pcr-amplified Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs pcr amplified
    Propagation and cell binding of gB-NT deletion mutants. ( A ) BHK-21 cells were infected (0.01 p.f.u./cell) with wild-type (WT) MuHV-4, each deletion mutant or a revertant of the gBΔ2–30 mutant (REV). Virus growth with time was then monitored by plaque assay. ( B ) EGFP + version of the same viruses as in (A) was added to BHK-21 cells (1 p.f.u./cell) for the time indicated, then washed with PBS to remove unbound virions. The cells were then cultured overnight and infection was quantitated the next day by flow cytometric assay of viral eGFP expression. Equivalent data were obtained in two further experiments. ( C ) NMuMG cells were stained with gB-Fc fusions recovered from supernatants of transfected 293T cells. The shaded histogram is staining with secondary antibody only. None of the gB-NT deletions affected cell binding. ( D ) The gB-Fc fusion protein was pre-incubated with the neutralizing gB-NT-specific mAb MG-2C10 before being used to stain NMuMG cells. No difference in staining was observed. ( E ) NS0 myeloma cells were exposed (18 h) to eGFP + wild-type (WT) MuHV-4 or gB-NT deletion mutants. Infection was then quantitated by flow cytometric assay of viral eGFP expression. ( F ) Mice were infected intranasally with wild-type (WT) MuHV-4, the gBΔ2–14 or gBΔ2–30 mutant or a revertant of the gBΔ2–30 mutant (REV). Lungs were harvested at 6 days post-infection and infectious virus quantitated by plaque assay. Each bar shows the mean±s.e.m. titers of five mice per group. ( G ) At 14 days after infection as for (B), spleens were harvested and virus load measured by infectious center assay. Each bar shows the mean±s.e.m. titers of five mice per group. ( H ) <t>DNA</t> was extracted from the same spleens as in (C) and assayed for viral genome load by real-time <t>PCR.</t> Each bar shows the mean±s.e.m. of five mice per group.
    Pcr Amplified, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3658 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/New England Biolabs
    Average 99 stars, based on 3658 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    92
    Illumina Inc polymerase chain reaction pcr amplified
    iCLIP identifies the TIA1 and TIAL1 crosslink sites with nucleotide resolution. Autoradiogram of 32 P-labelled RNA crosslinked to TIA1 (A) or TIAL1 (B) in HeLa cells. Immunoprecipitation was performed with either anti-TIA1 or anti-TIAL1 antibody using lysate from UV-crosslinked HeLa cells, cells transfected with TIA1 or TIAL1, TIA1/TIAL1 KD cells, or non-crosslinked cells. High and low RNase concentrations were used and protein G beads were used as a control. The Western blots below the autoradiograms show the input lysate used for each immunoprecipitation. (C) TIA1 and TIAL1 crosslink to uridine tracts downstream of the alternative 5′ splice sites in the CLIP4 gene. The <t>cDNA</t> positions are colour-coded for three replicate TIA1 and TIAL1 experiments, and the random barcode (shown on the left) is used to identify unique iCLIP cDNAs (number in brackets indicates the number of corresponding <t>PCR</t> duplicates). Below, the bar graphs show the cDNA count (number of cDNAs at each crosslink site). Pre-mRNA sequence is shown below with crosslink nucleotides in red. The exon and intron positions of the two isoforms of CLIP4 mRNA are shown at the bottom.
    Polymerase Chain Reaction Pcr Amplified, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 227 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Illumina Inc
    Average 92 stars, based on 227 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    90
    Agilent technologies polymerase chain reaction pcr amplified
    iCLIP identifies the TIA1 and TIAL1 crosslink sites with nucleotide resolution. Autoradiogram of 32 P-labelled RNA crosslinked to TIA1 (A) or TIAL1 (B) in HeLa cells. Immunoprecipitation was performed with either anti-TIA1 or anti-TIAL1 antibody using lysate from UV-crosslinked HeLa cells, cells transfected with TIA1 or TIAL1, TIA1/TIAL1 KD cells, or non-crosslinked cells. High and low RNase concentrations were used and protein G beads were used as a control. The Western blots below the autoradiograms show the input lysate used for each immunoprecipitation. (C) TIA1 and TIAL1 crosslink to uridine tracts downstream of the alternative 5′ splice sites in the CLIP4 gene. The <t>cDNA</t> positions are colour-coded for three replicate TIA1 and TIAL1 experiments, and the random barcode (shown on the left) is used to identify unique iCLIP cDNAs (number in brackets indicates the number of corresponding <t>PCR</t> duplicates). Below, the bar graphs show the cDNA count (number of cDNAs at each crosslink site). Pre-mRNA sequence is shown below with crosslink nucleotides in red. The exon and intron positions of the two isoforms of CLIP4 mRNA are shown at the bottom.
    Polymerase Chain Reaction Pcr Amplified, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Agilent technologies
    Average 90 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    System Biosciences Inc polymerase chain reaction pcr amplified
    iCLIP identifies the TIA1 and TIAL1 crosslink sites with nucleotide resolution. Autoradiogram of 32 P-labelled RNA crosslinked to TIA1 (A) or TIAL1 (B) in HeLa cells. Immunoprecipitation was performed with either anti-TIA1 or anti-TIAL1 antibody using lysate from UV-crosslinked HeLa cells, cells transfected with TIA1 or TIAL1, TIA1/TIAL1 KD cells, or non-crosslinked cells. High and low RNase concentrations were used and protein G beads were used as a control. The Western blots below the autoradiograms show the input lysate used for each immunoprecipitation. (C) TIA1 and TIAL1 crosslink to uridine tracts downstream of the alternative 5′ splice sites in the CLIP4 gene. The <t>cDNA</t> positions are colour-coded for three replicate TIA1 and TIAL1 experiments, and the random barcode (shown on the left) is used to identify unique iCLIP cDNAs (number in brackets indicates the number of corresponding <t>PCR</t> duplicates). Below, the bar graphs show the cDNA count (number of cDNAs at each crosslink site). Pre-mRNA sequence is shown below with crosslink nucleotides in red. The exon and intron positions of the two isoforms of CLIP4 mRNA are shown at the bottom.
    Polymerase Chain Reaction Pcr Amplified, supplied by System Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/System Biosciences Inc
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    Roche polymerase chain reaction pcr amplified
    Heat shock and cadmium sulfate change the alternative splicing pattern of the adenovirus E1A minigene. (A) Schematic representation of the alternative spliced isoforms of E1A pre-mRNA. The major isoforms 9S, 12S, and 13S are generated by alternative selection of the 5′ splice sites. The minor isoforms 10S and 11S involve the usage of additional internal 3′ splice sites. Sizes, in base pairs, of the corresponding <t>RT-PCR</t> products obtained with the use of the E1A-569 and E1A-1315 primers are shown. (B) In vivo alternative splicing of E1A pre-mRNA is affected by heat shock and by cadmium sulfate. The pCMVE1A plasmid containing the E1A minigene was transfected in HeLa cells. Twenty-four hours after transfection total RNAs were extracted from unstressed cells (37°C) or from cells heat-shocked for 1 h at 42°C. RNAs were also prepared from cells allowed to recover 1, 2, 4, or 6 h at 37°C after heat shock. RNAs were also extracted from cells treated for 3 or 5 h with 30 μM of cadmium sulfate, another induced of <t>HAP</t> bodies. RNA were analyzed by RT-PCR with E1A-569 and E1A-1315 primers. RT-PCR products were resolved on 5% polyacrylamide gel and detected by autoradiography. (C) ImageQuant PhosphorImager quantification of the major E1A isoforms: white bars, light gray bars, and dark gray bars, represent 13S, 12S, and 9S molecules, respectively. Percentages of the three isoforms are the average of at least three independent experiments. Error bars are shown.
    Polymerase Chain Reaction Pcr Amplified, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 95 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Roche
