pdgfra Search Results


94
Thermo Fisher gene exp pdgfra mm01211685 m1
Gene Exp Pdgfra Mm01211685 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/Gene+Exp%2E+Pdgfra%2C+Mm01211685_m1/pmc12939824-61-2--1
Average 94 stars, based on 1 article reviews
gene exp pdgfra mm01211685 m1 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Sangon Biotech ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer
Ggcttctttcgcacaatctcaat Sangon Biotech N A Pdgfra Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/a+biotech+ggcttctttcgcacaatctcaat+n+pdgfra+primer+sangon/pm35863346-241-84-85
Average 86 stars, based on 1 article reviews
ggcttctttcgcacaatctcaat sangon biotech n a pdgfra primer - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory b6 cg
B6 Cg, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/cre+mice+pdgfra/pm40158217-496-172-174
Average 86 stars, based on 1 article reviews
b6 cg - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
OriGene pdgfra mouse 27mer sirna duplexe c
Pdgfra Mouse 27mer Sirna Duplexe C, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/Pdgfra+Mouse+siRNA+Oligo+Duplex/pmc06137712__mmc1-60-16-23
Average 90 stars, based on 1 article reviews
pdgfra mouse 27mer sirna duplexe c - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc pdgfrβ
Pdgfrβ, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/pDONR223-PDGFRA+(Plasmid+%2323892)/pmc06514402-598-5-10
Average 93 stars, based on 1 article reviews
pdgfrβ - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Miltenyi Biotec cd140a pe
Cd140a Pe, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/CD140a+Antibody%2C+anti-mouse/ppr0452464-61-24-26
Average 96 stars, based on 1 article reviews
cd140a pe - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

94
Proteintech pdgfra
Pdgfra, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/PDGFRA+Antibody/pmc04974072-19-16-23
Average 94 stars, based on 1 article reviews
pdgfra - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

92
Addgene inc full length mouse pdgfra cdna
Full Length Mouse Pdgfra Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/pCDH-CMV-PDGFRa-3xFlag-EF1-nlsCopGFP+(Plasmid+%2399731)/pmc07856068-148-77-91
Average 92 stars, based on 1 article reviews
full length mouse pdgfra cdna - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

93
Biorbyt atp6v0a4
( A ) The clinicopathological characteristics of the patient. ( B ) Whole-exome sequencing identified a heterozygous mutation in the <t>ATP6V0A4</t> gene on chromosome 7 in the patient: c.1534G>T (p.Val512Leu). ( C and D ) Sanger sequencing of ATP6V0A4 , amplified by PCR from leukocyte DNA of the patient and his parents, indicated that the father was a heterozygous carrier of the identified variant. ( E ) Cryo-EM density of human V-ATPase (PDB:7UNF) with subunits color-coded. Subunit a4 is labeled with red, and the N-terminal domain of the V-ATPase a4 subunit (a4-NT) is situated in the cytoplasm, interacting with the V1 domain to stabilize the enzyme structure; the C-terminal domain (a4-CT) forms a transmembrane proton channel. V512L residue is located at the C-terminus of the a4 subunit. ( F ) The valine residue altered by the p.V512L mutation is highly conserved across species. ( G ) Structure of WT-a4 and V512L-a4 as predicted by AlphaFold. SNHL, sensorineural hearing loss; ARR, aldosterone/renin ratio; IFTA, interstitial fibrosis and tubular atrophy; V512L, Val512Leu; Mut, mutant.
Atp6v0a4, supplied by Biorbyt, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/PDGFRA+(phospho-Tyr988)+antibody/pmc12208546-272-9-11
Average 93 stars, based on 1 article reviews
atp6v0a4 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene anti pdgfra

Anti Pdgfra, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/PDGF+Receptor+alpha+(PDGFRA)+Mouse+Monoclonal+Antibody/pmc09558082-330-10-13
Average 90 stars, based on 1 article reviews
anti pdgfra - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

