pegfp-n2 expression vector Search Results


90
Becton Dickinson pegfp-n2 expression vector
Pegfp N2 Expression Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/pegfp+c1/pmc06674701-79-20-23
Average 90 stars, based on 1 article reviews
pegfp-n2 expression vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
GenScript corporation pegfp-n2/ptagrfp-c expression vectors pegfp-n2-hbmp-2/ptagrfp-c-hfgf2 recombinant plasmids
Pegfp N2/Ptagrfp C Expression Vectors Pegfp N2 Hbmp 2/Ptagrfp C Hfgf2 Recombinant Plasmids, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/recombinant+basic+fgf/pmc08166400-39-7-10
Average 90 stars, based on 1 article reviews
pegfp-n2/ptagrfp-c expression vectors pegfp-n2-hbmp-2/ptagrfp-c-hfgf2 recombinant plasmids - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega pegfp-n2
Pegfp N2, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/pegfp+n2/pmc05618797-83-6-10
Average 90 stars, based on 1 article reviews
pegfp-n2 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Becton Dickinson gfp expression vector
Gfp Expression Vector, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/pegfpn1/10__1523_slash_jneurosci__6186___08__2009-53-28-32
Average 90 stars, based on 1 article reviews
gfp expression vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

95
Addgene inc pegfp n2 vector
Pegfp N2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/pEGFP(C1)-RepoMan+(Plasmid+%2344212)/pm33333009-327-16-18
Average 95 stars, based on 1 article reviews
pegfp n2 vector - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

90
Promega pgem-t cloning and expression vector, carbenicillin resistance
Pgem T Cloning And Expression Vector, Carbenicillin Resistance, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/pgem+t+cloning+and+expression+vector++carbenicillin+resistance/10__1128_slash_jb__00082___15-83-90-92
Average 90 stars, based on 1 article reviews
pgem-t cloning and expression vector, carbenicillin resistance - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Becton Dickinson pegfp-n2 vectors
Pegfp N2 Vectors, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/pegfp+n2+vectors/10__1158_slash_0008___5472__can___07___1307-58-13-15
Average 90 stars, based on 1 article reviews
pegfp-n2 vectors - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Becton Dickinson pegfphjurp
Pegfphjurp, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/pegfphjurp/10__1158_slash_0008___5472__can___07___1307-58-7-15
Average 90 stars, based on 1 article reviews
pegfphjurp - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

93
Addgene inc mettl7a
A CRISPR screen for regulators of hPGCLC development using a custom CRISPR library. (A) Diagram showing the strategy for CRISPR-based genetic screen during hPGCLC induction in vitro . (B) FACS sorting of PGCLC(-)/AG − and PGCLC(+)/AG + at day 5 of induction. (C) PCA of all samples in the screen. (D) log 2 fold change of all sgRNAs in the custom CRISPR library in PGCLC(+) vs. PGCLC(-) cell populations. Data are average of two replicates. (E) Gene sets consisting of the significant hits in PGCLC(+) cells (top) or in PGCLC(-) cells (bottom) tested for enrichment in RNA-seq of genes most upregulated in PGCLC cells. (F) Normalized read counts of sgRNAs targeting TCL1A (top) and <t>METTL7A</t> (bottom) in PGCLC(+) vs. PGCLC(-) populations in screen replicates. Read counts in in PGCLC(-) cells set to 1.0.
Mettl7a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/METTL7A+pEGFP-N2+(890)+(Plasmid+%2362017)/pmc10752514-223-18-46
Average 93 stars, based on 1 article reviews
mettl7a - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