    Average 90 stars, based on 95 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    Stratagene polymerase chain reaction pcr amplified
    Heat shock and cadmium sulfate change the alternative splicing pattern of the adenovirus E1A minigene. (A) Schematic representation of the alternative spliced isoforms of E1A pre-mRNA. The major isoforms 9S, 12S, and 13S are generated by alternative selection of the 5′ splice sites. The minor isoforms 10S and 11S involve the usage of additional internal 3′ splice sites. Sizes, in base pairs, of the corresponding <t>RT-PCR</t> products obtained with the use of the E1A-569 and E1A-1315 primers are shown. (B) In vivo alternative splicing of E1A pre-mRNA is affected by heat shock and by cadmium sulfate. The pCMVE1A plasmid containing the E1A minigene was transfected in HeLa cells. Twenty-four hours after transfection total RNAs were extracted from unstressed cells (37°C) or from cells heat-shocked for 1 h at 42°C. RNAs were also prepared from cells allowed to recover 1, 2, 4, or 6 h at 37°C after heat shock. RNAs were also extracted from cells treated for 3 or 5 h with 30 μM of cadmium sulfate, another induced of <t>HAP</t> bodies. RNA were analyzed by RT-PCR with E1A-569 and E1A-1315 primers. RT-PCR products were resolved on 5% polyacrylamide gel and detected by autoradiography. (C) ImageQuant PhosphorImager quantification of the major E1A isoforms: white bars, light gray bars, and dark gray bars, represent 13S, 12S, and 9S molecules, respectively. Percentages of the three isoforms are the average of at least three independent experiments. Error bars are shown.
    Polymerase Chain Reaction Pcr Amplified, supplied by Stratagene, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Stratagene
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher polymerase chain reaction pcr amplified
    <t>km23-1</t> and km23-2 siRNAs selectively and specifically knock down both exogenous and endogenous km23-1 and km23-2 A: Left panel: 293T cells were transiently transfected with either EV (lane 1), or km23-2-Flag together with NC siRNA (lane 2), km23-1 siRNA (lane 3) or km23-2 siRNA (lane 4). Top panel, blockade of km23-1-Flag expression was analyzed via Western blotting with an anti-Flag M2 Ab. Bottom panel, equal loading was confirmed by blotting with an anti-DIC Ab. Right panel: 293T cells were transiently transfected with either EV (lane 1), or km23-1-Flag together with NC siRNA (lane 2), km23-1 siRNA (lane 3) or km23-2 siRNA (lane 4). Top panel, blockade of km23-1-Flag expression was analyzed via Western blotting with an anti-Flag M2 Ab. Bottom panel, equal loading was confirmed by blotting with an anti-DIC Ab. B: HaCaT cells were transfected with NC, km23-1-, or km23-2-specific siRNAs. Top panel, <t>RT-PCR</t> analysis of human km23-1 (left panel), and human km23-2 (right panel) mRNA expression from HaCaT cells were performed. Bottom panel, GAPDH was used as a loading control. Results are representative of two experiments.
    Polymerase Chain Reaction Pcr Amplified, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Thermo Fisher
    Average 90 stars, based on 287 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    Meridian Life Science polymerase chain reaction pcr amplified
    <t>km23-1</t> and km23-2 siRNAs selectively and specifically knock down both exogenous and endogenous km23-1 and km23-2 A: Left panel: 293T cells were transiently transfected with either EV (lane 1), or km23-2-Flag together with NC siRNA (lane 2), km23-1 siRNA (lane 3) or km23-2 siRNA (lane 4). Top panel, blockade of km23-1-Flag expression was analyzed via Western blotting with an anti-Flag M2 Ab. Bottom panel, equal loading was confirmed by blotting with an anti-DIC Ab. Right panel: 293T cells were transiently transfected with either EV (lane 1), or km23-1-Flag together with NC siRNA (lane 2), km23-1 siRNA (lane 3) or km23-2 siRNA (lane 4). Top panel, blockade of km23-1-Flag expression was analyzed via Western blotting with an anti-Flag M2 Ab. Bottom panel, equal loading was confirmed by blotting with an anti-DIC Ab. B: HaCaT cells were transfected with NC, km23-1-, or km23-2-specific siRNAs. Top panel, <t>RT-PCR</t> analysis of human km23-1 (left panel), and human km23-2 (right panel) mRNA expression from HaCaT cells were performed. Bottom panel, GAPDH was used as a loading control. Results are representative of two experiments.
    Polymerase Chain Reaction Pcr Amplified, supplied by Meridian Life Science, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Meridian Life Science
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    TaKaRa polymerase chain reaction pcr amplified
    Regulation of cell cycle progression, mitosis, cell death, and cytoskeleton organization in <t>N3ICD-infected</t> human renal progenitors before and after differentiation toward the podocyte lineage. ( A, B ): Cell cycle analysis performed on ( A ) mock- and ( B ) N3ICD-infected renal progenitors. One representative of four independent experiments is shown. ( C, D ): Cell cycle analysis performed on ( C ) mock- and ( D ) N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. One representative of four independent experiments is shown. ( E, F ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors as assessed by annexin-V and propidium iodide (PI) staining. One representative of four independent experiments is shown. ( G, H ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage as assessed by annexin-V and PI staining reveals an increase in the percentage of PI/annexin V positive cells in N3ICD-infected cells. One representative of four independent experiments is shown. ( I, J ): Above: H3-Ser10 (red) and tubulin (blue) staining of mock- and N3ICD-infected undifferentiated renal progenitors reveals normal mitoses. For mock-infected cells, a representative metaphase is shown, while for N3ICD-infected cells, a representative anaphase is shown. One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- and N3ICD-infected undifferentiated renal progenitors. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( K, L ): Above: H3-Ser10 (red) and tubulin (blue) staining of renal progenitors infected with vector expressing N3ICD ( L ) after their differentiation toward the podocyte lineage reveals aberrant mitoses characterized by micro/multinucleation (red) and abnormal spindle distribution (blue) in comparison with those infected with an empty vector (mock, [ K ]). One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- ( K ) and N3ICD-infected ( L ) renal progenitors after their differentiation toward the podocyte lineage reveals F-actin filaments distributed as stress-like bundles along the axis of the cells in mock-infected podocytes and redistribution of F-actin fibers to the periphery of the cells in podocytes infected with N3ICD. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( M, N ): Assessment by real-time quantitative reverse transcription polymerase chain reaction <t>(RT-PCR)</t> of Aurora kinase B ( M ), p21 Cip1/WAF-1 and p27 Kip1 ( N ) mRNA expression in mock- and N3ICD-infected undifferentiated renal progenitors. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. ( O, P ): Assessment by real-time quantitative RT-PCR of Aurora kinase B ( O ) and p27 Kip1 , p21 Cip1/WAF-1 ( P ) mRNA expression in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. Abbreviation: FACS, fluorescence activated cell sorting.
    Polymerase Chain Reaction Pcr Amplified, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/TaKaRa
    Average 90 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    GE Healthcare polymerase chain reaction pcr amplified
