pcr-amplified Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    TaKaRa pcr amplified
    <t>NFATc1/αA</t> suppresses cell death and Prdm1/ Blimp-1 expression in chicken DT40 B cells. (A) WT, NFATC1 −/−/− , NFATC1 −/−/ α A , and NFATC1 −/−/ α C DT40 cells were stimulated with 30 µg/ml α-IgM M4 Ab for 28 h. Cells were stained by annexin V-Cy3. Shown is the percentage of apoptotic cells in one typical experiment from more than three. (B) Real-time qPCR assays. RNAs were isolated from either untreated DT40 B cells—or from cells treated with 30 µg/ml αIgM for 6 h (+) using a QIAamp RNA Blood kit (QIAGEN), and quantitative <t>RT-PCR</t> assays were performed using TaqMan probes for detecting Bcl-6 and GAPDH3 RNAs as internal control. (C,D) Human NFATc1/αA affects the gene signature of DT40 cells. RNAs from untreated DT40 B cells—or from cells treated with α-IgM for 4 h (C) or T+I for 1 and 4 h (D) were assayed in semi-quantitative PCR assays. In (C,D) , one typical assay from two reactions is shown.
    Pcr Amplified, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    86
    Illumina Inc pcr amplified
    Sm proteins associate with mature mRNAs. (a) Meta-gene analysis of read density around splice sites for all Drosophila and human Sm-associated intron-containing mRNAs in all RIP-seq experiments. (b) Meta-gene analysis of read density along the gene length for all Drosophila Sm-associated mRNAs quantified from oligodT and random hexamer primed libraries. (c) Example tracks for read density along the gene length for oligodT and random hexamer primed libraries. (d) Poly(A) tail length Sm-associated mRNAs (CG3997, CG1349 and CG3776) and non-associated mRNA (RpS2) from Y12 IP in S2 cells. IN, input total RNA; IP, <t>immunoprecipitated</t> RNA. The labels denote the length of poly(A) tails. Oligo(dT) 20 was used as the reverse primer for the reverse transcription and subsequent <t>PCR,</t> therefore producing the ‘smear’ of poly(A) tail. See Figure S11 in Additional file 1 for analysis of poly(A) containing reads for selected Sm-associated mRNAs.
    Pcr Amplified, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Illumina Inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    86
    Addgene inc pcr amplified
    <t>miR-450b-5p</t> directly targets SIAH1 and SFRP2 A. Predicted miR-450b-5p target sequences in the 3′-UTR of SIAH1 (SIAH1-3′UTR-WT) and SFRP2 (SFRP2-3′UTR-WT), and sequences with mutated nucleotides (SIAH1-3′UTR-MUT and SFRP2-3′UTR-MUT). B. Real-time <t>PCR</t> analysis of SIAH1 and SFRP2 expression, normalized by GAPDH. C. Western blotting analysis of SIAH1 and SFRP1 in indicated cells. D. Western blotting analyses of GFP proteins in indicated cells. α-Tubulin served as loading control. E. Luciferase activity analysis of indicated cells transfused with indicated reporters of a different amount of miR-450b-5p (20 and 50 nM). Data were presented in mean ± SD of three independent experiments. * p
    Pcr Amplified, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Addgene inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    86
    Stratagene pcr amplified
    Constructs for plastid and nuclear transformations. ( a ) Construct for plastid transformation. lacO DNA (1 or ∼2.5 kb; dashed lines) was inserted between the HindIII and SmaI restriction sites into a polylinker in the unique Bsu36I site ( 31 ) of pZS197 ( 30 ). P rrn , plastid rrn promoter driving the aadA gene conferring resistance to spectinomycin; T psbA , terminator region from plastid psbA . Plastid rbcL and accD sequences are used for recombination into the plastid genome; their direction of transcription is shown by the arrowheads. The EcoRV restriction site was destroyed in the production of pZS197 but is restored in transplastomic plants. 1: position of 1.24 kb probe used in Southern DNA analysis. 2: position of the rbcL primer used to determine the size of the lacO insert in (b); 3: position of the forward and reverse primers used to analyse immunoprecipitated DNA for the presence of lacO . ( b ) <t>PCR</t> analysis of leaf DNA from transplastomic lacO lines. Lanes 1–4 and 5–8, putative transplastomic lines containing lacO constructs with 1 or ∼2.5 kb lacO DNA, respectively. Lane 9, no-template negative control. Lane 10, positive control, PCR on plasmid containing 1 kb lacO. Marker sizes are shown on the left. Primers were used to amplify a region extending from rbcL to accD and were expected to give band sizes of 2.6 or ∼4.0 kb with 1 kb or ∼2.5 kb of lacO , respectively. ( c ) Southern blot analysis of transplastomic tobacco lines, regenerated following bombardment with a plasmid containing ∼2.5 kb lacO repeat sequence. Total leaf DNA (0.3 µg) was cut with EcoRV and SacII and probed with a 32 P-labelled 1.24 kb BamHI fragment from rbcL [see (a) above]. Lanes 1–6, putative transplastomic lines. WT, ‘Petite Havana’ wild-type. Band sizes are shown on the left. ( d , e ) Constructs for nuclear transformation containing the CaMV 35S promoter and nos terminator in pBIN19 ( 32 ). (d) <t>gfp-lacI</t> DNA was inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and SacI restriction sites. (e) lacI-gfp has been inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and StuI restriction sites.
    Pcr Amplified, supplied by Stratagene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Stratagene
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Image Search Results