94
Addgene inc phage pdgfrɑ plasmid

Phage Pdgfrɑ Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/pHAGE-PDGFRA+(Plasmid+%23116769)/pm41519838-272-11-13
Average 94 stars, based on 1 article reviews
phage pdgfrɑ plasmid - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
fluidigm 3160007a
Antibody panel used for CyTOF
3160007a, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pdgfra/Anti-Human+PDGFRa+(D13C6)-160Gd/pmc09178170-42-8-6
Average 93 stars, based on 1 article reviews
3160007a - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


( A ) The clinicopathological characteristics of the patient. ( B ) Whole-exome sequencing identified a heterozygous mutation in the ATP6V0A4 gene on chromosome 7 in the patient: c.1534G>T (p.Val512Leu). ( C and D ) Sanger sequencing of ATP6V0A4 , amplified by PCR from leukocyte DNA of the patient and his parents, indicated that the father was a heterozygous carrier of the identified variant. ( E ) Cryo-EM density of human V-ATPase (PDB:7UNF) with subunits color-coded. Subunit a4 is labeled with red, and the N-terminal domain of the V-ATPase a4 subunit (a4-NT) is situated in the cytoplasm, interacting with the V1 domain to stabilize the enzyme structure; the C-terminal domain (a4-CT) forms a transmembrane proton channel. V512L residue is located at the C-terminus of the a4 subunit. ( F ) The valine residue altered by the p.V512L mutation is highly conserved across species. ( G ) Structure of WT-a4 and V512L-a4 as predicted by AlphaFold. SNHL, sensorineural hearing loss; ARR, aldosterone/renin ratio; IFTA, interstitial fibrosis and tubular atrophy; V512L, Val512Leu; Mut, mutant.

Journal: The Journal of Clinical Investigation

Article Title: A gain-of-function mutation in ATP6V0A4 drives primary distal renal tubular alkalosis with enhanced V-ATPase activity

doi: 10.1172/JCI188807

Figure Lengend Snippet: ( A ) The clinicopathological characteristics of the patient. ( B ) Whole-exome sequencing identified a heterozygous mutation in the ATP6V0A4 gene on chromosome 7 in the patient: c.1534G>T (p.Val512Leu). ( C and D ) Sanger sequencing of ATP6V0A4 , amplified by PCR from leukocyte DNA of the patient and his parents, indicated that the father was a heterozygous carrier of the identified variant. ( E ) Cryo-EM density of human V-ATPase (PDB:7UNF) with subunits color-coded. Subunit a4 is labeled with red, and the N-terminal domain of the V-ATPase a4 subunit (a4-NT) is situated in the cytoplasm, interacting with the V1 domain to stabilize the enzyme structure; the C-terminal domain (a4-CT) forms a transmembrane proton channel. V512L residue is located at the C-terminus of the a4 subunit. ( F ) The valine residue altered by the p.V512L mutation is highly conserved across species. ( G ) Structure of WT-a4 and V512L-a4 as predicted by AlphaFold. SNHL, sensorineural hearing loss; ARR, aldosterone/renin ratio; IFTA, interstitial fibrosis and tubular atrophy; V512L, Val512Leu; Mut, mutant.

Article Snippet: The following primary antibodies were used for Western blot: ATP6V0A4 (orb666101, Biorybt), β-actin (sc-47778, Santa Cruz Biotechnology), P62 (18420-1-AP, Proteintech), LC3 (14600-1-AP, Proteintech), Bax (89477S, Cell Signaling Technology), cleaved caspase-3 (9661S, Cell Signaling Technology), and Bcl-2 (3498S, CST).

Techniques: Sequencing, Mutagenesis, Amplification, Variant Assay, Cryo-EM Sample Prep, Labeling, Residue