90
Addgene inc ripk3
Optogenetic control of necrosome formation and necroptosis. Data were shown as mean ± s.e.m. Photostimulation was applied at 470 nm at a power density of 4 mW cm −2 or using a 488‐nm confocal laser (5% output). DIC, differential interference contrast. Scale bar, 10 µm. a) Schematics illustrating tumor necrosis factor alpha (TNFα)‐induced necroptosis under physiological conditions (left) and the design principle of converting necroptosis into LiPOPtosis (right), which enables light‐triggered necrosome formation and subsequent necroptotic cell death. The photo‐responsive region of cryptochrome 2 (CRY2 PHR ) is fused with RIPK1 or <t>RIPK3</t> to manipulate necrosome formation with light. LiPOP1 is generated by fusing CRY2 PHR to an optimized N‐terminal fragment of MLKL (MLKL‐NT). In the dark, the engineeredCRY2‐MLKL‐NT exhibits minimal cytotoxic activity. Upon blue light illumination, CRY2 drives multimerization of MLKL‐NT to perforate PM to induce cell death, thereby mimicking RIPK1/3 induced phosphorylation of MLKL to expose the multimerizable NT domain to trigger necroptosis. NT, the N‐terminal domain of MLKL; PM, plasma membrane; RIPK1/3, receptor‐interacting serine/threonine‐protein kinase 1/3; FADD, Fas‐associated protein with death domain; Casp 8, caspase 8; P, phosphorylation site. b) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK1 (red) and RIPK3‐GFP (green) before and after photostimulation. The intensity profiles of RIPK3‐GFP (green) and mCh‐CRY2‐RIPK1 (red; across the white line) in response to photostimulation were plotted on the right. Also see Movie , Supporting Information. c) Immunoblot analysis of light‐inducible association of RIPK1 with RIPK3 and phosphorylation of RIPK3. HeLa cells were co‐transfected with RIPK3‐GFP and mCh‐CRY2‐RIPK1 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pRIPK3‐S277 antibodies (1:1000) were used to probe total RIPK3 and phosphorylated RIPK3, respectively. The duration of light stimulation was indicated above the blots. d) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK3 (red) and MLKL‐Venus (green) before and after photostimulation. The intensity profiles of mCh‐CRY2‐RIPK3 and MLKL‐Venus (across the white line) in response to blue light were plotted on the right. Also see Movie , Supporting Information. e) Immunoblot analysis of the photo‐triggered RIPK3‐MLKL interaction and activation of MLKL reported by its phosphorylation. HeLa cells were co‐transfected with MLKL‐Venus and mCherry‐CRY2‐RIPK3 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pMLKL‐S358 antibodies (1:1000) were used to probe total exogenous MLKL and its phosphorylation, respectively. f) The 3D structure of MLKL‐NT (PDB entry: 2MSV). Positively‐charged residues mutated in the study were indicated. g) Cartoon showing the design of MLKL‐NT‐mCherry‐CRY2 PHR hybrid constructs (termed as LiPOP). The cytotoxicity of each LiPOP variant before and after light illumination was summarized on the right. The triple‐mutation variant (H15A/K16A/R17A‐3A‐1; named as LiPOP1) showed the least dark activity while retaining a high degree of PM permeabilization upon photostimulation. The scale bar (white‐to‐red) indicates the relative degree of LiPOP‐mediated cytotoxicity. Also see Figure , Supporting Information. h–j) Time‐lapse confocal imaging of HeLa cells expressing LiPOP1 (red) upon exposure to blue light (h). Pacific Blue Annexin V (blue) was used as a PM marker and also as an indicator for PS translocation from the inner half leaflet of PM to the outer membrane