    NFATc1/αA suppresses cell death and Prdm1/ Blimp-1 expression in chicken DT40 B cells. (A) WT, NFATC1 −/−/− , NFATC1 −/−/ α A , and NFATC1 −/−/ α C DT40 cells were stimulated with 30 µg/ml α-IgM M4 Ab for 28 h. Cells were stained by annexin V-Cy3. Shown is the percentage of apoptotic cells in one typical experiment from more than three. (B) Real-time qPCR assays. RNAs were isolated from either untreated DT40 B cells—or from cells treated with 30 µg/ml αIgM for 6 h (+) using a QIAamp RNA Blood kit (QIAGEN), and quantitative RT-PCR assays were performed using TaqMan probes for detecting Bcl-6 and GAPDH3 RNAs as internal control. (C,D) Human NFATc1/αA affects the gene signature of DT40 cells. RNAs from untreated DT40 B cells—or from cells treated with α-IgM for 4 h (C) or T+I for 1 and 4 h (D) were assayed in semi-quantitative PCR assays. In (C,D) , one typical assay from two reactions is shown.

    Journal: Frontiers in Immunology

    Article Title: Induction of Short NFATc1/αA Isoform Interferes with Peripheral B Cell Differentiation

    doi: 10.3389/fimmu.2018.00032

    Figure Lengend Snippet: NFATc1/αA suppresses cell death and Prdm1/ Blimp-1 expression in chicken DT40 B cells. (A) WT, NFATC1 −/−/− , NFATC1 −/−/ α A , and NFATC1 −/−/ α C DT40 cells were stimulated with 30 µg/ml α-IgM M4 Ab for 28 h. Cells were stained by annexin V-Cy3. Shown is the percentage of apoptotic cells in one typical experiment from more than three. (B) Real-time qPCR assays. RNAs were isolated from either untreated DT40 B cells—or from cells treated with 30 µg/ml αIgM for 6 h (+) using a QIAamp RNA Blood kit (QIAGEN), and quantitative RT-PCR assays were performed using TaqMan probes for detecting Bcl-6 and GAPDH3 RNAs as internal control. (C,D) Human NFATc1/αA affects the gene signature of DT40 cells. RNAs from untreated DT40 B cells—or from cells treated with α-IgM for 4 h (C) or T+I for 1 and 4 h (D) were assayed in semi-quantitative PCR assays. In (C,D) , one typical assay from two reactions is shown.

    Article Snippet: For constructing vectors expressing chimeric EGFP-human NFATc1/αA or c1/αC proteins, a complete fragment of EGFP was PCR-amplified from the pEGFP-C3 vector (Clontech, Palo Alto, CA, USA) using the following primers: 5′-primer: 5′-CGCAAGCTTATGGTGAGCAAGGGC-3′ (+HindIII site), and 3′-primer, 5′-CGCGGATCCTCACTTGTACAGCTCGTC-3′ (+BamHI site).

    Techniques: Expressing, Staining, Real-time Polymerase Chain Reaction, Isolation, Quantitative RT-PCR

    Effect of NFATc1/αA-bio and NFATc1/βC-bio proteins on cell death and the expression of Aicda and Prdm1 genes in murine WEHI 231 B lymphoma cells. (A) WEHI 231 B cells stably infected with retroviral vectors expressing BirA (WEHI-231), Bir A and NFATc1/αA-bio (NFATc1/αA), or BirA and NFATc1/βC-bio (NFATc1/βC) were stimulated with α-IgM or α-IgM α-IgM + αCD40 for 48 or 96 h. Apoptosis was determined by PI staining. MFI: Mean fluorescence intensity. (B) Wild-type (WT) WEHI cells (Co) or cells expressing NFATc1/αA-bio (blue) or NFATc1/βC-bio (red) were left unstimulated or stimulated for 6, 24, or 96 h with α-IgM. RNA was isolated and converted to cDNA libraries. DNA stretches of 50 bp were sequenced on a Illumina HiSeq2500 platform using the Truseq SBS kit-HS V3. Shown are the RNA reads (RPKM) from the Aicda and Prdm1 genes in the three types of WEHI cells. Results of one from two assays are shown. (C) Chromatin immuno precipitation (ChIP) assays for the binding of NFATc1-bio proteins to the Prdm1 gene in WEHI cells stimulated with T+I for 6 h. In the upper panel semi-quantitative PCR assays are shown for the detection of Prdm1 (and β -Actin ) DNA in chromatin precipitations. In the first three lanes, chromatin from WEHI cells transfected with BirA alone, with NFATc1/αA-bio (+BirA) or NFATc1/βC-bio (+BirA) was precipitated with streptavidin-agarose beads. In the next lanes, chromatin was precipitated with Abs specific for histone H3, NFATc1 (7A6), and immunoglobulin. In the last two lanes, DNA input and H 2 O controls are shown. One typical assay from three assays is shown. In the lower panel the enrichment of β -Actin, Rcan1, Prdm1, Il2 , and Ppp3ca DNAs precipitated with streptavidin beads from WEHI cells expressing either NFATc1/αA-bio or NFATc1/βC-bio is shown. Mean values of three assays are shown. (D) ChIP assays indicating histone modifications at the Prdm1 promoter. ChIP assays were performed with chromatin from WEHI cells overexpressing NFATc1/αA-bio (+BirA) (open bars) or NFATc1/βC-bio (+BirA) proteins (gray bars) using Abs directed the histone modifications H3K9me3 and H3K9ac, respectively. In semi-quantitative PCR assays, primers detecting the Prdm1 ) were used. Mean values of three assays are shown.

