|
LanthaScreen® fluorescent nuclear receptor coregulator peptides contain known interaction motifs and are labeled with fluorescein. These peptides are matched and validated to complement the LanthaScreen® TR-FRET Nuclear Receptor Coregulator Assays. Assays developed using these reagents
|
Buy from Supplier |
|
Proteintech
pgc1β Pgc1β, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgc-1b/PPARGC1B+Antibody/pm40016725-95-38-39 Average 93 stars, based on 1 article reviews
pgc1β - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pcdna f Pcdna F, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgc-1b/pcDNA-f%3APGC1b+(Plasmid+%231031)/pmc09068611-224-27-33 Average 93 stars, based on 1 article reviews
pcdna f - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
OriGene
ppargc1b Ppargc1b, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgc-1b/PGC1+beta+(PPARGC1B)+(NM_133263)+Human+Untagged+Clone/pm28394398-85-14-18 Average 90 stars, based on 1 article reviews
ppargc1b - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Boster Bio
pgc 1α ![]() Pgc 1α, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgc-1b/Anti-PGC1+Alpha+%2F+Beta+PPARGC1B+Antibody/pmc12843931-64-16-45 Average 94 stars, based on 1 article reviews
pgc 1α - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
OriGene
plasmid hppargc1b ![]() Plasmid Hppargc1b, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgc-1b/PGC1+beta+(PPARGC1B)+(NM_133263)+Human+Tagged+ORF+Clone/pm28394398-85-7-18 Average 90 stars, based on 1 article reviews
plasmid hppargc1b - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Addgene inc
caccgatcggccggtgctgtacaat lenticrispr v2 hstat3grna ![]() Caccgatcggccggtgctgtacaat Lenticrispr V2 Hstat3grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgc-1b/pCMX-PGC1b+(Plasmid+%231032)/pmc06463934-59-11-54 Average 90 stars, based on 1 article reviews
caccgatcggccggtgctgtacaat lenticrispr v2 hstat3grna - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Nagai Nori USA INC
transcriptional coactivator pparg coactivator-1b (pgc-1b) ![]() Transcriptional Coactivator Pparg Coactivator 1b (Pgc 1b), supplied by Nagai Nori USA INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgc-1b/transcriptional+coactivator+pparg+coactivator+1b++pgc+1b+/pm19254566-6-12-6 Average 90 stars, based on 1 article reviews
transcriptional coactivator pparg coactivator-1b (pgc-1b) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Kamei Co Ltd
proliferator activated receptor g coactivator 1 b pgc 1b ![]() Proliferator Activated Receptor G Coactivator 1 B Pgc 1b, supplied by Kamei Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pgc-1b/1+1b+activated+b+coactivator+g+pgc+proliferator+receptor/10__1002_slash_ddr__20246-35-28-34 Average 86 stars, based on 1 article reviews
proliferator activated receptor g coactivator 1 b pgc 1b - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Metabolites
Article Title: Rutin Maintains the Thermogenic Phenotype of Beige Adipocytes and Concomitantly Suppresses Mitophagy Against Obesity in HFD Mice
doi: 10.3390/metabo16010012
Figure Lengend Snippet: Rutin preserves the molecular characteristics of beige adipocytes following withdrawal from cold exposure. ( A , B ) Western blot analysis and interpretation of brown adipocyte proteins UCP1, PGC-1α and PRDM16 in ND, HFD, and HFD + Rutin groups under cold exposure and withdrawal conditions. n = 3. ( C ) UCP1 immunohistochemistry in ND, HFD, and HFD + Rutin groups during cold exposure and withdrawal. Scale bar is 100 μm. Data represent the means ± SEMs. Significance was determined by two-way ANOVA followed by Tukey’s post hoc test for multiple comparisons. Statistical significance is represented as follows: ns indicates no significant difference; * p < 0.05, ** p < 0.01 *** p < 0.001 vs. Cold group; ## p < 0.01, ### p < 0.001 vs. HFD + −Cold group; $ p < 0.05, $$ p < 0.01, $$$ p < 0.001 vs. HFD + Cold group.
Article Snippet: The following antibodies were obtained from the named sources: PRDM16 (Affinit Biosciences, Hefei, China; DF13303, 1:1000),
Techniques: Western Blot, Immunohistochemistry