    Regulation of cell cycle progression, mitosis, cell death, and cytoskeleton organization in <t>N3ICD-infected</t> human renal progenitors before and after differentiation toward the podocyte lineage. ( A, B ): Cell cycle analysis performed on ( A ) mock- and ( B ) N3ICD-infected renal progenitors. One representative of four independent experiments is shown. ( C, D ): Cell cycle analysis performed on ( C ) mock- and ( D ) N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. One representative of four independent experiments is shown. ( E, F ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors as assessed by annexin-V and propidium iodide (PI) staining. One representative of four independent experiments is shown. ( G, H ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage as assessed by annexin-V and PI staining reveals an increase in the percentage of PI/annexin V positive cells in N3ICD-infected cells. One representative of four independent experiments is shown. ( I, J ): Above: H3-Ser10 (red) and tubulin (blue) staining of mock- and N3ICD-infected undifferentiated renal progenitors reveals normal mitoses. For mock-infected cells, a representative metaphase is shown, while for N3ICD-infected cells, a representative anaphase is shown. One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- and N3ICD-infected undifferentiated renal progenitors. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( K, L ): Above: H3-Ser10 (red) and tubulin (blue) staining of renal progenitors infected with vector expressing N3ICD ( L ) after their differentiation toward the podocyte lineage reveals aberrant mitoses characterized by micro/multinucleation (red) and abnormal spindle distribution (blue) in comparison with those infected with an empty vector (mock, [ K ]). One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- ( K ) and N3ICD-infected ( L ) renal progenitors after their differentiation toward the podocyte lineage reveals F-actin filaments distributed as stress-like bundles along the axis of the cells in mock-infected podocytes and redistribution of F-actin fibers to the periphery of the cells in podocytes infected with N3ICD. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( M, N ): Assessment by real-time quantitative reverse transcription polymerase chain reaction <t>(RT-PCR)</t> of Aurora kinase B ( M ), p21 Cip1/WAF-1 and p27 Kip1 ( N ) mRNA expression in mock- and N3ICD-infected undifferentiated renal progenitors. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. ( O, P ): Assessment by real-time quantitative RT-PCR of Aurora kinase B ( O ) and p27 Kip1 , p21 Cip1/WAF-1 ( P ) mRNA expression in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. Abbreviation: FACS, fluorescence activated cell sorting.
    Polymerase Chain Reaction Pcr Amplified, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/GE Healthcare
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    Biotium polymerase chain reaction pcr amplified
    Regulation of cell cycle progression, mitosis, cell death, and cytoskeleton organization in <t>N3ICD-infected</t> human renal progenitors before and after differentiation toward the podocyte lineage. ( A, B ): Cell cycle analysis performed on ( A ) mock- and ( B ) N3ICD-infected renal progenitors. One representative of four independent experiments is shown. ( C, D ): Cell cycle analysis performed on ( C ) mock- and ( D ) N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. One representative of four independent experiments is shown. ( E, F ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors as assessed by annexin-V and propidium iodide (PI) staining. One representative of four independent experiments is shown. ( G, H ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage as assessed by annexin-V and PI staining reveals an increase in the percentage of PI/annexin V positive cells in N3ICD-infected cells. One representative of four independent experiments is shown. ( I, J ): Above: H3-Ser10 (red) and tubulin (blue) staining of mock- and N3ICD-infected undifferentiated renal progenitors reveals normal mitoses. For mock-infected cells, a representative metaphase is shown, while for N3ICD-infected cells, a representative anaphase is shown. One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- and N3ICD-infected undifferentiated renal progenitors. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( K, L ): Above: H3-Ser10 (red) and tubulin (blue) staining of renal progenitors infected with vector expressing N3ICD ( L ) after their differentiation toward the podocyte lineage reveals aberrant mitoses characterized by micro/multinucleation (red) and abnormal spindle distribution (blue) in comparison with those infected with an empty vector (mock, [ K ]). One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- ( K ) and N3ICD-infected ( L ) renal progenitors after their differentiation toward the podocyte lineage reveals F-actin filaments distributed as stress-like bundles along the axis of the cells in mock-infected podocytes and redistribution of F-actin fibers to the periphery of the cells in podocytes infected with N3ICD. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( M, N ): Assessment by real-time quantitative reverse transcription polymerase chain reaction <t>(RT-PCR)</t> of Aurora kinase B ( M ), p21 Cip1/WAF-1 and p27 Kip1 ( N ) mRNA expression in mock- and N3ICD-infected undifferentiated renal progenitors. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. ( O, P ): Assessment by real-time quantitative RT-PCR of Aurora kinase B ( O ) and p27 Kip1 , p21 Cip1/WAF-1 ( P ) mRNA expression in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. Abbreviation: FACS, fluorescence activated cell sorting.
    Polymerase Chain Reaction Pcr Amplified, supplied by Biotium, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Biotium
    Average 90 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    GenScript polymerase chain reaction pcr amplified
    Regulation of cell cycle progression, mitosis, cell death, and cytoskeleton organization in <t>N3ICD-infected</t> human renal progenitors before and after differentiation toward the podocyte lineage. ( A, B ): Cell cycle analysis performed on ( A ) mock- and ( B ) N3ICD-infected renal progenitors. One representative of four independent experiments is shown. ( C, D ): Cell cycle analysis performed on ( C ) mock- and ( D ) N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. One representative of four independent experiments is shown. ( E, F ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors as assessed by annexin-V and propidium iodide (PI) staining. One representative of four independent experiments is shown. ( G, H ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage as assessed by annexin-V and PI staining reveals an increase in the percentage of PI/annexin V positive cells in N3ICD-infected cells. One representative of four independent experiments is shown. ( I, J ): Above: H3-Ser10 (red) and tubulin (blue) staining of mock- and N3ICD-infected undifferentiated renal progenitors reveals normal mitoses. For mock-infected cells, a representative metaphase is shown, while for N3ICD-infected cells, a representative anaphase is shown. One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- and N3ICD-infected undifferentiated renal progenitors. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( K, L ): Above: H3-Ser10 (red) and tubulin (blue) staining of renal progenitors infected with vector expressing N3ICD ( L ) after their differentiation toward the podocyte lineage reveals aberrant mitoses characterized by micro/multinucleation (red) and abnormal spindle distribution (blue) in comparison with those infected with an empty vector (mock, [ K ]). One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- ( K ) and N3ICD-infected ( L ) renal progenitors after their differentiation toward the podocyte lineage reveals F-actin filaments distributed as stress-like bundles along the axis of the cells in mock-infected podocytes and redistribution of F-actin fibers to the periphery of the cells in podocytes infected with N3ICD. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( M, N ): Assessment by real-time quantitative reverse transcription polymerase chain reaction <t>(RT-PCR)</t> of Aurora kinase B ( M ), p21 Cip1/WAF-1 and p27 Kip1 ( N ) mRNA expression in mock- and N3ICD-infected undifferentiated renal progenitors. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. ( O, P ): Assessment by real-time quantitative RT-PCR of Aurora kinase B ( O ) and p27 Kip1 , p21 Cip1/WAF-1 ( P ) mRNA expression in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. Abbreviation: FACS, fluorescence activated cell sorting.
    Polymerase Chain Reaction Pcr Amplified, supplied by GenScript, used in various techniques. Bioz Stars score: 90/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/GenScript
    Average 90 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    Millipore polymerase chain reaction pcr amplified
    Mechanims of inhibition by <t>EBNA3A</t> of the MIZ-1-dependent activation of the CDKN2B transcription. ( A ) EBNA3A-dependent downregulation of CDKN2B expression is independent of CtBP. The CDKN2p-Luc construct was transfected into HeLa cells, together with a CMV-renilla LUC plasmid as internal control and expression plasmids for EBNA3A or EBNA3A-CtBPmut and MIZ-1 as indicated in the Figure. Results are plotted relative to the co-transfected CMV-renilla-LUC plasmid. Error bars represent standard deviations from three replicate assays. Protein expression levels were controled by western blotting using an anti-EBNA3A or an anti-MIZ-1 antibody for one representative experiment (bottom panels). ( B ) EBNA3A-dependent downregulation of CDKN2B expression is independent of MYC. The LCL wt and LCL Δ3A were treated or not with the 10058-F4 MYC inhibitor. Quantification of CDKN2B mRNA levels was performed by real time <t>RT-PCR.</t> Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from three replicate assays based on two different cDNAs. ( C ) EBNA3A inhibits MIZ-1 interaction with its coactivator Nucleophosmin. MIZ-1 was immunoprecipitated from eithe the LCL wt or the LCL Δ3A with an anti-MIZ-1 specific polyclonal antibody or with an unrelated antibody. Immunoprecipitated MIZ-1 and co-immunoprecipitated Nucleophosmin (NPM) proteins were analyzed by western blotting. Inputs correspond to 5% of the cell extract used for immunoprecipitation.
    Polymerase Chain Reaction Pcr Amplified, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Millipore
    Average 90 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    Toyobo polymerase chain reaction pcr amplified
    Mechanims of inhibition by <t>EBNA3A</t> of the MIZ-1-dependent activation of the CDKN2B transcription. ( A ) EBNA3A-dependent downregulation of CDKN2B expression is independent of CtBP. The CDKN2p-Luc construct was transfected into HeLa cells, together with a CMV-renilla LUC plasmid as internal control and expression plasmids for EBNA3A or EBNA3A-CtBPmut and MIZ-1 as indicated in the Figure. Results are plotted relative to the co-transfected CMV-renilla-LUC plasmid. Error bars represent standard deviations from three replicate assays. Protein expression levels were controled by western blotting using an anti-EBNA3A or an anti-MIZ-1 antibody for one representative experiment (bottom panels). ( B ) EBNA3A-dependent downregulation of CDKN2B expression is independent of MYC. The LCL wt and LCL Δ3A were treated or not with the 10058-F4 MYC inhibitor. Quantification of CDKN2B mRNA levels was performed by real time <t>RT-PCR.</t> Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from three replicate assays based on two different cDNAs. ( C ) EBNA3A inhibits MIZ-1 interaction with its coactivator Nucleophosmin. MIZ-1 was immunoprecipitated from eithe the LCL wt or the LCL Δ3A with an anti-MIZ-1 specific polyclonal antibody or with an unrelated antibody. Immunoprecipitated MIZ-1 and co-immunoprecipitated Nucleophosmin (NPM) proteins were analyzed by western blotting. Inputs correspond to 5% of the cell extract used for immunoprecipitation.
    Polymerase Chain Reaction Pcr Amplified, supplied by Toyobo, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Toyobo
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    90
    OriGene polymerase chain reaction pcr amplified
    <t>Nup62</t> knockdown significantly inhibited HIV-1 infection by reducing viral DNA integration. A , C8166 cells were transduced with lentiviral vectors harboring Nup62 shRNA or empty vector and were subsequently analyzed for Nup62 expression by WB at different time points. γ-Actin was included as an internal control. B , inhibitory effect of Nup62-KD on HIV-1 replication in CD4 + C8166 T cells and macrophages. Nup62-KD and empty C8166 cells were infected with VSV-G pseudotyped luc-expressing HIV-1 (pNL-BruΔBgl/Luc) ( left panel ) or HIV-1 pNL 4.3-GFP ( right panel ). The Luc activity from cells or HIV Gag-p24 levels of supernatants was measured to monitor viral replication after 48 h. C , monocyte-derived macrophages from healthy donors were transduced with lentiviral vectors encoding Nup62-shRNA and Nup62-siRNA, as described under “Experimental Procedures.” At day 4 post-transduction, MDMs were infected with the pNL4.3-Bal virus strain. Viral replication was monitored by measuring the levels of the HIV-1 Gag-p24 antigen in supernatants at different time points after infection. D , Nup62-KD, importin α3-kDa ( Imp α 3-kDa ), and ScRNA-C8166 T cells were infected with HIV-1 pNL4.3 Env + /R − /Luc virus, and 20 h later, DNA was extracted from infected cells, and HIV-1 late reverse transcription products ( upper panel ), HIV-1 two-LTR circles ( middle panel ), and the integrated DNA levels ( lower panel ) were analyzed by <t>RQ-PCR</t> using corresponding primers, as described under “Experimental Procedures.” Means and standard errors are representative of the results for duplicate samples from a typical experiment and were confirmed in two other independent experiments.
    Polymerase Chain Reaction Pcr Amplified, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/OriGene
    Average 90 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    94
    Addgene inc pcr amplified
    Dependence of expression on MYC, <t>AKT</t> and BCLXL for sustained growth of transformed T cells in vitro (A) Relative mRNA expression of MYC, AKT and BCLXL was quantified using real-time <t>PCR</t> on indicated days after removal of Dox. (B) Cellular viability, apoptosis, cell size, cell cycle status and cumulative number of cells were recorded for 7 days in the presence of absence of Dox.
    Pcr Amplified, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1690 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Addgene inc
    Average 94 stars, based on 1690 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    93
    GenScript pcr amplified bclaf1
    Dependence of expression on MYC, <t>AKT</t> and BCLXL for sustained growth of transformed T cells in vitro (A) Relative mRNA expression of MYC, AKT and BCLXL was quantified using real-time <t>PCR</t> on indicated days after removal of Dox. (B) Cellular viability, apoptosis, cell size, cell cycle status and cumulative number of cells were recorded for 7 days in the presence of absence of Dox.
    Pcr Amplified Bclaf1, supplied by GenScript, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified bclaf1/product/GenScript
    Average 93 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    pcr amplified bclaf1 - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    93
    Genewiz pcr amplified loci
    Dependence of expression on MYC, <t>AKT</t> and BCLXL for sustained growth of transformed T cells in vitro (A) Relative mRNA expression of MYC, AKT and BCLXL was quantified using real-time <t>PCR</t> on indicated days after removal of Dox. (B) Cellular viability, apoptosis, cell size, cell cycle status and cumulative number of cells were recorded for 7 days in the presence of absence of Dox.
    Pcr Amplified Loci, supplied by Genewiz, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified loci/product/Genewiz
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pcr amplified loci - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    90
    Addgene inc pcr amplified mrfp
    Dependence of expression on MYC, <t>AKT</t> and BCLXL for sustained growth of transformed T cells in vitro (A) Relative mRNA expression of MYC, AKT and BCLXL was quantified using real-time <t>PCR</t> on indicated days after removal of Dox. (B) Cellular viability, apoptosis, cell size, cell cycle status and cumulative number of cells were recorded for 7 days in the presence of absence of Dox.
    Pcr Amplified Mrfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified mrfp/product/Addgene inc
    Average 90 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    pcr amplified mrfp - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    Image Search Results


