Journal: eLife

Article Title: Metabolic modulation regulates cardiac wall morphogenesis in zebrafish

doi: 10.7554/eLife.50161

Figure Lengend Snippet: ( a ) qPCR analysis of mRNA levels of glycolytic enzyme genes in control and Erbb2 overexpressing (OE) rat neonatal CMs ( n = 3). Error bars, s.e.m. ( b ) Staining for PKM2, CTNI and DNA (DAPI) in control and Erbb2 OE rat neonatal CMs; arrowheads point to PKM2+ CMs. ( c ) Western blot analysis of PKM2 levels in control and Erbb2 OE rat neonatal CMs. ( d ) Extracellular acidification rate (ECAR) analysis in control and Erbb2 OE rat neonatal CMs; glycolytic capacity shown on the right ( n = 7). Error bars, s.d. ( e ) qPCR analysis of mRNA levels of glycolytic enzyme genes in DMSO and Erbb2 inhibitor treated zebrafish hearts ( n = 3). Error bars, s.e.m.; *p<0.05 and **p<0.001 by two-tailed unpaired t -test. NS, not significant. Scale bar, 20 μm. Figure 2—source data 1. Mass spectrometry data. P7 WT and CAERBB 2 OE mouse hearts were isolated and protein expression levels analyzed by mass spectrometry. All presented proteins are statistically significant at p<0.05. Figure 2—source data 2. Primer sequences for qPCR analysis. Primer sequences used in . Figure 2—source data 3. Mean Ct values of qPCR analysis in .

Article Snippet: To generate adenovirus vectors encoding PDK3 (NM_001106581) or ERBB2 (NM_004448), the following primers were used to amplify Pdk3 from rat neonatal CM or ERBB2 from Addgene clone # 39321: Pdk3 (forward 5’- TAGAGATCTGGTACCGTCGACCACCATGCGGCTCTTCTACCG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTCTAGAAAGTTTTATTACTCTTGATCTTGTCC -3’); ERBB2 (forward 5’- TAGAGATCTGGTACCGTCGACGCGGCCGCACCACCATGTATCCATATGATGTTCCAGATTATGCTATGGAGCTGGCGGCCTTG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTTCACACTGGCACGTCCAG ).

Techniques: Control, Staining, Western Blot, Two Tailed Test, Mass Spectrometry, Isolation, Expressing

Journal: eLife

Article Title: Metabolic modulation regulates cardiac wall morphogenesis in zebrafish

doi: 10.7554/eLife.50161

Figure Lengend Snippet: ( a ) ECAR analysis in control and NRG1 treated rat neonatal CMs; glycolytic capacity shown on the right ( n = 7). ( b ) Confocal images (mid-sagittal sections) of 77 hpf zebrafish hearts treated with DMSO or Erbb2 inhibitor; magnified view of area in white boxes shown below; arrowheads point to CMs in the trabecular layer. Error bars, s.d.; *p<0.05 by two-tailed unpaired t -test. Scale bars, 20 μm.

Article Snippet: To generate adenovirus vectors encoding PDK3 (NM_001106581) or ERBB2 (NM_004448), the following primers were used to amplify Pdk3 from rat neonatal CM or ERBB2 from Addgene clone # 39321: Pdk3 (forward 5’- TAGAGATCTGGTACCGTCGACCACCATGCGGCTCTTCTACCG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTCTAGAAAGTTTTATTACTCTTGATCTTGTCC -3’); ERBB2 (forward 5’- TAGAGATCTGGTACCGTCGACGCGGCCGCACCACCATGTATCCATATGATGTTCCAGATTATGCTATGGAGCTGGCGGCCTTG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTTCACACTGGCACGTCCAG ).

Techniques: Control, Two Tailed Test

Journal: eLife

Article Title: Metabolic modulation regulates cardiac wall morphogenesis in zebrafish

doi: 10.7554/eLife.50161

Figure Lengend Snippet: ( a ) Confocal images (mid-sagittal sections) of 77 hpf hearts treated with DMSO, dichloroacetate (DCA) or Erbb2 inhibitor; magnified view of area in white boxes shown below; arrowheads point to CMs in the trabecular layer; percentage of CMs in the trabecular layer shown on the right ( n = 5–7 ventricles). ( b ) Confocal images (mid-sagittal sections) of 77 hpf Tg(myl7:BFP-CAAX) alone or in combination with Tg(myl7:pdha1aSTA-P2A-tdTomato) or Tg(myl7:pdk3b-P2A-tdTomato) hearts; magnified view of area in white boxes shown below; arrowheads point to CMs in the trabecular layer; percentage of CMs in the trabecular layer shown on the right ( n = 5–7 ventricles). ( c–e” ) Staining for CTNI, N-cadherin and DNA (DAPI) in control ( c ), Pdk3 ( d ) and Erbb2 ( e ) OE rat neonatal CMs; magnified view of area in yellow ( c’, d’, e’ ) and white ( c”, d”, e” ) boxes; percentage of CMs exhibiting membrane protrusions shown on the right ( n = 3 individual experiments; each value corresponds to an average of 30 CMs). Pdk3 and Erbb2 OE causes rat neonatal CMs to exhibit membrane protrusions (d’, e’; arrows) and cell-cell junction rearrangements (d’, e’; arrowheads). Error bars, s.e.m.; *p<0.05 and **p<0.001 by ANOVA followed by Tukey’s HSD test. Scale bars, 20 μm.

Article Snippet: To generate adenovirus vectors encoding PDK3 (NM_001106581) or ERBB2 (NM_004448), the following primers were used to amplify Pdk3 from rat neonatal CM or ERBB2 from Addgene clone # 39321: Pdk3 (forward 5’- TAGAGATCTGGTACCGTCGACCACCATGCGGCTCTTCTACCG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTCTAGAAAGTTTTATTACTCTTGATCTTGTCC -3’); ERBB2 (forward 5’- TAGAGATCTGGTACCGTCGACGCGGCCGCACCACCATGTATCCATATGATGTTCCAGATTATGCTATGGAGCTGGCGGCCTTG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTTCACACTGGCACGTCCAG ).

Techniques: Staining, Control, Membrane

Journal: eLife

Article Title: Metabolic modulation regulates cardiac wall morphogenesis in zebrafish

doi: 10.7554/eLife.50161

Figure Lengend Snippet:

Article Snippet: To generate adenovirus vectors encoding PDK3 (NM_001106581) or ERBB2 (NM_004448), the following primers were used to amplify Pdk3 from rat neonatal CM or ERBB2 from Addgene clone # 39321: Pdk3 (forward 5’- TAGAGATCTGGTACCGTCGACCACCATGCGGCTCTTCTACCG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTCTAGAAAGTTTTATTACTCTTGATCTTGTCC -3’); ERBB2 (forward 5’- TAGAGATCTGGTACCGTCGACGCGGCCGCACCACCATGTATCCATATGATGTTCCAGATTATGCTATGGAGCTGGCGGCCTTG -3’ and reverse 5’- GGATATCTTATCTAGAAGCTTTCACACTGGCACGTCCAG ).

Techniques: Software, Microscopy, Staining