Journal: Communications biology

Article Title: AP-1 cFos/JunB /miR-200a regulate the pro-regenerative glial cell response during axolotl spinal cord regeneration.

doi: 10.1038/s42003-019-0335-4

Figure Lengend Snippet: Fig. 1 Axolotl glial cells express AP-1cFos/JunB after spinal cord injury. a Immunohistochemical analysis of regenerating spinal cords at 1 day post injury shows only NeuN+ neurons express c-Jun. GFAP+ glial cells are negative for c-Jun expression (n = 5) Scale bars = 50 μm. b Schematic diagram of the structure of the axolotl spinal cord, neuronal cell bodies that surround the glial cells are shown in blue, glial cells line the central canal (CC), they have a large nucleus and express GFAP on the membrane (green). c qRT-PCR profiling shows upregulation of c-Fos and JunB during axolotl spinal cord regeneration (n = 3). d In situ hybridization confirms JunB expression in glial cells at 1 day post injury, higher magnification image of panel d, showing JunB transcript in the oval-shaped glial cells that line the central canal (n = 5) Scale bars = 50 μm. ***p ≤0.001. Error bars represent ± S.T.D

Article Snippet: Restriction fragments were ligated together using T4 DNA Ligase (NEB) overnight at 4 °C and heat shock transformed into DH5α competent E. coli (Promega) cFos For Axolomics NheI ATTGCTAGCACCATGTTCCAGGGCTTCTCGGG cFos Rev Axolomics SacII ATCCCGCGGCAGAGCAAGCAAAGTAGGCG cJun For XhoI ATTCTCGAGACCATGGAGCCTACGTTCTACG cJun Rev SalI ATTGTCGACACATGAACGTCTGCAGCTGCTG JunB For NheI ATTGCTAGCACCATGTGCACCAAGATGGACG JunB Rev SacII ATTCCGCGGAAAGGGCTGCATCTTGGCA Sequences for the human versions of c-Fos (#70382), c-Jun (#70398) and JunB (#29687) were cloned from the indicated Addgene plasmids using the following primers (5′–3′) and subcloned into pCMV:GFP (Clontech): cFos FL Hs For SalI TATGTCGACACCATGACTGCAAAGATGGAAACGA cFos FL Hs Rev BamHI ACTGGATCCAAATGTTTGCAACTGCTGCGTTAG cJun FL Hs For SalI TATGTCGACACCATGACTGCAAAGATGGAAACGA cJun FL Hs Rev BamHI ACTGGATCCAAATGTTTGCAACTGCTGCGTTAG JunB FL Hs For SalI TATGTCGACACCATGTGCACTAAAATGGAACAGCC JunB FL Hs Rev BamHI ACTGGATCCGAAGGCGTGTCCCTTGAC For 3’ UTR luciferase experiments, primers were designed to amplify the cJun 3’ UTR based off our RACE sequences.

Techniques: Immunohistochemical staining, Expressing, Membrane, Quantitative RT-PCR, In Situ Hybridization

Journal: eLife

Article Title: Endogenous protein tagging in medaka using a simplified CRISPR/Cas9 knock-in approach

doi: 10.7554/eLife.75050

Figure Lengend Snippet: ( A ) Schematic diagram of cloning-free CRISPR knock-in strategy. The injection mix consists of three components, a single-guide RNA (sgRNA) targeting the gene of interest, Cas9-mSA mRNA, and the PCR-amplified donor fragment containing short homology arms on both ends (30–40 bp) and the fluorescent protein of interest with no ATG and no stop codon. Note that the 5′ ends of the PCR donor fragment are biotinylated (Btn). The mix is injected in one-cell staged medaka embryos and the injected fishes are screened for potential in-frame integrations mediated by homology-directed repair (HDR). ( B ) eGFP-cbx1b F1 CRISPR KI line stage 40 medaka embryos. eGFP-Cbx1b labels all nuclei and is thus an ubiquitous nuclear marker. n > 10 embryos. Scale bar = 100 µm ( C ) mScarlet-pcna F1 CRISPR KI line stage 40 medaka embryos. mScarlet-Pcna labels exclusively cycling cells. n > 10 embryos. Scale bar = 100 µm. ( D ) mNG-myosinhc F1 CRISPR KI line stage 40 medaka embryos. mNG-Myosinhc labels exclusively muscle cells located in the myotome tissue of medaka embryos. n > 10 embryos. Scale bar = 100 µm.

Article Snippet: Other Cas9 encoding plasmids used were pCS2+ Cas9 (Addgene #122948) ( ) and pCS2-Cas9 (Addgene #47322) ( ; ). sgRNAs were manually selected using previously published recommendations ( ; ; ; ; ) and in silico validated using CCTop and CHOPCHOP ( ; ; ).

Techniques: Clone Assay, CRISPR, Knock-In, Injection, Amplification, Marker

Journal: eLife

Article Title: Endogenous protein tagging in medaka using a simplified CRISPR/Cas9 knock-in approach

doi: 10.7554/eLife.75050

Figure Lengend Snippet: PCR amplification of mNeonGreen-HAtag-Linker (green, orange, and purple) using primers homologous to the extremity of the insert and containing flanking sequence corresponding to the homology arms (blue) for insertion just downstream the ATG of myosinhc gene (yellow) following Cas9/sgRNA DNA-induced cut. The PCR primers contain 5′ end Biotins (Btn). Bold letters denote the single-guide RNA (sgRNA) PAM, underlined the sequence upstream the PAM recognized by the sgRNA, blue letters the sequence homologous between the myosinhc locus and the PCR donor, dashed green for mNeonGreen indicates it is not to scale.

Article Snippet: Other Cas9 encoding plasmids used were pCS2+ Cas9 (Addgene #122948) ( ) and pCS2-Cas9 (Addgene #47322) ( ; ). sgRNAs were manually selected using previously published recommendations ( ; ; ; ; ) and in silico validated using CCTop and CHOPCHOP ( ; ; ).

Techniques: Amplification, Sequencing

Journal: eLife

Article Title: Endogenous protein tagging in medaka using a simplified CRISPR/Cas9 knock-in approach

doi: 10.7554/eLife.75050

Figure Lengend Snippet:

Article Snippet: Other Cas9 encoding plasmids used were pCS2+ Cas9 (Addgene #122948) ( ) and pCS2-Cas9 (Addgene #47322) ( ; ). sgRNAs were manually selected using previously published recommendations ( ; ; ; ; ) and in silico validated using CCTop and CHOPCHOP ( ; ; ).

Techniques: CRISPR, Recombinant, Plasmid Preparation, Sequencing, Software