during necroptotic cell death. Arrowheads indicate necroptotic bubble formation. Normalized fluorescence intensities of the cytosolic signal of LiPOP1 ((i), n = 62 cells from three independent assays) and Pacific Blue Annexin V staining ((j), n = 32 cells from three independent assays) upon photostimulation were also shown. Also see Movie , Supporting Information. k,l) light‐induced necroptotic cell death assessed by flow cytometry. HeLa cells expressing LiPOP1 were kept in the dark or exposed to blue light. Annexin V‐FITC was used to stain dying cells. HeLa cells expressing mCh‐CRY2 were used as CTRL. n = 3 (mean ± s.d.), **** P < 0.0001; ns, not significant (two‐tailed Student's t ‐test). m,n) Time‐lapse confocal imaging of HeLa cells co‐expressing LiPOP1 (red) and GCaMP6s‐CAAX (green; (m)). The intracellular Ca 2+ signals were reported by PM‐tethered GCaMP6s ( n = 27 cells from three independent assays; (n)) Cells were subjected to pulsed light stimulation (1 s ON for every 30 s). Also see Movie , Supporting Information. o) A lipid strip assay to confirm the light‐dependent interaction between LiPOP1 and various phospholipids spotted on a nitrocellulose membrane. The exact layout of lipids on the membrane was shown on the left. LiPOP1‐expressing HEK293T cells were lysed and incubated with the lipid membrane with or without blue light illumination (right). An anti‐mCherry (1:2000) antibody was used to probe the lipid‐bound fraction of LiPOP1.
Ripk3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/pEGFP-N2-RIPK3+(Plasmid+%2378822)/pmc08438606-190-34-36
Average 90 stars, based on 1 article reviews
ripk3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
BIODEV Formation et Consulting full-length human tmem59 (htmem59) cdnas
Optogenetic control of necrosome formation and necroptosis. Data were shown as mean ± s.e.m. Photostimulation was applied at 470 nm at a power density of 4 mW cm −2 or using a 488‐nm confocal laser (5% output). DIC, differential interference contrast. Scale bar, 10 µm. a) Schematics illustrating tumor necrosis factor alpha (TNFα)‐induced necroptosis under physiological conditions (left) and the design principle of converting necroptosis into LiPOPtosis (right), which enables light‐triggered necrosome formation and subsequent necroptotic cell death. The photo‐responsive region of cryptochrome 2 (CRY2 PHR ) is fused with RIPK1 or <t>RIPK3</t> to manipulate necrosome formation with light. LiPOP1 is generated by fusing CRY2 PHR to an optimized N‐terminal fragment of MLKL (MLKL‐NT). In the dark, the engineeredCRY2‐MLKL‐NT exhibits minimal cytotoxic activity. Upon blue light illumination, CRY2 drives multimerization of MLKL‐NT to perforate PM to induce cell death, thereby mimicking RIPK1/3 induced phosphorylation of MLKL to expose the multimerizable NT domain to trigger necroptosis. NT, the N‐terminal domain of MLKL; PM, plasma membrane; RIPK1/3, receptor‐interacting serine/threonine‐protein kinase 1/3; FADD, Fas‐associated protein with death domain; Casp 8, caspase 8; P, phosphorylation site. b) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK1 (red) and RIPK3‐GFP (green) before and after photostimulation. The intensity profiles of RIPK3‐GFP (green) and mCh‐CRY2‐RIPK1 (red; across the white line) in response to photostimulation were plotted on the right. Also see Movie , Supporting Information. c) Immunoblot analysis of light‐inducible association of RIPK1 with RIPK3 and phosphorylation of RIPK3. HeLa cells were co‐transfected with RIPK3‐GFP and mCh‐CRY2‐RIPK1 