pcsb-gfp Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs 5 alpha high efficiency competent e coli
    5 Alpha High Efficiency Competent E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 alpha high efficiency competent e coli/product/New England Biolabs
    Average 99 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    5 alpha high efficiency competent e coli - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher kpni restriction sites
    Kpni Restriction Sites, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kpni restriction sites/product/Thermo Fisher
    Average 99 stars, based on 134 article reviews
    Price from $9.99 to $1999.99
    kpni restriction sites - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    xhoi  (TaKaRa)
    99
    TaKaRa xhoi
    Xhoi, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 5928 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi/product/TaKaRa
    Average 99 stars, based on 5928 article reviews
    Price from $9.99 to $1999.99
    xhoi - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    TaKaRa pmcherry c1
    Pmcherry C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1577 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pmcherry c1/product/TaKaRa
    Average 99 stars, based on 1577 article reviews
    Price from $9.99 to $1999.99
    pmcherry c1 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    93
    TaKaRa bamhi restriction sites
    Bamhi Restriction Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 530 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi restriction sites/product/TaKaRa
    Average 93 stars, based on 530 article reviews
    Price from $9.99 to $1999.99
    bamhi restriction sites - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    94
    Polyplus Transfection jetprime reagent
    Jetprime Reagent, supplied by Polyplus Transfection, used in various techniques. Bioz Stars score: 94/100, based on 2366 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/jetprime reagent/product/Polyplus Transfection
    Average 94 stars, based on 2366 article reviews
    Price from $9.99 to $1999.99
    jetprime reagent - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    99
    TaKaRa primestar max dna polymerase
    Primestar Max Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 3780 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primestar max dna polymerase/product/TaKaRa
    Average 99 stars, based on 3780 article reviews
    Price from $9.99 to $1999.99
    primestar max dna polymerase - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    90
    Integrated DNA Technologies nols rv tcgagtcttcttttttcgcttctttcttcc
    Nols Rv Tcgagtcttcttttttcgcttctttcttcc, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nols rv tcgagtcttcttttttcgcttctttcttcc/product/Integrated DNA Technologies
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    nols rv tcgagtcttcttttttcgcttctttcttcc - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    94
    Agilent technologies pfuultra ii fusion hs dna polymerase
    Pfuultra Ii Fusion Hs Dna Polymerase, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 94/100, based on 1733 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pfuultra ii fusion hs dna polymerase/product/Agilent technologies
    Average 94 stars, based on 1733 article reviews
    Price from $9.99 to $1999.99
    pfuultra ii fusion hs dna polymerase - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    csb  (OriGene)
    90
    OriGene csb
    <t>CSB-induced</t> senescence is independent of p53. a RT-qPCR and b WB (Ponceau Red staining as a loading control) of p53 in <t>IMR-90.</t> c Experimental set-up of the two-step transduction of IMR-90, indicating also cell density at seeding. d RT-qPCR of p53 after silencing (PN21). RT-qPCRs: n = 3 independent experiments, mean ± SD; one-way ANOVA ( a F = 10.38, Dfn = 5, DFd = 12, p = 0.0005; d F = 15.37, DFn = 3, DFd = 8, p = 0.0011) with post-hoc Tukey’s test. e Population doubling after two passages in culture; n = 3 independent experiments, mean ± SD; GraphPad Prism two-by-two comparison of slope after linear regression (shSCR/shSCR vs. shp53/shSCR: F = 8.87048, DFn = 1, Dfd = 14, p = 0.1; shSCR/shCSB vs. shp53/shCSB: F = 0.103672, Dfn = 1, DFd = 14, p = 0.7522; shSCR/shSCR vs. shSCR/shCSB: F = 80.735, DFn = 1, Dfd = 14, p
    Csb, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/csb/product/OriGene
    Average 90 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    csb - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    93
    Eurofins nucleotide sequences
    <t>CSB-induced</t> senescence is independent of p53. a RT-qPCR and b WB (Ponceau Red staining as a loading control) of p53 in <t>IMR-90.</t> c Experimental set-up of the two-step transduction of IMR-90, indicating also cell density at seeding. d RT-qPCR of p53 after silencing (PN21). RT-qPCRs: n = 3 independent experiments, mean ± SD; one-way ANOVA ( a F = 10.38, Dfn = 5, DFd = 12, p = 0.0005; d F = 15.37, DFn = 3, DFd = 8, p = 0.0011) with post-hoc Tukey’s test. e Population doubling after two passages in culture; n = 3 independent experiments, mean ± SD; GraphPad Prism two-by-two comparison of slope after linear regression (shSCR/shSCR vs. shp53/shSCR: F = 8.87048, DFn = 1, Dfd = 14, p = 0.1; shSCR/shCSB vs. shp53/shCSB: F = 0.103672, Dfn = 1, DFd = 14, p = 0.7522; shSCR/shSCR vs. shSCR/shCSB: F = 80.735, DFn = 1, Dfd = 14, p
    Nucleotide Sequences, supplied by Eurofins, used in various techniques. Bioz Stars score: 93/100, based on 347 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleotide sequences/product/Eurofins
    Average 93 stars, based on 347 article reviews
    Price from $9.99 to $1999.99
    nucleotide sequences - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    dpni  (TaKaRa)
    96
    TaKaRa dpni
    <t>CSB-induced</t> senescence is independent of p53. a RT-qPCR and b WB (Ponceau Red staining as a loading control) of p53 in <t>IMR-90.</t> c Experimental set-up of the two-step transduction of IMR-90, indicating also cell density at seeding. d RT-qPCR of p53 after silencing (PN21). RT-qPCRs: n = 3 independent experiments, mean ± SD; one-way ANOVA ( a F = 10.38, Dfn = 5, DFd = 12, p = 0.0005; d F = 15.37, DFn = 3, DFd = 8, p = 0.0011) with post-hoc Tukey’s test. e Population doubling after two passages in culture; n = 3 independent experiments, mean ± SD; GraphPad Prism two-by-two comparison of slope after linear regression (shSCR/shSCR vs. shp53/shSCR: F = 8.87048, DFn = 1, Dfd = 14, p = 0.1; shSCR/shCSB vs. shp53/shCSB: F = 0.103672, Dfn = 1, DFd = 14, p = 0.7522; shSCR/shSCR vs. shSCR/shCSB: F = 80.735, DFn = 1, Dfd = 14, p
    Dpni, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 319 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dpni/product/TaKaRa
    Average 96 stars, based on 319 article reviews
    Price from $9.99 to $1999.99
    dpni - by Bioz Stars, 2020-08
    96/100 stars
      Buy from Supplier