    Journal: Frontiers in Immunology

    Article Title: Induction of Short NFATc1/αA Isoform Interferes with Peripheral B Cell Differentiation

    doi: 10.3389/fimmu.2018.00032

    Figure Lengend Snippet: Effect of NFATc1/αA-bio and NFATc1/βC-bio proteins on cell death and the expression of Aicda and Prdm1 genes in murine WEHI 231 B lymphoma cells. (A) WEHI 231 B cells stably infected with retroviral vectors expressing BirA (WEHI-231), Bir A and NFATc1/αA-bio (NFATc1/αA), or BirA and NFATc1/βC-bio (NFATc1/βC) were stimulated with α-IgM or α-IgM α-IgM + αCD40 for 48 or 96 h. Apoptosis was determined by PI staining. MFI: Mean fluorescence intensity. (B) Wild-type (WT) WEHI cells (Co) or cells expressing NFATc1/αA-bio (blue) or NFATc1/βC-bio (red) were left unstimulated or stimulated for 6, 24, or 96 h with α-IgM. RNA was isolated and converted to cDNA libraries. DNA stretches of 50 bp were sequenced on a Illumina HiSeq2500 platform using the Truseq SBS kit-HS V3. Shown are the RNA reads (RPKM) from the Aicda and Prdm1 genes in the three types of WEHI cells. Results of one from two assays are shown. (C) Chromatin immuno precipitation (ChIP) assays for the binding of NFATc1-bio proteins to the Prdm1 gene in WEHI cells stimulated with T+I for 6 h. In the upper panel semi-quantitative PCR assays are shown for the detection of Prdm1 (and β -Actin ) DNA in chromatin precipitations. In the first three lanes, chromatin from WEHI cells transfected with BirA alone, with NFATc1/αA-bio (+BirA) or NFATc1/βC-bio (+BirA) was precipitated with streptavidin-agarose beads. In the next lanes, chromatin was precipitated with Abs specific for histone H3, NFATc1 (7A6), and immunoglobulin. In the last two lanes, DNA input and H 2 O controls are shown. One typical assay from three assays is shown. In the lower panel the enrichment of β -Actin, Rcan1, Prdm1, Il2 , and Ppp3ca DNAs precipitated with streptavidin beads from WEHI cells expressing either NFATc1/αA-bio or NFATc1/βC-bio is shown. Mean values of three assays are shown. (D) ChIP assays indicating histone modifications at the Prdm1 promoter. ChIP assays were performed with chromatin from WEHI cells overexpressing NFATc1/αA-bio (+BirA) (open bars) or NFATc1/βC-bio (+BirA) proteins (gray bars) using Abs directed the histone modifications H3K9me3 and H3K9ac, respectively. In semi-quantitative PCR assays, primers detecting the Prdm1 ) were used. Mean values of three assays are shown.

    Article Snippet: For constructing vectors expressing chimeric EGFP-human NFATc1/αA or c1/αC proteins, a complete fragment of EGFP was PCR-amplified from the pEGFP-C3 vector (Clontech, Palo Alto, CA, USA) using the following primers: 5′-primer: 5′-CGCAAGCTTATGGTGAGCAAGGGC-3′ (+HindIII site), and 3′-primer, 5′-CGCGGATCCTCACTTGTACAGCTCGTC-3′ (+BamHI site).

    Techniques: Expressing, Stable Transfection, Infection, Staining, Fluorescence, Isolation, Chromatin Immunoprecipitation, Binding Assay, Real-time Polymerase Chain Reaction, Transfection

    Suppression of plasmablast differentiation and of IgG class switch by caNFATc1/αA. (A) Changes in Prdm1 RNA levels in splenic B cells upon stimulation with α-IgM, α-CD40, or LPS for 24 h. pαIgM: cells were “pulsed” for 30 min at 4°C with α-IgM, washed and then treated with α-CD40 or LPS for 24 h. Shown are mean values of Prdm1 RNA reads (RPKM) from two assays. (B) Splenic B cells from wild-type (WT) mice (open columns) or caNfatc1/ α A × Cd23-cre mice (black) were treated for 24–72 h with LPS. Real-time PCR assays for detecting Prdm1 RNA levels. Mean values of three assays are shown. (C,D) WT and caNfatc1/ α A × Cd23-cre mice were immunized with NP-KLH (C) or NP-Ficoll (D) for 21 days, and the serum levels of immunoglobulins were determined in ELISAs. One dot and square indicates one mouse, respectively.

    Journal: Frontiers in Immunology

    Article Title: Induction of Short NFATc1/αA Isoform Interferes with Peripheral B Cell Differentiation

    doi: 10.3389/fimmu.2018.00032

    Figure Lengend Snippet: Suppression of plasmablast differentiation and of IgG class switch by caNFATc1/αA. (A) Changes in Prdm1 RNA levels in splenic B cells upon stimulation with α-IgM, α-CD40, or LPS for 24 h. pαIgM: cells were “pulsed” for 30 min at 4°C with α-IgM, washed and then treated with α-CD40 or LPS for 24 h. Shown are mean values of Prdm1 RNA reads (RPKM) from two assays. (B) Splenic B cells from wild-type (WT) mice (open columns) or caNfatc1/ α A × Cd23-cre mice (black) were treated for 24–72 h with LPS. Real-time PCR assays for detecting Prdm1 RNA levels. Mean values of three assays are shown. (C,D) WT and caNfatc1/ α A × Cd23-cre mice were immunized with NP-KLH (C) or NP-Ficoll (D) for 21 days, and the serum levels of immunoglobulins were determined in ELISAs. One dot and square indicates one mouse, respectively.