    Propagation and cell binding of gB-NT deletion mutants. ( A ) BHK-21 cells were infected (0.01 p.f.u./cell) with wild-type (WT) MuHV-4, each deletion mutant or a revertant of the gBΔ2–30 mutant (REV). Virus growth with time was then monitored by plaque assay. ( B ) EGFP + version of the same viruses as in (A) was added to BHK-21 cells (1 p.f.u./cell) for the time indicated, then washed with PBS to remove unbound virions. The cells were then cultured overnight and infection was quantitated the next day by flow cytometric assay of viral eGFP expression. Equivalent data were obtained in two further experiments. ( C ) NMuMG cells were stained with gB-Fc fusions recovered from supernatants of transfected 293T cells. The shaded histogram is staining with secondary antibody only. None of the gB-NT deletions affected cell binding. ( D ) The gB-Fc fusion protein was pre-incubated with the neutralizing gB-NT-specific mAb MG-2C10 before being used to stain NMuMG cells. No difference in staining was observed. ( E ) NS0 myeloma cells were exposed (18 h) to eGFP + wild-type (WT) MuHV-4 or gB-NT deletion mutants. Infection was then quantitated by flow cytometric assay of viral eGFP expression. ( F ) Mice were infected intranasally with wild-type (WT) MuHV-4, the gBΔ2–14 or gBΔ2–30 mutant or a revertant of the gBΔ2–30 mutant (REV). Lungs were harvested at 6 days post-infection and infectious virus quantitated by plaque assay. Each bar shows the mean±s.e.m. titers of five mice per group. ( G ) At 14 days after infection as for (B), spleens were harvested and virus load measured by infectious center assay. Each bar shows the mean±s.e.m. titers of five mice per group. ( H ) DNA was extracted from the same spleens as in (C) and assayed for viral genome load by real-time PCR. Each bar shows the mean±s.e.m. of five mice per group.