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pRIPK3‐S277 antibodies (1:1000) were used to probe total RIPK3 and phosphorylated RIPK3, respectively. The duration of light stimulation was indicated above the blots. d) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK3 (red) and MLKL‐Venus (green) before and after photostimulation. The intensity profiles of mCh‐CRY2‐RIPK3 and MLKL‐Venus (across the white line) in response to blue light were plotted on the right. Also see Movie , Supporting Information. e) Immunoblot analysis of the photo‐triggered RIPK3‐MLKL interaction and activation of MLKL reported by its phosphorylation. HeLa cells were co‐transfected with MLKL‐Venus and mCherry‐CRY2‐RIPK3 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pMLKL‐S358 antibodies (1:1000) were used to probe total exogenous MLKL and its phosphorylation, respectively. f) The 3D structure of MLKL‐NT (PDB entry: 2MSV). Positively‐charged residues mutated in the study were indicated. g) Cartoon showing the design of MLKL‐NT‐mCherry‐CRY2 PHR hybrid constructs (termed as LiPOP). The cytotoxicity of each LiPOP variant before and after light illumination was summarized on the right. The triple‐mutation variant (H15A/K16A/R17A‐3A‐1; named as LiPOP1) showed the least dark activity while retaining a high degree of PM permeabilization upon photostimulation. The scale bar (white‐to‐red) indicates the relative degree of LiPOP‐mediated cytotoxicity. Also see Figure , Supporting Information. h–j) Time‐lapse confocal imaging of HeLa cells expressing LiPOP1 (red) upon exposure to blue light (h). Pacific Blue Annexin V (blue) was used as a PM marker and also as an indicator for PS translocation from the inner half leaflet of PM to the outer membrane during necroptotic cell death. Arrowheads indicate necroptotic bubble formation. Normalized fluorescence intensities of the cytosolic signal of LiPOP1 ((i), n = 62 cells from three independent assays) and Pacific Blue Annexin V staining ((j), n = 32 cells from three independent assays) upon photostimulation were also shown. Also see Movie , Supporting Information. k,l) light‐induced necroptotic cell death assessed by flow cytometry. HeLa cells expressing LiPOP1 were kept in the dark or exposed to blue light. Annexin V‐FITC was used to stain dying cells. HeLa cells expressing mCh‐CRY2 were used as CTRL. n = 3 (mean ± s.d.), **** P < 0.0001; ns, not significant (two‐tailed Student's t ‐test). m,n) Time‐lapse confocal imaging of HeLa cells co‐expressing LiPOP1 (red) and GCaMP6s‐CAAX (green; (m)). The intracellular Ca 2+ signals were reported by PM‐tethered GCaMP6s ( n = 27 cells from three independent assays; (n)) Cells were subjected to pulsed light stimulation (1 s ON for every 30 s). Also see Movie , Supporting Information. o) A lipid strip assay to confirm the light‐dependent interaction between LiPOP1 and various phospholipids spotted on a nitrocellulose membrane. The exact layout of lipids on the membrane was shown on the left. LiPOP1‐expressing HEK293T cells were lysed and incubated with the lipid membrane with or without blue light illumination (right). An anti‐mCherry (1:2000) antibody was used to probe the lipid‐bound fraction of LiPOP1.
Full Length Human Tmem59 (Htmem59) Cdnas, supplied by BIODEV Formation et Consulting, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/full+length+human+tmem59++htmem59++cdnas/10__3390_slash_separations9110341-42-0-13
Average 90 stars, based on 1 article reviews
full-length human tmem59 (htmem59) cdnas - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