    Article Snippet: For constructing vectors expressing chimeric EGFP-human NFATc1/αA or c1/αC proteins, a complete fragment of EGFP was PCR-amplified from the pEGFP-C3 vector (Clontech, Palo Alto, CA, USA) using the following primers: 5′-primer: 5′-CGCAAGCTTATGGTGAGCAAGGGC-3′ (+HindIII site), and 3′-primer, 5′-CGCGGATCCTCACTTGTACAGCTCGTC-3′ (+BamHI site).

    Techniques: Mouse Assay, Real-time Polymerase Chain Reaction

    Sm proteins associate with mature mRNAs. (a) Meta-gene analysis of read density around splice sites for all Drosophila and human Sm-associated intron-containing mRNAs in all RIP-seq experiments. (b) Meta-gene analysis of read density along the gene length for all Drosophila Sm-associated mRNAs quantified from oligodT and random hexamer primed libraries. (c) Example tracks for read density along the gene length for oligodT and random hexamer primed libraries. (d) Poly(A) tail length Sm-associated mRNAs (CG3997, CG1349 and CG3776) and non-associated mRNA (RpS2) from Y12 IP in S2 cells. IN, input total RNA; IP, immunoprecipitated RNA. The labels denote the length of poly(A) tails. Oligo(dT) 20 was used as the reverse primer for the reverse transcription and subsequent PCR, therefore producing the ‘smear’ of poly(A) tail. See Figure S11 in Additional file 1 for analysis of poly(A) containing reads for selected Sm-associated mRNAs.

    Journal: Genome Biology

    Article Title: RIP-seq analysis of eukaryotic Sm proteins identifies three major categories of Sm-containing ribonucleoproteins

    doi: 10.1186/gb-2014-15-1-r7

    Figure Lengend Snippet: Sm proteins associate with mature mRNAs. (a) Meta-gene analysis of read density around splice sites for all Drosophila and human Sm-associated intron-containing mRNAs in all RIP-seq experiments. (b) Meta-gene analysis of read density along the gene length for all Drosophila Sm-associated mRNAs quantified from oligodT and random hexamer primed libraries. (c) Example tracks for read density along the gene length for oligodT and random hexamer primed libraries. (d) Poly(A) tail length Sm-associated mRNAs (CG3997, CG1349 and CG3776) and non-associated mRNA (RpS2) from Y12 IP in S2 cells. IN, input total RNA; IP, immunoprecipitated RNA. The labels denote the length of poly(A) tails. Oligo(dT) 20 was used as the reverse primer for the reverse transcription and subsequent PCR, therefore producing the ‘smear’ of poly(A) tail. See Figure S11 in Additional file 1 for analysis of poly(A) containing reads for selected Sm-associated mRNAs.

    Article Snippet: Immunoprecipitated RNA was reverse transcribed to cDNA, fragmented, ligated with adapters, PCR-amplified and sequenced on an Illumina Genome Analyzer II.

    Techniques: Random Hexamer Labeling, Immunoprecipitation, Polymerase Chain Reaction

    RNA-Sm association is cell type-specific and not due to re-assortment. (a) RIP-qRT-PCR in da-Gal4 VFP-SmD1 fly ovary (anti-GFP) and S2 cells (Y12). Negative controls (Ctrl) used are 5S rRNA, Act5C and Smt3. CG9042 (Gapdh) is used as the normalization standard. snRNAs are shown separately due to the difference in scale. (b) mRNAs associated with Sm proteins in ovaries but not in S2 cells are expressed in S2 cells. t -Test for significance between IP and Ctrl: * P

    Journal: Genome Biology

    Article Title: RIP-seq analysis of eukaryotic Sm proteins identifies three major categories of Sm-containing ribonucleoproteins

    doi: 10.1186/gb-2014-15-1-r7

    Figure Lengend Snippet: RNA-Sm association is cell type-specific and not due to re-assortment. (a) RIP-qRT-PCR in da-Gal4 VFP-SmD1 fly ovary (anti-GFP) and S2 cells (Y12). Negative controls (Ctrl) used are 5S rRNA, Act5C and Smt3. CG9042 (Gapdh) is used as the normalization standard. snRNAs are shown separately due to the difference in scale. (b) mRNAs associated with Sm proteins in ovaries but not in S2 cells are expressed in S2 cells. t -Test for significance between IP and Ctrl: * P

    Article Snippet: Immunoprecipitated RNA was reverse transcribed to cDNA, fragmented, ligated with adapters, PCR-amplified and sequenced on an Illumina Genome Analyzer II.

    Techniques: Quantitative RT-PCR

    U1 snRNP binds mature mRNAs. (a) Putative base pairs between the 5′ end of U1 snRNA and the CG3776 mRNA coding region (upper panel). Within the putative region of base pairing, three translationally silent point mutations were introduced (bold blue letters) to disrupt the helix (lower panel). (b) Cartoon of the S2 cell transfection construct, showing the CG3776 expression unit. CG3776endo and CG3776tag indicate locations of primers for qRT-PCR. CG3776endo amplifies both endogenous and transfected CG3776 mRNAs, whereas CG3776tag amplifies transfected CG3776 mRNA only. The black star indicates the location of the putative U1 binding site. (c) pAW vector, pAW-CG3776wt and pAW-CG3776mut were transfected into S2 cells, and CG3776wt and CG3776mut expression was measured using qRT-PCR with the CG3776endo primer pair. GAPDH was used as normalization standard. (d) After pAW-CG3776wt and pAW-CG3776mut were transfected, anti-Sm (Y12) IPs were performed using S2 cell lysate. GAPDH was used as normalization standard. (e) Proposed model of snRNP-mRNA interactions. Distinct snRNPs (U1 and potentially others) associate with mature mRNAs via base pairing and/or protein-mediated interaction. Such interactions could serve as a platform to recruit RNA processing factors that act on multiple levels of RNA metabolism. t -Test for significance between IP and control (Ctrl): * P