    Journal: The EMBO Journal

    Article Title: Antibody evasion by the N terminus of murid herpesvirus-4 glycoprotein B

    doi: 10.1038/sj.emboj.7601925

    Figure Lengend Snippet: Propagation and cell binding of gB-NT deletion mutants. ( A ) BHK-21 cells were infected (0.01 p.f.u./cell) with wild-type (WT) MuHV-4, each deletion mutant or a revertant of the gBΔ2–30 mutant (REV). Virus growth with time was then monitored by plaque assay. ( B ) EGFP + version of the same viruses as in (A) was added to BHK-21 cells (1 p.f.u./cell) for the time indicated, then washed with PBS to remove unbound virions. The cells were then cultured overnight and infection was quantitated the next day by flow cytometric assay of viral eGFP expression. Equivalent data were obtained in two further experiments. ( C ) NMuMG cells were stained with gB-Fc fusions recovered from supernatants of transfected 293T cells. The shaded histogram is staining with secondary antibody only. None of the gB-NT deletions affected cell binding. ( D ) The gB-Fc fusion protein was pre-incubated with the neutralizing gB-NT-specific mAb MG-2C10 before being used to stain NMuMG cells. No difference in staining was observed. ( E ) NS0 myeloma cells were exposed (18 h) to eGFP + wild-type (WT) MuHV-4 or gB-NT deletion mutants. Infection was then quantitated by flow cytometric assay of viral eGFP expression. ( F ) Mice were infected intranasally with wild-type (WT) MuHV-4, the gBΔ2–14 or gBΔ2–30 mutant or a revertant of the gBΔ2–30 mutant (REV). Lungs were harvested at 6 days post-infection and infectious virus quantitated by plaque assay. Each bar shows the mean±s.e.m. titers of five mice per group. ( G ) At 14 days after infection as for (B), spleens were harvested and virus load measured by infectious center assay. Each bar shows the mean±s.e.m. titers of five mice per group. ( H ) DNA was extracted from the same spleens as in (C) and assayed for viral genome load by real-time PCR. Each bar shows the mean±s.e.m. of five mice per group.

    Article Snippet: We first PCR-amplified (Phusion DNA polymerase; New England Biolabs, Hitchin, UK) coordinates 15 001–16 600 of the MuHV-4 genome , including Kpn I and Eco RI restriction sites in the respective 5′ and 3′ primers, and cloned the PCR product into the Kpn I/Eco RI sites of pSP73 (Promega Corporation, Southampton, UK).

    Techniques: Binding Assay, Infection, Mutagenesis, Plaque Assay, Cell Culture, Flow Cytometry, Expressing, Staining, Transfection, Incubation, Mouse Assay, Real-time Polymerase Chain Reaction

    iCLIP identifies the TIA1 and TIAL1 crosslink sites with nucleotide resolution. Autoradiogram of 32 P-labelled RNA crosslinked to TIA1 (A) or TIAL1 (B) in HeLa cells. Immunoprecipitation was performed with either anti-TIA1 or anti-TIAL1 antibody using lysate from UV-crosslinked HeLa cells, cells transfected with TIA1 or TIAL1, TIA1/TIAL1 KD cells, or non-crosslinked cells. High and low RNase concentrations were used and protein G beads were used as a control. The Western blots below the autoradiograms show the input lysate used for each immunoprecipitation. (C) TIA1 and TIAL1 crosslink to uridine tracts downstream of the alternative 5′ splice sites in the CLIP4 gene. The cDNA positions are colour-coded for three replicate TIA1 and TIAL1 experiments, and the random barcode (shown on the left) is used to identify unique iCLIP cDNAs (number in brackets indicates the number of corresponding PCR duplicates). Below, the bar graphs show the cDNA count (number of cDNAs at each crosslink site). Pre-mRNA sequence is shown below with crosslink nucleotides in red. The exon and intron positions of the two isoforms of CLIP4 mRNA are shown at the bottom.

    Journal: PLoS Biology

    Article Title: iCLIP Predicts the Dual Splicing Effects of TIA-RNA Interactions

    doi: 10.1371/journal.pbio.1000530

    Figure Lengend Snippet: iCLIP identifies the TIA1 and TIAL1 crosslink sites with nucleotide resolution. Autoradiogram of 32 P-labelled RNA crosslinked to TIA1 (A) or TIAL1 (B) in HeLa cells. Immunoprecipitation was performed with either anti-TIA1 or anti-TIAL1 antibody using lysate from UV-crosslinked HeLa cells, cells transfected with TIA1 or TIAL1, TIA1/TIAL1 KD cells, or non-crosslinked cells. High and low RNase concentrations were used and protein G beads were used as a control. The Western blots below the autoradiograms show the input lysate used for each immunoprecipitation. (C) TIA1 and TIAL1 crosslink to uridine tracts downstream of the alternative 5′ splice sites in the CLIP4 gene. The cDNA positions are colour-coded for three replicate TIA1 and TIAL1 experiments, and the random barcode (shown on the left) is used to identify unique iCLIP cDNAs (number in brackets indicates the number of corresponding PCR duplicates). Below, the bar graphs show the cDNA count (number of cDNAs at each crosslink site). Pre-mRNA sequence is shown below with crosslink nucleotides in red. The exon and intron positions of the two isoforms of CLIP4 mRNA are shown at the bottom.

    Article Snippet: Linearised cDNA was then PCR-amplified using primers complementary to the adapter regions and subjected to high-throughput sequencing using Illumina GA2.

    Techniques: Immunoprecipitation, Transfection, Western Blot, Polymerase Chain Reaction, Sequencing

    Heat shock and cadmium sulfate change the alternative splicing pattern of the adenovirus E1A minigene. (A) Schematic representation of the alternative spliced isoforms of E1A pre-mRNA. The major isoforms 9S, 12S, and 13S are generated by alternative selection of the 5′ splice sites. The minor isoforms 10S and 11S involve the usage of additional internal 3′ splice sites. Sizes, in base pairs, of the corresponding RT-PCR products obtained with the use of the E1A-569 and E1A-1315 primers are shown. (B) In vivo alternative splicing of E1A pre-mRNA is affected by heat shock and by cadmium sulfate. The pCMVE1A plasmid containing the E1A minigene was transfected in HeLa cells. Twenty-four hours after transfection total RNAs were extracted from unstressed cells (37°C) or from cells heat-shocked for 1 h at 42°C. RNAs were also prepared from cells allowed to recover 1, 2, 4, or 6 h at 37°C after heat shock. RNAs were also extracted from cells treated for 3 or 5 h with 30 μM of cadmium sulfate, another induced of HAP bodies. RNA were analyzed by RT-PCR with E1A-569 and E1A-1315 primers. RT-PCR products were resolved on 5% polyacrylamide gel and detected by autoradiography. (C) ImageQuant PhosphorImager quantification of the major E1A isoforms: white bars, light gray bars, and dark gray bars, represent 13S, 12S, and 9S molecules, respectively. Percentages of the three isoforms are the average of at least three independent experiments. Error bars are shown.

    Journal: Molecular Biology of the Cell

    Article Title: Stress-induced Nuclear Bodies Are Sites of Accumulation of Pre-mRNA Processing Factors

    doi:

    Figure Lengend Snippet: Heat shock and cadmium sulfate change the alternative splicing pattern of the adenovirus E1A minigene. (A) Schematic representation of the alternative spliced isoforms of E1A pre-mRNA. The major isoforms 9S, 12S, and 13S are generated by alternative selection of the 5′ splice sites. The minor isoforms 10S and 11S involve the usage of additional internal 3′ splice sites. Sizes, in base pairs, of the corresponding RT-PCR products obtained with the use of the E1A-569 and E1A-1315 primers are shown. (B) In vivo alternative splicing of E1A pre-mRNA is affected by heat shock and by cadmium sulfate. The pCMVE1A plasmid containing the E1A minigene was transfected in HeLa cells. Twenty-four hours after transfection total RNAs were extracted from unstressed cells (37°C) or from cells heat-shocked for 1 h at 42°C. RNAs were also prepared from cells allowed to recover 1, 2, 4, or 6 h at 37°C after heat shock. RNAs were also extracted from cells treated for 3 or 5 h with 30 μM of cadmium sulfate, another induced of HAP bodies. RNA were analyzed by RT-PCR with E1A-569 and E1A-1315 primers. RT-PCR products were resolved on 5% polyacrylamide gel and detected by autoradiography. (C) ImageQuant PhosphorImager quantification of the major E1A isoforms: white bars, light gray bars, and dark gray bars, represent 13S, 12S, and 9S molecules, respectively. Percentages of the three isoforms are the average of at least three independent experiments. Error bars are shown.

    Article Snippet: Portions of the open reading frame of HAP were polymerase chain reaction (PCR)-amplified with Pwo polymerase (Roche Molecular Biochemicals) with the use of the HAP cDNA ( ) as template and suitable primers synthesized on the basis of the cDNA sequence (accession number NM-002967).

    Techniques: Generated, Selection, Reverse Transcription Polymerase Chain Reaction, In Vivo, Plasmid Preparation, Transfection, Autoradiography

    km23-1 and km23-2 siRNAs selectively and specifically knock down both exogenous and endogenous km23-1 and km23-2 A: Left panel: 293T cells were transiently transfected with either EV (lane 1), or km23-2-Flag together with NC siRNA (lane 2), km23-1 siRNA (lane 3) or km23-2 siRNA (lane 4). Top panel, blockade of km23-1-Flag expression was analyzed via Western blotting with an anti-Flag M2 Ab. Bottom panel, equal loading was confirmed by blotting with an anti-DIC Ab. Right panel: 293T cells were transiently transfected with either EV (lane 1), or km23-1-Flag together with NC siRNA (lane 2), km23-1 siRNA (lane 3) or km23-2 siRNA (lane 4). Top panel, blockade of km23-1-Flag expression was analyzed via Western blotting with an anti-Flag M2 Ab. Bottom panel, equal loading was confirmed by blotting with an anti-DIC Ab. B: HaCaT cells were transfected with NC, km23-1-, or km23-2-specific siRNAs. Top panel, RT-PCR analysis of human km23-1 (left panel), and human km23-2 (right panel) mRNA expression from HaCaT cells were performed. Bottom panel, GAPDH was used as a loading control. Results are representative of two experiments.

    Journal: Journal of cellular physiology

    Article Title: Requirement of a dynein light chain in TGF?/Smad3 signaling

    doi: 10.1002/jcp.21910

    Figure Lengend Snippet: km23-1 and km23-2 siRNAs selectively and specifically knock down both exogenous and endogenous km23-1 and km23-2 A: Left panel: 293T cells were transiently transfected with either EV (lane 1), or km23-2-Flag together with NC siRNA (lane 2), km23-1 siRNA (lane 3) or km23-2 siRNA (lane 4). Top panel, blockade of km23-1-Flag expression was analyzed via Western blotting with an anti-Flag M2 Ab. Bottom panel, equal loading was confirmed by blotting with an anti-DIC Ab. Right panel: 293T cells were transiently transfected with either EV (lane 1), or km23-1-Flag together with NC siRNA (lane 2), km23-1 siRNA (lane 3) or km23-2 siRNA (lane 4). Top panel, blockade of km23-1-Flag expression was analyzed via Western blotting with an anti-Flag M2 Ab. Bottom panel, equal loading was confirmed by blotting with an anti-DIC Ab. B: HaCaT cells were transfected with NC, km23-1-, or km23-2-specific siRNAs. Top panel, RT-PCR analysis of human km23-1 (left panel), and human km23-2 (right panel) mRNA expression from HaCaT cells were performed. Bottom panel, GAPDH was used as a loading control. Results are representative of two experiments.

    Article Snippet: To prepare human km23-2-Flag, hkm23-2 was polymerase chain reaction (PCR)-amplified from a plasmid (IMAGE cDNA clone: 781013, Invitrogen) containing the coding region of human km23-2, with primers containing additional suitable flanking restriction enzyme sites for BglII (5’ primer) and SalI (3’ primer), and inserted into pCMV5-Flag (Sigma) after digestion with BglII and SalI restriction enzymes.

    Techniques: Transfection, Expressing, Western Blot, Reverse Transcription Polymerase Chain Reaction

    TGFβ-mediated induction of PAI-Luc luciferase activity and endogenous PAI-1 gene expression in HaCaT cells specifically requires km23-2, but not km23-1 A: HaCaT cells were transfected with NC siRNA, km23-1 siRNA, or km23-2 siRNA. 24h after transfection, the medium was replaced with SF medium for 1 h, followed by incubation of cells in the absence (open bar) and presence (black bar) of TGFβ (5ng/ml) for an additional 18 h. Luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega). The results are representative of at least two experiments, each performed in triplicate. B: HaCaT cells were transfected and treated as described for Fig. 3A. Real-time RT-PCR analysis of human PAI-1 mRNA expression from HaCaT cells was performed. Bars represent mean ± SD of PAI-1 mRNA levels normalized to control 18S rRNA levels. Results are representative of two experiments.

    Journal: Journal of cellular physiology

    Article Title: Requirement of a dynein light chain in TGF?/Smad3 signaling

    doi: 10.1002/jcp.21910

    Figure Lengend Snippet: TGFβ-mediated induction of PAI-Luc luciferase activity and endogenous PAI-1 gene expression in HaCaT cells specifically requires km23-2, but not km23-1 A: HaCaT cells were transfected with NC siRNA, km23-1 siRNA, or km23-2 siRNA. 24h after transfection, the medium was replaced with SF medium for 1 h, followed by incubation of cells in the absence (open bar) and presence (black bar) of TGFβ (5ng/ml) for an additional 18 h. Luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega). The results are representative of at least two experiments, each performed in triplicate. B: HaCaT cells were transfected and treated as described for Fig. 3A. Real-time RT-PCR analysis of human PAI-1 mRNA expression from HaCaT cells was performed. Bars represent mean ± SD of PAI-1 mRNA levels normalized to control 18S rRNA levels. Results are representative of two experiments.