    92
    Nikon eclipse te2000 e microscope
    <t>CSB-induced</t> senescence is independent of p53. a RT-qPCR and b WB (Ponceau Red staining as a loading control) of p53 in <t>IMR-90.</t> c Experimental set-up of the two-step transduction of IMR-90, indicating also cell density at seeding. d RT-qPCR of p53 after silencing (PN21). RT-qPCRs: n = 3 independent experiments, mean ± SD; one-way ANOVA ( a F = 10.38, Dfn = 5, DFd = 12, p = 0.0005; d F = 15.37, DFn = 3, DFd = 8, p = 0.0011) with post-hoc Tukey’s test. e Population doubling after two passages in culture; n = 3 independent experiments, mean ± SD; GraphPad Prism two-by-two comparison of slope after linear regression (shSCR/shSCR vs. shp53/shSCR: F = 8.87048, DFn = 1, Dfd = 14, p = 0.1; shSCR/shCSB vs. shp53/shCSB: F = 0.103672, Dfn = 1, DFd = 14, p = 0.7522; shSCR/shSCR vs. shSCR/shCSB: F = 80.735, DFn = 1, Dfd = 14, p
    Eclipse Te2000 E Microscope, supplied by Nikon, used in various techniques. Bioz Stars score: 92/100, based on 1558 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eclipse te2000 e microscope/product/Nikon
    Average 92 stars, based on 1558 article reviews
    Price from $9.99 to $1999.99
    eclipse te2000 e microscope - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Thermo Fisher pcdna3 1
    <t>CSB-induced</t> senescence is independent of p53. a RT-qPCR and b WB (Ponceau Red staining as a loading control) of p53 in <t>IMR-90.</t> c Experimental set-up of the two-step transduction of IMR-90, indicating also cell density at seeding. d RT-qPCR of p53 after silencing (PN21). RT-qPCRs: n = 3 independent experiments, mean ± SD; one-way ANOVA ( a F = 10.38, Dfn = 5, DFd = 12, p = 0.0005; d F = 15.37, DFn = 3, DFd = 8, p = 0.0011) with post-hoc Tukey’s test. e Population doubling after two passages in culture; n = 3 independent experiments, mean ± SD; GraphPad Prism two-by-two comparison of slope after linear regression (shSCR/shSCR vs. shp53/shSCR: F = 8.87048, DFn = 1, Dfd = 14, p = 0.1; shSCR/shCSB vs. shp53/shCSB: F = 0.103672, Dfn = 1, DFd = 14, p = 0.7522; shSCR/shSCR vs. shSCR/shCSB: F = 80.735, DFn = 1, Dfd = 14, p
    Pcdna3 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 49697 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcdna3 1/product/Thermo Fisher
    Average 92 stars, based on 49697 article reviews
    Price from $9.99 to $1999.99
    pcdna3 1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    89
    TaKaRa pacgfp n1
    <t>CSB-induced</t> senescence is independent of p53. a RT-qPCR and b WB (Ponceau Red staining as a loading control) of p53 in <t>IMR-90.</t> c Experimental set-up of the two-step transduction of IMR-90, indicating also cell density at seeding. d RT-qPCR of p53 after silencing (PN21). RT-qPCRs: n = 3 independent experiments, mean ± SD; one-way ANOVA ( a F = 10.38, Dfn = 5, DFd = 12, p = 0.0005; d F = 15.37, DFn = 3, DFd = 8, p = 0.0011) with post-hoc Tukey’s test. e Population doubling after two passages in culture; n = 3 independent experiments, mean ± SD; GraphPad Prism two-by-two comparison of slope after linear regression (shSCR/shSCR vs. shp53/shSCR: F = 8.87048, DFn = 1, Dfd = 14, p = 0.1; shSCR/shCSB vs. shp53/shCSB: F = 0.103672, Dfn = 1, DFd = 14, p = 0.7522; shSCR/shSCR vs. shSCR/shCSB: F = 80.735, DFn = 1, Dfd = 14, p
    Pacgfp N1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 295 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pacgfp n1/product/TaKaRa
    Average 89 stars, based on 295 article reviews
    Price from $9.99 to $1999.99
    pacgfp n1 - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    99
    Thermo Fisher xhoi
    <t>CSB-induced</t> senescence is independent of p53. a RT-qPCR and b WB (Ponceau Red staining as a loading control) of p53 in <t>IMR-90.</t> c Experimental set-up of the two-step transduction of IMR-90, indicating also cell density at seeding. d RT-qPCR of p53 after silencing (PN21). RT-qPCRs: n = 3 independent experiments, mean ± SD; one-way ANOVA ( a F = 10.38, Dfn = 5, DFd = 12, p = 0.0005; d F = 15.37, DFn = 3, DFd = 8, p = 0.0011) with post-hoc Tukey’s test. e Population doubling after two passages in culture; n = 3 independent experiments, mean ± SD; GraphPad Prism two-by-two comparison of slope after linear regression (shSCR/shSCR vs. shp53/shSCR: F = 8.87048, DFn = 1, Dfd = 14, p = 0.1; shSCR/shCSB vs. shp53/shCSB: F = 0.103672, Dfn = 1, DFd = 14, p = 0.7522; shSCR/shSCR vs. shSCR/shCSB: F = 80.735, DFn = 1, Dfd = 14, p
    Xhoi, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 8200 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi/product/Thermo Fisher
    Average 99 stars, based on 8200 article reviews
    Price from $9.99 to $1999.99
    xhoi - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    CSB-induced senescence is independent of p53. a RT-qPCR and b WB (Ponceau Red staining as a loading control) of p53 in IMR-90. c Experimental set-up of the two-step transduction of IMR-90, indicating also cell density at seeding. d RT-qPCR of p53 after silencing (PN21). RT-qPCRs: n = 3 independent experiments, mean ± SD; one-way ANOVA ( a F = 10.38, Dfn = 5, DFd = 12, p = 0.0005; d F = 15.37, DFn = 3, DFd = 8, p = 0.0011) with post-hoc Tukey’s test. e Population doubling after two passages in culture; n = 3 independent experiments, mean ± SD; GraphPad Prism two-by-two comparison of slope after linear regression (shSCR/shSCR vs. shp53/shSCR: F = 8.87048, DFn = 1, Dfd = 14, p = 0.1; shSCR/shCSB vs. shp53/shCSB: F = 0.103672, Dfn = 1, DFd = 14, p = 0.7522; shSCR/shSCR vs. shSCR/shCSB: F = 80.735, DFn = 1, Dfd = 14, p