    Journal: Genome Biology

    Article Title: RIP-seq analysis of eukaryotic Sm proteins identifies three major categories of Sm-containing ribonucleoproteins

    doi: 10.1186/gb-2014-15-1-r7

    Figure Lengend Snippet: U1 snRNP binds mature mRNAs. (a) Putative base pairs between the 5′ end of U1 snRNA and the CG3776 mRNA coding region (upper panel). Within the putative region of base pairing, three translationally silent point mutations were introduced (bold blue letters) to disrupt the helix (lower panel). (b) Cartoon of the S2 cell transfection construct, showing the CG3776 expression unit. CG3776endo and CG3776tag indicate locations of primers for qRT-PCR. CG3776endo amplifies both endogenous and transfected CG3776 mRNAs, whereas CG3776tag amplifies transfected CG3776 mRNA only. The black star indicates the location of the putative U1 binding site. (c) pAW vector, pAW-CG3776wt and pAW-CG3776mut were transfected into S2 cells, and CG3776wt and CG3776mut expression was measured using qRT-PCR with the CG3776endo primer pair. GAPDH was used as normalization standard. (d) After pAW-CG3776wt and pAW-CG3776mut were transfected, anti-Sm (Y12) IPs were performed using S2 cell lysate. GAPDH was used as normalization standard. (e) Proposed model of snRNP-mRNA interactions. Distinct snRNPs (U1 and potentially others) associate with mature mRNAs via base pairing and/or protein-mediated interaction. Such interactions could serve as a platform to recruit RNA processing factors that act on multiple levels of RNA metabolism. t -Test for significance between IP and control (Ctrl): * P

    Article Snippet: Immunoprecipitated RNA was reverse transcribed to cDNA, fragmented, ligated with adapters, PCR-amplified and sequenced on an Illumina Genome Analyzer II.

    Techniques: Transfection, Construct, Expressing, Quantitative RT-PCR, Binding Assay, Plasmid Preparation, Activated Clotting Time Assay

    miR-450b-5p directly targets SIAH1 and SFRP2 A. Predicted miR-450b-5p target sequences in the 3′-UTR of SIAH1 (SIAH1-3′UTR-WT) and SFRP2 (SFRP2-3′UTR-WT), and sequences with mutated nucleotides (SIAH1-3′UTR-MUT and SFRP2-3′UTR-MUT). B. Real-time PCR analysis of SIAH1 and SFRP2 expression, normalized by GAPDH. C. Western blotting analysis of SIAH1 and SFRP1 in indicated cells. D. Western blotting analyses of GFP proteins in indicated cells. α-Tubulin served as loading control. E. Luciferase activity analysis of indicated cells transfused with indicated reporters of a different amount of miR-450b-5p (20 and 50 nM). Data were presented in mean ± SD of three independent experiments. * p

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: miR-450b-5p directly targets SIAH1 and SFRP2 A. Predicted miR-450b-5p target sequences in the 3′-UTR of SIAH1 (SIAH1-3′UTR-WT) and SFRP2 (SFRP2-3′UTR-WT), and sequences with mutated nucleotides (SIAH1-3′UTR-MUT and SFRP2-3′UTR-MUT). B. Real-time PCR analysis of SIAH1 and SFRP2 expression, normalized by GAPDH. C. Western blotting analysis of SIAH1 and SFRP1 in indicated cells. D. Western blotting analyses of GFP proteins in indicated cells. α-Tubulin served as loading control. E. Luciferase activity analysis of indicated cells transfused with indicated reporters of a different amount of miR-450b-5p (20 and 50 nM). Data were presented in mean ± SD of three independent experiments. * p

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Real-time Polymerase Chain Reaction, Expressing, Western Blot, Luciferase, Activity Assay

    KRAS signaling enhances miR-450b-5p expression in CRC A. Real-time PCR analyses of miR-450b-5p expression in CRC samples with wild-type KRAS (n=52) and CRC samples with mutant-KRAS (n=31). B. Real-time PCR analyses of miR-450b-5p expression and western blotting analyses of KRAS expression in indicated CRC cell lines with different KRAS types. C, D. Real-time PCR analyses of miR-450b-5p expression and western blotting analyses of KRAS and its downstream genes expression in indicated cells transfected with mutant KRAS G12D or treated with KRAS G12D -siRNA. E. Chromatin immunoprecipitation assay (CHIP) for detection of c-FOS binding site on the promoter of miR-450b-5p. F. Luciferase activity analyses of c-FOS on promoter activity of miR-450b-5p transfected with wild-type and mutated-type reporter vector.

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: KRAS signaling enhances miR-450b-5p expression in CRC A. Real-time PCR analyses of miR-450b-5p expression in CRC samples with wild-type KRAS (n=52) and CRC samples with mutant-KRAS (n=31). B. Real-time PCR analyses of miR-450b-5p expression and western blotting analyses of KRAS expression in indicated CRC cell lines with different KRAS types. C, D. Real-time PCR analyses of miR-450b-5p expression and western blotting analyses of KRAS and its downstream genes expression in indicated cells transfected with mutant KRAS G12D or treated with KRAS G12D -siRNA. E. Chromatin immunoprecipitation assay (CHIP) for detection of c-FOS binding site on the promoter of miR-450b-5p. F. Luciferase activity analyses of c-FOS on promoter activity of miR-450b-5p transfected with wild-type and mutated-type reporter vector.