99
New England Biolabs ecori
Optogenetic control of necrosome formation and necroptosis. Data were shown as mean ± s.e.m. Photostimulation was applied at 470 nm at a power density of 4 mW cm −2 or using a 488‐nm confocal laser (5% output). DIC, differential interference contrast. Scale bar, 10 µm. a) Schematics illustrating tumor necrosis factor alpha (TNFα)‐induced necroptosis under physiological conditions (left) and the design principle of converting necroptosis into LiPOPtosis (right), which enables light‐triggered necrosome formation and subsequent necroptotic cell death. The photo‐responsive region of cryptochrome 2 (CRY2 PHR ) is fused with RIPK1 or <t>RIPK3</t> to manipulate necrosome formation with light. LiPOP1 is generated by fusing CRY2 PHR to an optimized N‐terminal fragment of MLKL (MLKL‐NT). In the dark, the engineeredCRY2‐MLKL‐NT exhibits minimal cytotoxic activity. Upon blue light illumination, CRY2 drives multimerization of MLKL‐NT to perforate PM to induce cell death, thereby mimicking RIPK1/3 induced phosphorylation of MLKL to expose the multimerizable NT domain to trigger necroptosis. NT, the N‐terminal domain of MLKL; PM, plasma membrane; RIPK1/3, receptor‐interacting serine/threonine‐protein kinase 1/3; FADD, Fas‐associated protein with death domain; Casp 8, caspase 8; P, phosphorylation site. b) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK1 (red) and RIPK3‐GFP (green) before and after photostimulation. The intensity profiles of RIPK3‐GFP (green) and mCh‐CRY2‐RIPK1 (red; across the white line) in response to photostimulation were plotted on the right. Also see Movie , Supporting Information. c) Immunoblot analysis of light‐inducible association of RIPK1 with RIPK3 and phosphorylation of RIPK3. HeLa cells were co‐transfected with RIPK3‐GFP and mCh‐CRY2‐RIPK1 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pRIPK3‐S277 antibodies (1:1000) were used to probe total RIPK3 and phosphorylated RIPK3, respectively. The duration of light stimulation was indicated above the blots. d) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK3 (red) and MLKL‐Venus (green) before and after photostimulation. The intensity profiles of mCh‐CRY2‐RIPK3 and MLKL‐Venus (across the white line) in response to blue light were plotted on the right. Also see Movie , Supporting Information. e) Immunoblot analysis of the photo‐triggered RIPK3‐MLKL interaction and activation of MLKL reported by its phosphorylation. HeLa cells were co‐transfected with MLKL‐Venus and mCherry‐CRY2‐RIPK3 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pMLKL‐S358 antibodies (1:1000) were used to probe total exogenous MLKL and its phosphorylation, respectively. f) The 3D structure of MLKL‐NT (PDB entry: 2MSV). Positively‐charged residues mutated in the study were indicated. g) Cartoon showing the design of MLKL‐NT‐mCherry‐CRY2 PHR hybrid constructs (termed as LiPOP). The cytotoxicity of each LiPOP variant before and after light illumination was summarized on the right. The triple‐mutation variant (H15A/K16A/R17A‐3A‐1; named as LiPOP1) showed the least dark activity while retaining a high degree of PM permeabilization upon photostimulation. The scale bar (white‐to‐red) indicates the relative degree of LiPOP‐mediated cytotoxicity. Also see Figure , Supporting Information. h–j) Time‐lapse confocal imaging of HeLa cells expressing LiPOP1 (red) upon exposure to blue light (h). Pacific Blue Annexin V (blue) was used as a PM marker and also as an indicator for PS translocation from the inner half leaflet of PM to the outer membrane during necroptotic cell death. Arrowheads indicate necroptotic bubble formation. Normalized fluorescence intensities of the cytosolic signal of LiPOP1 ((i), n = 62 cells from three independent assays) and Pacific Blue Annexin V staining ((j), n = 32 cells from three independent assays) upon photostimulation were also shown. Also see Movie , Supporting Information. k,l) light‐induced necroptotic cell death assessed by flow cytometry. HeLa cells expressing LiPOP1 were kept in the dark or exposed to blue light. Annexin V‐FITC was used to stain dying cells. HeLa cells expressing mCh‐CRY2 were used as CTRL. n = 3 (mean ± s.d.), **** P < 0.0001; ns, not significant (two‐tailed Student's t ‐test). m,n) Time‐lapse confocal imaging of HeLa cells co‐expressing LiPOP1 (red) and GCaMP6s‐CAAX (green; (m)). The intracellular Ca 2+ signals were reported by PM‐tethered GCaMP6s ( n = 27 cells from three independent assays; (n)) Cells were subjected to pulsed light stimulation (1 s ON for every 30 s). Also see Movie , Supporting Information. o) A lipid strip assay to confirm the light‐dependent interaction between LiPOP1 and various phospholipids spotted on a nitrocellulose membrane. The exact layout of lipids on the membrane was shown on the left. LiPOP1‐expressing HEK293T cells were lysed and incubated with the lipid membrane with or without blue light illumination (right). An anti‐mCherry (1:2000) antibody was used to probe the lipid‐bound fraction of LiPOP1.
Ecori, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pegfp-n2+expression+vector/EcoRI/custom%40r0101%4028334855
Average 99 stars, based on 1 article reviews
ecori - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

Image Search Results


A CRISPR screen for regulators of hPGCLC development using a custom CRISPR library. (A) Diagram showing the strategy for CRISPR-based genetic screen during hPGCLC induction in vitro . (B) FACS sorting of PGCLC(-)/AG − and PGCLC(+)/AG + at day 5 of induction. (C) PCA of all samples in the screen. (D) log 2 fold change of all sgRNAs in the custom CRISPR library in PGCLC(+) vs. PGCLC(-) cell populations. Data are average of two replicates. (E) Gene sets consisting of the significant hits in PGCLC(+) cells (top) or in PGCLC(-) cells (bottom) tested for enrichment in RNA-seq of genes most upregulated in PGCLC cells. (F) Normalized read counts of sgRNAs targeting TCL1A (top) and METTL7A (bottom) in PGCLC(+) vs. PGCLC(-) populations in screen replicates. Read counts in in PGCLC(-) cells set to 1.0.

Journal: PLOS Genetics

Article Title: CRISPR loss of function screening to identify genes involved in human primordial germ cell-like cell development

doi: 10.1371/journal.pgen.1011080

Figure Lengend Snippet: A CRISPR screen for regulators of hPGCLC development using a custom CRISPR library. (A) Diagram showing the strategy for CRISPR-based genetic screen during hPGCLC induction in vitro . (B) FACS sorting of PGCLC(-)/AG − and PGCLC(+)/AG + at day 5 of induction. (C) PCA of all samples in the screen. (D) log 2 fold change of all sgRNAs in the custom CRISPR library in PGCLC(+) vs. PGCLC(-) cell populations. Data are average of two replicates. (E) Gene sets consisting of the significant hits in PGCLC(+) cells (top) or in PGCLC(-) cells (bottom) tested for enrichment in RNA-seq of genes most upregulated in PGCLC cells. (F) Normalized read counts of sgRNAs targeting TCL1A (top) and METTL7A (bottom) in PGCLC(+) vs. PGCLC(-) populations in screen replicates. Read counts in in PGCLC(-) cells set to 1.0.