    Journal: Nature Communications

    Article Title: CSB promoter downregulation via histone H3 hypoacetylation is an early determinant of replicative senescence

    doi: 10.1038/s41467-019-13314-y

    Figure Lengend Snippet: CSB-induced senescence is independent of p53. a RT-qPCR and b WB (Ponceau Red staining as a loading control) of p53 in IMR-90. c Experimental set-up of the two-step transduction of IMR-90, indicating also cell density at seeding. d RT-qPCR of p53 after silencing (PN21). RT-qPCRs: n = 3 independent experiments, mean ± SD; one-way ANOVA ( a F = 10.38, Dfn = 5, DFd = 12, p = 0.0005; d F = 15.37, DFn = 3, DFd = 8, p = 0.0011) with post-hoc Tukey’s test. e Population doubling after two passages in culture; n = 3 independent experiments, mean ± SD; GraphPad Prism two-by-two comparison of slope after linear regression (shSCR/shSCR vs. shp53/shSCR: F = 8.87048, DFn = 1, Dfd = 14, p = 0.1; shSCR/shCSB vs. shp53/shCSB: F = 0.103672, Dfn = 1, DFd = 14, p = 0.7522; shSCR/shSCR vs. shSCR/shCSB: F = 80.735, DFn = 1, Dfd = 14, p

    Article Snippet: Ectopic expression of CSB was obtained upon transfection with Lipofectamine 3000 of early-passage IMR-90 (PN15) with the CSB (Myc-DDK-tagged) expression vector (pCMV6-Entry) (RC219020, OriGene), called here “pCSB”.

    Techniques: Quantitative RT-PCR, Western Blot, Staining, Transduction

    CSB-dependent senescence is specific to the DDR/p21 pathway. a Enumeration of endogenous γ−H2AX and 53BP1 foci/cell at PNs preceding or during CSB depletion. n = 50–70 cells from three independent experiments; mean ± SEM; one-way ANOVA (γ−H2AX: F = 3.209, DFn = 3, DFd = 220, p = 0.0239; 53BP1: F = 5.603, DFn = 3, DFd = 220, p = 0.001) with post-hoc Tukey’s test vs. the respective PN16. b Representative confocal acquisitions of irradiated (10 Gy) and non-irradiated (non-IR) IMR-90 immunostained for γ−H2AX (green) and 53BP1 (red), counterstained with Hoechst (blue, nuclei), after maximum intensity projection with the Imaris software; scale bar = 20 µM. Percentage of cells with 0, 1, 2, 3, or > 3 ( c ) γ−H2AX or d 53BP1 foci per nucleus. n = 90 cells from three independent experiments. Mean ± SEM; two-way ANOVA (γ−H2AX: F = 35.77, DFn = 4, DFd = 20, p

    Journal: Nature Communications

    Article Title: CSB promoter downregulation via histone H3 hypoacetylation is an early determinant of replicative senescence

    doi: 10.1038/s41467-019-13314-y

    Figure Lengend Snippet: CSB-dependent senescence is specific to the DDR/p21 pathway. a Enumeration of endogenous γ−H2AX and 53BP1 foci/cell at PNs preceding or during CSB depletion. n = 50–70 cells from three independent experiments; mean ± SEM; one-way ANOVA (γ−H2AX: F = 3.209, DFn = 3, DFd = 220, p = 0.0239; 53BP1: F = 5.603, DFn = 3, DFd = 220, p = 0.001) with post-hoc Tukey’s test vs. the respective PN16. b Representative confocal acquisitions of irradiated (10 Gy) and non-irradiated (non-IR) IMR-90 immunostained for γ−H2AX (green) and 53BP1 (red), counterstained with Hoechst (blue, nuclei), after maximum intensity projection with the Imaris software; scale bar = 20 µM. Percentage of cells with 0, 1, 2, 3, or > 3 ( c ) γ−H2AX or d 53BP1 foci per nucleus. n = 90 cells from three independent experiments. Mean ± SEM; two-way ANOVA (γ−H2AX: F = 35.77, DFn = 4, DFd = 20, p

    Article Snippet: Ectopic expression of CSB was obtained upon transfection with Lipofectamine 3000 of early-passage IMR-90 (PN15) with the CSB (Myc-DDK-tagged) expression vector (pCMV6-Entry) (RC219020, OriGene), called here “pCSB”.

    Techniques: Irradiation, Software

    CSB knockdown induces premature p21-dependent senescence. a Scheme of the experiment. b Immunoblot of CSB at PN20. GAPDH was used as a loading control. c Quantitative RT-qPCR of CSB at PN19 and PN20 in IMR-90 fibroblasts knocked down for CSB (shCSB#1 and shCSB#2) and scramble control (shSCR). n = 3 independent experiments, mean ± SD, values are reported in the Source Data files; two-way ANOVA ( F = 28.24, DFn = 2, DFd = 12, p

    Journal: Nature Communications

    Article Title: CSB promoter downregulation via histone H3 hypoacetylation is an early determinant of replicative senescence

    doi: 10.1038/s41467-019-13314-y

    Figure Lengend Snippet: CSB knockdown induces premature p21-dependent senescence. a Scheme of the experiment. b Immunoblot of CSB at PN20. GAPDH was used as a loading control. c Quantitative RT-qPCR of CSB at PN19 and PN20 in IMR-90 fibroblasts knocked down for CSB (shCSB#1 and shCSB#2) and scramble control (shSCR). n = 3 independent experiments, mean ± SD, values are reported in the Source Data files; two-way ANOVA ( F = 28.24, DFn = 2, DFd = 12, p

    Article Snippet: Ectopic expression of CSB was obtained upon transfection with Lipofectamine 3000 of early-passage IMR-90 (PN15) with the CSB (Myc-DDK-tagged) expression vector (pCMV6-Entry) (RC219020, OriGene), called here “pCSB”.

    Techniques: Quantitative RT-PCR