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Mutagenesis, Western Blot, Transfection, Chromatin Immunoprecipitation, Binding Assay, Luciferase, Activity Assay, Plasmid Preparation

    miR-450b-5p activates Wnt signaling pathway in CRC A. GO enrichment and KEGG enrichment of pathways involving predicted miR-450b-5p targeting genes. B. The Wnt signaling luciferase reporter assay of indicated cells transfected with miR-450b-5p and miR-450b-5p-inhibitor. C. Western blotting assay for β-Catenin in cytoplasm and nucleus of indicated cells transfected with control, miR-450b-5p and miR-450b-5p-inhibitor. LamB1 and a-tubulin served as loading controls for nucleus and cytoplasm proteins, respectively. D. Western blot analysis in indicated cells of protein products of Wnt signaling pathway downstream genes. E. Q-PCR analysis in indicated cells of protein products of Wnt signaling pathway downstream genes.* p

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: miR-450b-5p activates Wnt signaling pathway in CRC A. GO enrichment and KEGG enrichment of pathways involving predicted miR-450b-5p targeting genes. B. The Wnt signaling luciferase reporter assay of indicated cells transfected with miR-450b-5p and miR-450b-5p-inhibitor. C. Western blotting assay for β-Catenin in cytoplasm and nucleus of indicated cells transfected with control, miR-450b-5p and miR-450b-5p-inhibitor. LamB1 and a-tubulin served as loading controls for nucleus and cytoplasm proteins, respectively. D. Western blot analysis in indicated cells of protein products of Wnt signaling pathway downstream genes. E. Q-PCR analysis in indicated cells of protein products of Wnt signaling pathway downstream genes.* p

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Luciferase, Reporter Assay, Transfection, Western Blot, Polymerase Chain Reaction

    Repression of SIAH1 and SFRP2 inhibits the CRC progression induced by miR-450b-5p, and the clinical relevance of miR-450b-5p and its targets in CRC A. Western blotting and Real-time PCR analyses of SIAH1 and SFRP2 exogenous expression. B. MTT assays on indicated cells. The OD values (450 nm) of cells at day 7 were analyzed; C. Flow-cytometry of an apoptosis assay on indicated cells. Annexin-positive/PI-negative cells were calculated for apoptotic rate. D. Real-time PCR analyses of SFRP2, miR-450b-5p, and SIAH1 expression in 10 fresh human CRC samples. E. Spearman correlation analyses on relative expression of miR-450b-5p and relative expression of SIAH1 and SFRP2 in 10 fresh human CRC samples. F. Proposed model: miR450b-5p is increased by mutated KRAS through AP-1 binding to its promoter, and then down-regulates SIAH1 and SFRP2, finally activating Wnt signaling pathway. Error bars represent mean ± SD from three independent experiments, * p

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: Repression of SIAH1 and SFRP2 inhibits the CRC progression induced by miR-450b-5p, and the clinical relevance of miR-450b-5p and its targets in CRC A. Western blotting and Real-time PCR analyses of SIAH1 and SFRP2 exogenous expression. B. MTT assays on indicated cells. The OD values (450 nm) of cells at day 7 were analyzed; C. Flow-cytometry of an apoptosis assay on indicated cells. Annexin-positive/PI-negative cells were calculated for apoptotic rate. D. Real-time PCR analyses of SFRP2, miR-450b-5p, and SIAH1 expression in 10 fresh human CRC samples. E. Spearman correlation analyses on relative expression of miR-450b-5p and relative expression of SIAH1 and SFRP2 in 10 fresh human CRC samples. F. Proposed model: miR450b-5p is increased by mutated KRAS through AP-1 binding to its promoter, and then down-regulates SIAH1 and SFRP2, finally activating Wnt signaling pathway. Error bars represent mean ± SD from three independent experiments, * p

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Western Blot, Real-time Polymerase Chain Reaction, Expressing, MTT Assay, Flow Cytometry, Cytometry, Apoptosis Assay, Binding Assay

    Overexpression of miR-miR-450b-5p correlates with CRC progression Real-time PCR analyses of miR-450b-5p in 10 normal intestine epithelial tissues (normal) and 170 CRC tissues (tumor), normalized by U6 expression. Boundaries of boxes represent bounding of the boxes stand for the lower and upper quartile. Lines within the boxes and whiskers represent median and extremum. A. Mean expression of miR-450b-5p in normal tissues (normal) and CRC tissues (tumor). B. Expression of miR-450b-5p in different T classification (T1-T4) of CRC compared with 10 normal intestine tissues. C. Expression of miR450b-5p in different N classification (N0-N2) of CRC. D. Expression of miR-450b-5p in different distant metastasis stage of CRC. E. Overall survival and disease-free survival time curves analyzed by Kaplan-Meier of patients with high (≥median; n=85) or low miR-450b-5p (

    Journal: Oncotarget

    Article Title: miR-450b-5p induced by oncogenic KRAS is required for colorectal cancer progression

    doi: 10.18632/oncotarget.11016

    Figure Lengend Snippet: Overexpression of miR-miR-450b-5p correlates with CRC progression Real-time PCR analyses of miR-450b-5p in 10 normal intestine epithelial tissues (normal) and 170 CRC tissues (tumor), normalized by U6 expression. Boundaries of boxes represent bounding of the boxes stand for the lower and upper quartile. Lines within the boxes and whiskers represent median and extremum. A. Mean expression of miR-450b-5p in normal tissues (normal) and CRC tissues (tumor). B. Expression of miR-450b-5p in different T classification (T1-T4) of CRC compared with 10 normal intestine tissues. C. Expression of miR450b-5p in different N classification (N0-N2) of CRC. D. Expression of miR-450b-5p in different distant metastasis stage of CRC. E. Overall survival and disease-free survival time curves analyzed by Kaplan-Meier of patients with high (≥median; n=85) or low miR-450b-5p (

    Article Snippet: Plasmids and transfection To construct the plasmid that overexpresses mir-450b-5p, a 78bp fragment of pri-mir-450b-5p was PCR-amplified, then generated into the lentiviral vector pLVTHM (Addgene Inc., Cambridge, MA, USA).