( A ) The prediction outcome of V512L-a4 stability was ΔΔG:0.268 kcal/mol (stabilizing). ( B ) Prediction of interatomic interactions of p.V512L. Residues 512 in the WT-a4 and V512L-a4 proteins are colored in light green and are shown as sticks. The respective chemical interactions are labeled as dotted lines and colored as follows: hydrogen bonds—(red), weak hydrogen bonds—(orange), hydrophobic contacts—(green), amide-amide contacts—(blue), and ionic interactions—(gold). Amino acid residues are also colored according to type, namely: nitrogen (blue), oxygen (red), and sulfur (yellow). In comparison with WT sites, increased interactions were observed to be added in mutant sites. ( C ) The WT-a4 has an average RMSD of 1.03 nm, and the V512L-a4 is 0.76 nm. ( D ) The WT-a4 has an average Rg of 4.500 nm, and the V512L-a4 is 4.455 nm. ( E ) For the residues between 500 and 530 near the V512L, the WT-a4 has an average RMSF of 0.473 nm, and the V512L-a4 is 0.456 nm. ( F ) Free energy landscapes for WT-a4 and V512L-a4. The free energy landscape uses a color gradient from blue (indicating high stability, folded states) to red (indicating low stability, unfolded states). IHC ( G ) and immunofluorescence ( H ) validated patient renal tubular tissues with increased ATP6V0A4 expression abundance compared with MCN, IgAN, and FSGS. Each group was always compared with the proband, which was considered as the reference group. Scale bar: 40 μm in IHC and immunofluorescence. Violin plots indicate median (red) and upper and lower quartile (blue). *** P < 0.0005, **** P < 0.0001 by 2-tailed unpaired t test. V512L, Val512Leu; RMSD, root mean square deviation; Rg, radius of gyration; RMSF, root mean square fluctuations; MCN, minimal change nephropathy; IgAN, IgA nephropathy; FSGS, focal segmental glomerulosclerosis.

Journal: The Journal of Clinical Investigation

Article Title: A gain-of-function mutation in ATP6V0A4 drives primary distal renal tubular alkalosis with enhanced V-ATPase activity

doi: 10.1172/JCI188807

Figure Lengend Snippet: ( A ) The prediction outcome of V512L-a4 stability was ΔΔG:0.268 kcal/mol (stabilizing). ( B ) Prediction of interatomic interactions of p.V512L. Residues 512 in the WT-a4 and V512L-a4 proteins are colored in light green and are shown as sticks. The respective chemical interactions are labeled as dotted lines and colored as follows: hydrogen bonds—(red), weak hydrogen bonds—(orange), hydrophobic contacts—(green), amide-amide contacts—(blue), and ionic interactions—(gold). Amino acid residues are also colored according to type, namely: nitrogen (blue), oxygen (red), and sulfur (yellow). In comparison with WT sites, increased interactions were observed to be added in mutant sites. ( C ) The WT-a4 has an average RMSD of 1.03 nm, and the V512L-a4 is 0.76 nm. ( D ) The WT-a4 has an average Rg of 4.500 nm, and the V512L-a4 is 4.455 nm. ( E ) For the residues between 500 and 530 near the V512L, the WT-a4 has an average RMSF of 0.473 nm, and the V512L-a4 is 0.456 nm. ( F ) Free energy landscapes for WT-a4 and V512L-a4. The free energy landscape uses a color gradient from blue (indicating high stability, folded states) to red (indicating low stability, unfolded states). IHC ( G ) and immunofluorescence ( H ) validated patient renal tubular tissues with increased ATP6V0A4 expression abundance compared with MCN, IgAN, and FSGS. Each group was always compared with the proband, which was considered as the reference group. Scale bar: 40 μm in IHC and immunofluorescence. Violin plots indicate median (red) and upper and lower quartile (blue). *** P < 0.0005, **** P < 0.0001 by 2-tailed unpaired t test. V512L, Val512Leu; RMSD, root mean square deviation; Rg, radius of gyration; RMSF, root mean square fluctuations; MCN, minimal change nephropathy; IgAN, IgA nephropathy; FSGS, focal segmental glomerulosclerosis.

Article Snippet: The following primary antibodies were used for Western blot: ATP6V0A4 (orb666101, Biorybt), β-actin (sc-47778, Santa Cruz Biotechnology), P62 (18420-1-AP, Proteintech), LC3 (14600-1-AP, Proteintech), Bax (89477S, Cell Signaling Technology), cleaved caspase-3 (9661S, Cell Signaling Technology), and Bcl-2 (3498S, CST).