Article Snippet: Two pairs of sgRNAs targeting TCL1A (CGAGTGCCCGACACTCGGGG and GCAAGAGCCAGAGCCTCTCA for pre-exon1, and AGGTACAGCCAGCTTTGGAG and GGCTGTACCTCGATGGTTAA for post-exon1) or METTL7A (TACCATCTTTATCCTGAGAC and GTAAGCTCCATTGCTCAGAA for pre-exon1, and CGGGGAGAACATGCACCAGG and AGCGCTCAAACTGCAGGTGT for post-exon1) were selected and cloned into the pX335-U6-Chimeric BB-CBh-hSpCas9n (D10A) SpCas9n-expression vector to generate the sgRNAs/Cas9n vector (Addgene, #42335 [ ]).

Techniques: CRISPR, In Vitro, RNA Sequencing

Optogenetic control of necrosome formation and necroptosis. Data were shown as mean ± s.e.m. Photostimulation was applied at 470 nm at a power density of 4 mW cm −2 or using a 488‐nm confocal laser (5% output). DIC, differential interference contrast. Scale bar, 10 µm. a) Schematics illustrating tumor necrosis factor alpha (TNFα)‐induced necroptosis under physiological conditions (left) and the design principle of converting necroptosis into LiPOPtosis (right), which enables light‐triggered necrosome formation and subsequent necroptotic cell death. The photo‐responsive region of cryptochrome 2 (CRY2 PHR ) is fused with RIPK1 or RIPK3 to manipulate necrosome formation with light. LiPOP1 is generated by fusing CRY2 PHR to an optimized N‐terminal fragment of MLKL (MLKL‐NT). In the dark, the engineeredCRY2‐MLKL‐NT exhibits minimal cytotoxic activity. Upon blue light illumination, CRY2 drives multimerization of MLKL‐NT to perforate PM to induce cell death, thereby mimicking RIPK1/3 induced phosphorylation of MLKL to expose the multimerizable NT domain to trigger necroptosis. NT, the N‐terminal domain of MLKL; PM, plasma membrane; RIPK1/3, receptor‐interacting serine/threonine‐protein kinase 1/3; FADD, Fas‐associated protein with death domain; Casp 8, caspase 8; P, phosphorylation site. b) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK1 (red) and RIPK3‐GFP (green) before and after photostimulation. The intensity profiles of RIPK3‐GFP (green) and mCh‐CRY2‐RIPK1 (red; across the white line) in response to photostimulation were plotted on the right. Also see Movie , Supporting Information. c) Immunoblot analysis of light‐inducible association of RIPK1 with RIPK3 and phosphorylation of RIPK3. HeLa cells were co‐transfected with RIPK3‐GFP and mCh‐CRY2‐RIPK1 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pRIPK3‐S277 antibodies (1:1000) were used to probe total RIPK3 and phosphorylated RIPK3, respectively. The duration of light stimulation was indicated above the blots. d) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK3 (red) and MLKL‐Venus (green) before and after photostimulation. The intensity profiles of mCh‐CRY2‐RIPK3 and MLKL‐Venus (across the white line) in response to blue light were plotted on the right. Also see Movie , Supporting Information. e) Immunoblot analysis of the photo‐triggered RIPK3‐MLKL interaction and activation of MLKL reported by its phosphorylation. HeLa cells were co‐transfected with MLKL‐Venus and mCherry‐CRY2‐RIPK3 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pMLKL‐S358 antibodies (1:1000) were used to probe total exogenous MLKL and its phosphorylation, respectively. f) The 3D structure of MLKL‐NT (PDB entry: 2MSV). Positively‐charged residues mutated in the study were indicated. g) Cartoon showing the design of MLKL‐NT‐mCherry‐CRY2 PHR hybrid constructs (termed as LiPOP). The cytotoxicity of each LiPOP variant before and after light illumination was summarized on the right. The triple‐mutation variant (H15A/K16A/R17A‐3A‐1; named as LiPOP1) showed the least dark activity while retaining a high degree of PM permeabilization upon photostimulation. The scale bar (white‐to‐red) indicates the relative degree of LiPOP‐mediated cytotoxicity. Also see Figure , Supporting Information. h–j) Time‐lapse confocal imaging of HeLa cells expressing LiPOP1 (red) upon exposure to blue light (h). Pacific Blue Annexin V (blue) was used as a PM marker and also as an indicator for PS translocation from the inner half leaflet of PM to the outer membrane during necroptotic cell death. Arrowheads indicate necroptotic bubble formation. Normalized fluorescence intensities of the cytosolic signal of LiPOP1 ((i), n = 62 cells from three independent assays) and Pacific Blue Annexin V staining ((j), n = 32 cells from three independent assays) upon photostimulation were also shown. Also see Movie , Supporting Information. k,l) light‐induced necroptotic cell death assessed by flow cytometry. HeLa cells expressing LiPOP1 were kept in the dark or exposed to blue light. Annexin V‐FITC was used to stain dying cells. HeLa cells expressing mCh‐CRY2 were used as CTRL. n = 3 (mean ± s.d.), **** P < 0.0001; ns, not significant (two‐tailed Student's t ‐test). m,n) Time‐lapse confocal imaging of HeLa cells co‐expressing LiPOP1 (red) and GCaMP6s‐CAAX (green; (m)). The intracellular Ca 2+ signals were reported by PM‐tethered GCaMP6s ( n = 27 cells from three independent assays; (n)) Cells were subjected to pulsed light stimulation (1 s ON for every 30 s). Also see Movie , Supporting Information. o) A lipid strip assay to confirm the light‐dependent interaction between LiPOP1 and various phospholipids spotted on a nitrocellulose membrane. The exact layout of lipids on the membrane was shown on the left. LiPOP1‐expressing HEK293T cells were lysed and incubated with the lipid membrane with or without blue light illumination (right). An anti‐mCherry (1:2000) antibody was used to probe the lipid‐bound fraction of LiPOP1.

Journal: Advanced Science

Article Title: Optogenetic Control of Non‐Apoptotic Cell Death

doi: 10.1002/advs.202100424

Figure Lengend Snippet: Optogenetic control of necrosome formation and necroptosis. Data were shown as mean ± s.e.m. Photostimulation was applied at 470 nm at a power density of 4 mW cm −2 or using a 488‐nm confocal laser (5% output). DIC, differential interference contrast. Scale bar, 10 µm. a) Schematics illustrating tumor necrosis factor alpha (TNFα)‐induced necroptosis under physiological conditions (left) and the design principle of converting necroptosis into LiPOPtosis (right), which enables light‐triggered necrosome formation and subsequent necroptotic cell death. The photo‐responsive region of cryptochrome 2 (CRY2 PHR ) is fused with RIPK1 or RIPK3 to manipulate necrosome formation with light. LiPOP1 is generated by fusing CRY2 PHR to an optimized N‐terminal fragment of MLKL (MLKL‐NT). In the dark, the engineeredCRY2‐MLKL‐NT exhibits minimal cytotoxic activity. Upon blue light illumination, CRY2 drives multimerization of MLKL‐NT to perforate PM to induce cell death, thereby mimicking RIPK1/3 induced phosphorylation of MLKL to expose the multimerizable NT domain to trigger necroptosis. NT, the N‐terminal domain of MLKL; PM, plasma membrane; RIPK1/3, receptor‐interacting serine/threonine‐protein kinase 1/3; FADD, Fas‐associated protein with death domain; Casp 8, caspase 8; P, phosphorylation site. b) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK1 (red) and RIPK3‐GFP (green) before and after photostimulation. The intensity profiles of RIPK3‐GFP (green) and mCh‐CRY2‐RIPK1 (red; across the white line) in response to photostimulation were plotted on the right. Also see Movie , Supporting Information. c) Immunoblot analysis of light‐inducible association of RIPK1 with RIPK3 and phosphorylation of RIPK3. HeLa cells were co‐transfected with RIPK3‐GFP and mCh‐CRY2‐RIPK1 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pRIPK3‐S277 antibodies (1:1000) were used to probe total RIPK3 and phosphorylated RIPK3, respectively. The duration of light stimulation was indicated above the blots. d) Confocal images of HeLa cells co‐expressing mCh‐CRY2‐RIPK3 (red) and MLKL‐Venus (green) before and after photostimulation. The intensity profiles of mCh‐CRY2‐RIPK3 and MLKL‐Venus (across the white line) in response to blue light were plotted on the right. Also see Movie , Supporting Information. e) Immunoblot analysis of the photo‐triggered RIPK3‐MLKL interaction and activation of MLKL reported by its phosphorylation. HeLa cells were co‐transfected with MLKL‐Venus and mCherry‐CRY2‐RIPK3 and subjected to photostimulation. Anti‐full length GFP (1:1000) and pMLKL‐S358 antibodies (1:1000) were used to probe total exogenous MLKL and its phosphorylation, respectively. f) The 3D structure of MLKL‐NT (PDB entry: 2MSV). Positively‐charged residues mutated in the study were indicated. g) Cartoon showing the design of MLKL‐NT‐mCherry‐CRY2 PHR hybrid constructs (termed as LiPOP). The cytotoxicity of each LiPOP variant before and after light illumination was summarized on the right. The triple‐mutation variant (H15A/K16A/R17A‐3A‐1; named as LiPOP1) showed the least dark activity while retaining a high degree of PM permeabilization upon photostimulation. The scale bar (white‐to‐red) indicates the relative degree of LiPOP‐mediated cytotoxicity. Also see Figure , Supporting Information. h–j) Time‐lapse confocal imaging of HeLa cells expressing LiPOP1 (red) upon exposure to blue light (h). Pacific Blue Annexin V (blue) was used as a PM marker and also as an indicator for PS translocation from the inner half leaflet of PM to the outer membrane during necroptotic cell death. Arrowheads indicate necroptotic bubble formation. Normalized fluorescence intensities of the cytosolic signal of LiPOP1 ((i), n = 62 cells from three independent assays) and Pacific Blue Annexin V staining ((j), n = 32 cells from three independent assays) upon photostimulation were also shown. Also see Movie , Supporting Information. k,l) light‐induced necroptotic cell death assessed by flow cytometry. HeLa cells expressing LiPOP1 were kept in the dark or exposed to blue light. Annexin V‐FITC was used to stain dying cells. HeLa cells expressing mCh‐CRY2 were used as CTRL. n = 3 (mean ± s.d.), **** P < 0.0001; ns, not significant (two‐tailed Student's t ‐test). m,n) Time‐lapse confocal imaging of HeLa cells co‐expressing LiPOP1 (red) and GCaMP6s‐CAAX (green; (m)). The intracellular Ca 2+ signals were reported by PM‐tethered GCaMP6s ( n = 27 cells from three independent assays; (n)) Cells were subjected to pulsed light stimulation (1 s ON for every 30 s). Also see Movie , Supporting Information. o) A lipid strip assay to confirm the light‐dependent interaction between LiPOP1 and various phospholipids spotted on a nitrocellulose membrane. The exact layout of lipids on the membrane was shown on the left. LiPOP1‐expressing HEK293T cells were lysed and incubated with the lipid membrane with or without blue light illumination (right). An anti‐mCherry (1:2000) antibody was used to probe the lipid‐bound fraction of LiPOP1.

Article Snippet: pGP‐CMV‐GCaMP6s‐CAAX (#52228), pUAS‐NanoLuc (#87696), packing vectors pMD2.G (#12259), and psPAX2 (#12260), and the lentiviral vector pWPXL (#12257) were obtained from Addgene. mCherry‐CRY2‐RIPK1 and mCherry‐CRY2‐RIPK3 were generated by inserting the cDNAs encoding RIPK1 (#78842, Addgene), RIPK3 (#78822, Addgene) into a home‐made vector mCherry‐CRY2 PHR modified from pmCherry‐C1.

Techniques: Control, Generated, Activity Assay, Phospho-proteomics, Clinical Proteomics, Membrane, Expressing, Western Blot, Transfection, Activation Assay, Construct, Variant Assay, Mutagenesis, Imaging, Marker, Translocation Assay, Fluorescence, Staining, Flow Cytometry, Two Tailed Test, Stripping Membranes, Incubation