    Techniques: Over Expression, Real-time Polymerase Chain Reaction, Expressing

    Constructs for plastid and nuclear transformations. ( a ) Construct for plastid transformation. lacO DNA (1 or ∼2.5 kb; dashed lines) was inserted between the HindIII and SmaI restriction sites into a polylinker in the unique Bsu36I site ( 31 ) of pZS197 ( 30 ). P rrn , plastid rrn promoter driving the aadA gene conferring resistance to spectinomycin; T psbA , terminator region from plastid psbA . Plastid rbcL and accD sequences are used for recombination into the plastid genome; their direction of transcription is shown by the arrowheads. The EcoRV restriction site was destroyed in the production of pZS197 but is restored in transplastomic plants. 1: position of 1.24 kb probe used in Southern DNA analysis. 2: position of the rbcL primer used to determine the size of the lacO insert in (b); 3: position of the forward and reverse primers used to analyse immunoprecipitated DNA for the presence of lacO . ( b ) PCR analysis of leaf DNA from transplastomic lacO lines. Lanes 1–4 and 5–8, putative transplastomic lines containing lacO constructs with 1 or ∼2.5 kb lacO DNA, respectively. Lane 9, no-template negative control. Lane 10, positive control, PCR on plasmid containing 1 kb lacO. Marker sizes are shown on the left. Primers were used to amplify a region extending from rbcL to accD and were expected to give band sizes of 2.6 or ∼4.0 kb with 1 kb or ∼2.5 kb of lacO , respectively. ( c ) Southern blot analysis of transplastomic tobacco lines, regenerated following bombardment with a plasmid containing ∼2.5 kb lacO repeat sequence. Total leaf DNA (0.3 µg) was cut with EcoRV and SacII and probed with a 32 P-labelled 1.24 kb BamHI fragment from rbcL [see (a) above]. Lanes 1–6, putative transplastomic lines. WT, ‘Petite Havana’ wild-type. Band sizes are shown on the left. ( d , e ) Constructs for nuclear transformation containing the CaMV 35S promoter and nos terminator in pBIN19 ( 32 ). (d) gfp-lacI DNA was inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and SacI restriction sites. (e) lacI-gfp has been inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and StuI restriction sites.

    Journal: Nucleic Acids Research

    Article Title: Binding of lac repressor-GFP fusion protein to lac operator sites inserted in the tobacco chloroplast genome examined by chromatin immunoprecipitation

    doi: 10.1093/nar/gkq413

    Figure Lengend Snippet: Constructs for plastid and nuclear transformations. ( a ) Construct for plastid transformation. lacO DNA (1 or ∼2.5 kb; dashed lines) was inserted between the HindIII and SmaI restriction sites into a polylinker in the unique Bsu36I site ( 31 ) of pZS197 ( 30 ). P rrn , plastid rrn promoter driving the aadA gene conferring resistance to spectinomycin; T psbA , terminator region from plastid psbA . Plastid rbcL and accD sequences are used for recombination into the plastid genome; their direction of transcription is shown by the arrowheads. The EcoRV restriction site was destroyed in the production of pZS197 but is restored in transplastomic plants. 1: position of 1.24 kb probe used in Southern DNA analysis. 2: position of the rbcL primer used to determine the size of the lacO insert in (b); 3: position of the forward and reverse primers used to analyse immunoprecipitated DNA for the presence of lacO . ( b ) PCR analysis of leaf DNA from transplastomic lacO lines. Lanes 1–4 and 5–8, putative transplastomic lines containing lacO constructs with 1 or ∼2.5 kb lacO DNA, respectively. Lane 9, no-template negative control. Lane 10, positive control, PCR on plasmid containing 1 kb lacO. Marker sizes are shown on the left. Primers were used to amplify a region extending from rbcL to accD and were expected to give band sizes of 2.6 or ∼4.0 kb with 1 kb or ∼2.5 kb of lacO , respectively. ( c ) Southern blot analysis of transplastomic tobacco lines, regenerated following bombardment with a plasmid containing ∼2.5 kb lacO repeat sequence. Total leaf DNA (0.3 µg) was cut with EcoRV and SacII and probed with a 32 P-labelled 1.24 kb BamHI fragment from rbcL [see (a) above]. Lanes 1–6, putative transplastomic lines. WT, ‘Petite Havana’ wild-type. Band sizes are shown on the left. ( d , e ) Constructs for nuclear transformation containing the CaMV 35S promoter and nos terminator in pBIN19 ( 32 ). (d) gfp-lacI DNA was inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and SacI restriction sites. (e) lacI-gfp has been inserted between the coding region for the RbcS transit peptide and the nos terminator using XbaI and StuI restriction sites.

    Article Snippet: For the gfp-lacI construct, the lacI coding sequence ( ) was PCR-amplified from E. coli XL1-Blue (Stratagene, http://www.stratagene.com ) using forward (5′-ACG GGATCC GTGAAACCAGTAACGTTATACGATGTC) and reverse (5′-TTATAA GAGCTC TCACTGCCCGCTTTCCAGTCGGG) primers, introducing a stop codon and inserting BamHI and SacI restriction sites (underlined) at the 5′- and 3′-ends, respectively.

    Techniques: Construct, Transformation Assay, Immunoprecipitation, Polymerase Chain Reaction, Negative Control, Positive Control, Plasmid Preparation, Marker, Southern Blot, Sequencing

    Binding of GFP-LacI to chloroplast-located lacO sequences. ( a ) PCR analysis of immunoprecipitated chloroplast DNA. Immunoprecipitation was carried out with the following treatments: antibody to A. thaliana TTG1, antibody to GFP or no antibody. Total DNA was extracted from a fraction of the chloroplast lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−). M, DNA size markers. (a) Binding of GFP-LacI to lacO. Primers were used to amplify a 409-bp sequence, which includes plastid-localized lacO (marked as position 3 in Figure 1(a). Experimental lines are listed on the left. Treatments shown in the left half of the panel were carried out following formaldehyde cross-linking, those on the right were not subjected to formaldehyde cross-linking. ( b ) Effect of IPTG on binding of GFP-LacI to lacO. PCR analysis of immunoprecipitated chloroplast DNA from lacO /GFP-LacI lines, using primers to amplify a 409-bp fragment encompassing lacO and a 396-bp fragment from atpBE (shown on left side). Treatments shown in the left half of the panel were carried out in the absence of IPTG, those in the right half were carried out in the presence of 20 mM IPTG.

    Journal: Nucleic Acids Research

    Article Title: Binding of lac repressor-GFP fusion protein to lac operator sites inserted in the tobacco chloroplast genome examined by chromatin immunoprecipitation

    doi: 10.1093/nar/gkq413

    Figure Lengend Snippet: Binding of GFP-LacI to chloroplast-located lacO sequences. ( a ) PCR analysis of immunoprecipitated chloroplast DNA. Immunoprecipitation was carried out with the following treatments: antibody to A. thaliana TTG1, antibody to GFP or no antibody. Total DNA was extracted from a fraction of the chloroplast lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−). M, DNA size markers. (a) Binding of GFP-LacI to lacO. Primers were used to amplify a 409-bp sequence, which includes plastid-localized lacO (marked as position 3 in Figure 1(a). Experimental lines are listed on the left. Treatments shown in the left half of the panel were carried out following formaldehyde cross-linking, those on the right were not subjected to formaldehyde cross-linking. ( b ) Effect of IPTG on binding of GFP-LacI to lacO. PCR analysis of immunoprecipitated chloroplast DNA from lacO /GFP-LacI lines, using primers to amplify a 409-bp fragment encompassing lacO and a 396-bp fragment from atpBE (shown on left side). Treatments shown in the left half of the panel were carried out in the absence of IPTG, those in the right half were carried out in the presence of 20 mM IPTG.

    Article Snippet: For the gfp-lacI construct, the lacI coding sequence ( ) was PCR-amplified from E. coli XL1-Blue (Stratagene, http://www.stratagene.com ) using forward (5′-ACG GGATCC GTGAAACCAGTAACGTTATACGATGTC) and reverse (5′-TTATAA GAGCTC TCACTGCCCGCTTTCCAGTCGGG) primers, introducing a stop codon and inserting BamHI and SacI restriction sites (underlined) at the 5′- and 3′-ends, respectively.

    Techniques: Binding Assay, Polymerase Chain Reaction, Immunoprecipitation, Isolation, Sequencing

    Binding of GFP-LacI to chloroplast sequences. Experimental lines are listed on the left; treatments shown in the left half of the panels were carried out following a formaldehyde cross-linking step, those on the right were not subjected to cross-linking. ( a ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 396-bp fragment from plastid atpB/E . ( b ) PCR analysis of formaldehyde cross-linked, immunoprecipitated chloroplast DNA using primers to amplify a 233-bp fragment from plastid 23S rDNA. ( c ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 167-bp fragment from plastid psbT . Total DNA was extracted from a fraction of the lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−).

    Journal: Nucleic Acids Research

    Article Title: Binding of lac repressor-GFP fusion protein to lac operator sites inserted in the tobacco chloroplast genome examined by chromatin immunoprecipitation

    doi: 10.1093/nar/gkq413

    Figure Lengend Snippet: Binding of GFP-LacI to chloroplast sequences. Experimental lines are listed on the left; treatments shown in the left half of the panels were carried out following a formaldehyde cross-linking step, those on the right were not subjected to cross-linking. ( a ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 396-bp fragment from plastid atpB/E . ( b ) PCR analysis of formaldehyde cross-linked, immunoprecipitated chloroplast DNA using primers to amplify a 233-bp fragment from plastid 23S rDNA. ( c ) PCR analysis of immunoprecipitated chloroplast DNA using primers to amplify a 167-bp fragment from plastid psbT . Total DNA was extracted from a fraction of the lysate that did not undergo immunoprecipitation. Control reactions for PCR included genomic DNA isolated from a transplastomic lacO line (+) and water (−).

    Article Snippet: For the gfp-lacI construct, the lacI coding sequence ( ) was PCR-amplified from E. coli XL1-Blue (Stratagene, http://www.stratagene.com ) using forward (5′-ACG GGATCC GTGAAACCAGTAACGTTATACGATGTC) and reverse (5′-TTATAA GAGCTC TCACTGCCCGCTTTCCAGTCGGG) primers, introducing a stop codon and inserting BamHI and SacI restriction sites (underlined) at the 5′- and 3′-ends, respectively.

    Techniques: Binding Assay, Polymerase Chain Reaction, Immunoprecipitation, Isolation