Techniques: Labeling, Comparison, Mutagenesis, Immunofluorescence, Expressing

( A ) The WT and V512L-transduced M1s were constructed using CRISPR/Cas9 genome editing. ( B and C ) Western blot and ( D ) RT-qPCR analysis of ATP6V0A4 expression abundance and mRNA levels in HEK293T cells and M1 cells expressing WT-a4 or V512L-a4. β-Actin antibody was used as a protein loading control. n = 6 per group ( C ); n = 8 per group ( D ). ( E and F ) Immunostaining results of ATP6V0A4 expression levels of WT and V512L-transduced M1s. Scale bar: 15 μm. Violin plots indicate median (red) and upper and lower quartile (blue). **** P < 0.0001 by 2-tailed unpaired t test. ( G and H ) CHX chasing experiment showing ATP6V0A4 stability. WT and V512L-transduced M1s were incubated with medium containing CHX (100 μg/mL). Cells were lysed at 0, 2, 4, 8, 12, and 24 hours after CHX treatment and subjected to Western blot. n = 3. ( I ) V-ATPase activity and ( J ) H + -K + -ATPase activity in M1 cells expressing WT-a4 or V512L-a4. n = 3. Data are given as mean ± SEM. M1, mouse collecting duct cells; a4, ATP6V0A4; CHX, cycloheximide.

Journal: The Journal of Clinical Investigation

Article Title: A gain-of-function mutation in ATP6V0A4 drives primary distal renal tubular alkalosis with enhanced V-ATPase activity

doi: 10.1172/JCI188807

Figure Lengend Snippet: ( A ) The WT and V512L-transduced M1s were constructed using CRISPR/Cas9 genome editing. ( B and C ) Western blot and ( D ) RT-qPCR analysis of ATP6V0A4 expression abundance and mRNA levels in HEK293T cells and M1 cells expressing WT-a4 or V512L-a4. β-Actin antibody was used as a protein loading control. n = 6 per group ( C ); n = 8 per group ( D ). ( E and F ) Immunostaining results of ATP6V0A4 expression levels of WT and V512L-transduced M1s. Scale bar: 15 μm. Violin plots indicate median (red) and upper and lower quartile (blue). **** P < 0.0001 by 2-tailed unpaired t test. ( G and H ) CHX chasing experiment showing ATP6V0A4 stability. WT and V512L-transduced M1s were incubated with medium containing CHX (100 μg/mL). Cells were lysed at 0, 2, 4, 8, 12, and 24 hours after CHX treatment and subjected to Western blot. n = 3. ( I ) V-ATPase activity and ( J ) H + -K + -ATPase activity in M1 cells expressing WT-a4 or V512L-a4. n = 3. Data are given as mean ± SEM. M1, mouse collecting duct cells; a4, ATP6V0A4; CHX, cycloheximide.

Article Snippet: The following primary antibodies were used for Western blot: ATP6V0A4 (orb666101, Biorybt), β-actin (sc-47778, Santa Cruz Biotechnology), P62 (18420-1-AP, Proteintech), LC3 (14600-1-AP, Proteintech), Bax (89477S, Cell Signaling Technology), cleaved caspase-3 (9661S, Cell Signaling Technology), and Bcl-2 (3498S, CST).

Techniques: Construct, CRISPR, Western Blot, Quantitative RT-PCR, Expressing, Control, Immunostaining, Incubation, Activity Assay

Journal: Cell metabolism

Article Title: Single-cell dissection of the obesity-exercise axis in adipose-muscle tissues implies a critical role for mesenchymal stem cells

doi: 10.1016/j.cmet.2022.09.004

Figure Lengend Snippet:

Article Snippet: Immunofluorescence was carried out using 15ug/mL anti-SCA1 (710952, ThermoFisher), 5ug/mL anti-PDGFRA (TA807645 S, Origene), and 15ug/mL anti-LAMA4 (AF3837-SP, R&D Systems).

Techniques: Recombinant, RNAscope, Multiplex Assay, Sequencing, Software

Antibody panel used for CyTOF

Journal: Journal of Cachexia, Sarcopenia and Muscle

Article Title: A negative feedback loop between fibroadipogenic progenitors and muscle fibres involving endothelin promotes human muscle fibrosis

doi: 10.1002/jcsm.12974

Figure Lengend Snippet: Antibody panel used for CyTOF

Article Snippet: PDGFRa , 160Gd , D13C6 , Fluidigm , 3160007A.

Techniques: