</t> <t>Immunoblots</t> in A from three biological replicates were analyzed with Phoretix <t>1D</t> software (Phoretix International). The protein contents (per unit of thylakoid protein) of the thylakoid membranes from VIGS plants were normalized to the level of the β-subunit of the ATP synthase (CF1 β). Protein levels in the VIGS-TRX m plants are shown relative to the levels in the VIGS-GFP leaves (100%). Data are given as means ± sd of three biological replicates.
1d Software, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1d software/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
1d software - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PHORETIX INTERNATIONAL LIMITED 1d software package
Immunoblot analyses of thylakoid proteins from VIGS plants. A, Immunoblot analysis of thylakoid proteins loaded on the basis of equal total thylakoid proteins. Aliquots of 2.5 μg (¼ VIGS-GFP), 5 μg (½ VIGS-GFP), 10 μg (VIGS-GFP), and 10 μg (VIGS-TRX m) of total thylakoid proteins were loaded on the gels. Designations of thylakoid membrane protein complexes and their diagnostic components are labeled on the left. Three biological replicates were performed, and similar results were obtained. B, Semiquantitative analysis of thylakoid <t>proteins.</t> <t>Immunoblots</t> in A from three biological replicates were analyzed with Phoretix <t>1D</t> software (Phoretix International). The protein contents (per unit of thylakoid protein) of the thylakoid membranes from VIGS plants were normalized to the level of the β-subunit of the ATP synthase (CF1 β). Protein levels in the VIGS-TRX m plants are shown relative to the levels in the VIGS-GFP leaves (100%). Data are given as means ± sd of three biological replicates.
1d Software Package, supplied by PHORETIX INTERNATIONAL LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1d software package/product/PHORETIX INTERNATIONAL LIMITED
Average 90 stars, based on 1 article reviews
1d software package - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using the Phoretix 1D software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.

Journal:

Article Title: Analysis of Structural and Physiological Profiles To Assess the Effects of Cu on Biofilm Microbial Communities

doi: 10.1128/AEM.70.8.4512-4521.2004

Figure Lengend Snippet: Bacterial DGGE gel picture of biofilm samples exposed to 0, 1, 3, and 10 μM Cu and sampled on days 3, 5, 10, 17, and 24 of the exposure period. Gel image analysis was performed by using the Phoretix 1D software package. Background was subtracted, and bands were automatically detected and manually corrected. A band percentage matrix was generated, and sample similarities were analyzed by NMDS.

Article Snippet: The temperature program of the eukaryotic PCR was as follows: 5 min at 94°C; 30 cycles with an annealing temperature of 60°C (30 s) for the first 5 cycles and a touchdown step (in which the annealing temperature was decreased from 60 to 55°C) for 25 cycles, and extension at 68°C for 90 s. The final extension step lasted 10 min. PCR product concentrations were estimated by separation on 1% agarose gels stained with ethidium bromide and digital gel image analysis using Phoretix 1D software (Nonlinear Dynamics, Newcastle, United Kingdom). table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Primer a Sequence (5′ to 3′) Target site Characteristic GC-EUK1427F TCTGTGATGCCCTTAGATGTTCTGGG b 1427-1453 d Eukaryotic primer EUK1616R GCGGTGTGTACAAAGGGCAGGG 1616-1637 d Eukaryotic primer GC-CYA371F CAGCAGTGGGGAATTTTCC c 371-390 e Cyanobacterial primer CYA783R GACTACWGGGGTATCTAATCCCW 738-761 e Cyanobacterial primer GC-357F CCTACGGGAGGCAGCAG b 357-374 e Universal bacterial primer R518 ATTACCGCGGCTGCTGG 518-525 e Universal bacterial primer Open in a separate window a R (reverse) and F (forward) designations refer to primer orientation in relation to the rRNA. b A 40-nucleotide GC-rich clamp (5′-CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCC-3′) is attached to the 5′ end of the primer. c A 40-nucleotide GC-rich clamp (5′-CGCCCGCCGCGCCCCGCGCCGGTCCCGCCGCCCCGCCCG-3′) is attached to the 5′ end of the cyanobacterial primer. d Saccharomyces cerevisiae numbering of 18S rRNA nucleotides. e Escherichia coli numbering of 16S rRNA nucleotides.

Techniques: Software, Generated

Immunoblot analyses of thylakoid proteins from VIGS plants. A, Immunoblot analysis of thylakoid proteins loaded on the basis of equal total thylakoid proteins. Aliquots of 2.5 μg (¼ VIGS-GFP), 5 μg (½ VIGS-GFP), 10 μg (VIGS-GFP), and 10 μg (VIGS-TRX m) of total thylakoid proteins were loaded on the gels. Designations of thylakoid membrane protein complexes and their diagnostic components are labeled on the left. Three biological replicates were performed, and similar results were obtained. B, Semiquantitative analysis of thylakoid proteins. Immunoblots in A from three biological replicates were analyzed with Phoretix 1D software (Phoretix International). The protein contents (per unit of thylakoid protein) of the thylakoid membranes from VIGS plants were normalized to the level of the β-subunit of the ATP synthase (CF1 β). Protein levels in the VIGS-TRX m plants are shown relative to the levels in the VIGS-GFP leaves (100%). Data are given as means ± sd of three biological replicates.

Journal: Plant Physiology

Article Title: Evidence for a Role of Chloroplastic m-Type Thioredoxins in the Biogenesis of Photosystem II in Arabidopsis 1 [C] [W] [OPEN]

doi: 10.1104/pp.113.228353

Figure Lengend Snippet: Immunoblot analyses of thylakoid proteins from VIGS plants. A, Immunoblot analysis of thylakoid proteins loaded on the basis of equal total thylakoid proteins. Aliquots of 2.5 μg (¼ VIGS-GFP), 5 μg (½ VIGS-GFP), 10 μg (VIGS-GFP), and 10 μg (VIGS-TRX m) of total thylakoid proteins were loaded on the gels. Designations of thylakoid membrane protein complexes and their diagnostic components are labeled on the left. Three biological replicates were performed, and similar results were obtained. B, Semiquantitative analysis of thylakoid proteins. Immunoblots in A from three biological replicates were analyzed with Phoretix 1D software (Phoretix International). The protein contents (per unit of thylakoid protein) of the thylakoid membranes from VIGS plants were normalized to the level of the β-subunit of the ATP synthase (CF1 β). Protein levels in the VIGS-TRX m plants are shown relative to the levels in the VIGS-GFP leaves (100%). Data are given as means ± sd of three biological replicates.

Article Snippet: Immunoblots in A from three biological replicates were analyzed with Phoretix 1D software (Phoretix International).

Techniques: Western Blot, Diagnostic Assay, Labeling, Software