    Article Snippet: To prepare human km23-2-Flag, hkm23-2 was polymerase chain reaction (PCR)-amplified from a plasmid (IMAGE cDNA clone: 781013, Invitrogen) containing the coding region of human km23-2, with primers containing additional suitable flanking restriction enzyme sites for BglII (5’ primer) and SalI (3’ primer), and inserted into pCMV5-Flag (Sigma) after digestion with BglII and SalI restriction enzymes.

    Techniques: Luciferase, Activity Assay, Expressing, Transfection, Incubation, Reporter Assay, Quantitative RT-PCR

    The mutational spectrum of Qβ replicase, Mut II, and EP-PCR . (A): Qβ replicase did not have significant bias for A/T- > N/N (black bars) or G/C- > N/N (grey bars) changes. Mut II and EP-PCR using either Mn 2+ (manufacture's protocol 3) or Mn 2+ with an unbalanced dGTP concentration (manufacture's protocol 7) demonstrated significant A/T- > N/N bias. (B): The different transition/transversion ratios between the methods. Qβ replicase and Mut II did not show a significant bias for transitions (black bars) over transversions (grey bars) compared to both versions of EP-PCR, which showed a significant preference for transitions. (C): The percentage of all possible base substitutions for each of the mutagenesis methods analyzed. All possible base substitutions were recovered with Qβ replicase. The G/C - > C/G transversion was only recovered once with Mut II, which also over represented A/T- > T/A transversions. With EP-PCR (manufacture's protocol 3) A/T- > T/A transversions were over represented, the A/T- > C/G transversion was only recovered once and the G/C - > C/G transversion was not recovered. G/C - > C/G and G/C- > T/A transversions were not recovered with EP-PCR (manufacture's protocol 7). Both versions of EP-PCR over represented A/T- > G/C transitions. Experiments were repeated 2 times with the standard deviation between experiments shown as error bars. The data set used to generate Figure 3 was as follows: 71 point mutations were characterized for Qβ replicase (52,327 bases were sequenced in total with an average mutation rate of 1 point mutation every 737 bases giving a mutation frequency of 1.35). 48 point mutations were characterized for Mut II (6720 bases were sequenced in total with a mutation rate of 1/140 bases giving a mutation frequency of 7.14). EP-PCR manufacture's protocol 3; 74 point mutations were characterized (36,960 bases were sequenced in total with a mutation rate of 1/499 bases and a mutation frequency of 2.00) and manufacture's protocol 7; 43 point mutations were characterized (9,600 bases were sequenced in total with a mutation rate of 1/225 bases giving a mutation frequency of 4.48).

    Journal: BMC Biotechnology

    Article Title: RNA mutagenesis yields highly diverse mRNA libraries for in vitro protein evolution

    doi: 10.1186/1472-6750-7-18

    Figure Lengend Snippet: The mutational spectrum of Qβ replicase, Mut II, and EP-PCR . (A): Qβ replicase did not have significant bias for A/T- > N/N (black bars) or G/C- > N/N (grey bars) changes. Mut II and EP-PCR using either Mn 2+ (manufacture's protocol 3) or Mn 2+ with an unbalanced dGTP concentration (manufacture's protocol 7) demonstrated significant A/T- > N/N bias. (B): The different transition/transversion ratios between the methods. Qβ replicase and Mut II did not show a significant bias for transitions (black bars) over transversions (grey bars) compared to both versions of EP-PCR, which showed a significant preference for transitions. (C): The percentage of all possible base substitutions for each of the mutagenesis methods analyzed. All possible base substitutions were recovered with Qβ replicase. The G/C - > C/G transversion was only recovered once with Mut II, which also over represented A/T- > T/A transversions. With EP-PCR (manufacture's protocol 3) A/T- > T/A transversions were over represented, the A/T- > C/G transversion was only recovered once and the G/C - > C/G transversion was not recovered. G/C - > C/G and G/C- > T/A transversions were not recovered with EP-PCR (manufacture's protocol 7). Both versions of EP-PCR over represented A/T- > G/C transitions. Experiments were repeated 2 times with the standard deviation between experiments shown as error bars. The data set used to generate Figure 3 was as follows: 71 point mutations were characterized for Qβ replicase (52,327 bases were sequenced in total with an average mutation rate of 1 point mutation every 737 bases giving a mutation frequency of 1.35). 48 point mutations were characterized for Mut II (6720 bases were sequenced in total with a mutation rate of 1/140 bases giving a mutation frequency of 7.14). EP-PCR manufacture's protocol 3; 74 point mutations were characterized (36,960 bases were sequenced in total with a mutation rate of 1/499 bases and a mutation frequency of 2.00) and manufacture's protocol 7; 43 point mutations were characterized (9,600 bases were sequenced in total with a mutation rate of 1/225 bases giving a mutation frequency of 4.48).

    Article Snippet: The mRNA template was amplified with Qβ replicase and subsequently reverse transcribed and PCR-amplified (Superscript III™ RT-PCR; Invitrogen) prior to blunt-end cloning into pPCR-Script Amp SK (+) (Stratagene), transformed into E. coli strain HB2151, and clones chosen at random were sequenced.

    Techniques: Polymerase Chain Reaction, Concentration Assay, Mutagenesis, Standard Deviation

    Regulation of cell cycle progression, mitosis, cell death, and cytoskeleton organization in N3ICD-infected human renal progenitors before and after differentiation toward the podocyte lineage. ( A, B ): Cell cycle analysis performed on ( A ) mock- and ( B ) N3ICD-infected renal progenitors. One representative of four independent experiments is shown. ( C, D ): Cell cycle analysis performed on ( C ) mock- and ( D ) N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. One representative of four independent experiments is shown. ( E, F ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors as assessed by annexin-V and propidium iodide (PI) staining. One representative of four independent experiments is shown. ( G, H ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage as assessed by annexin-V and PI staining reveals an increase in the percentage of PI/annexin V positive cells in N3ICD-infected cells. One representative of four independent experiments is shown. ( I, J ): Above: H3-Ser10 (red) and tubulin (blue) staining of mock- and N3ICD-infected undifferentiated renal progenitors reveals normal mitoses. For mock-infected cells, a representative metaphase is shown, while for N3ICD-infected cells, a representative anaphase is shown. One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- and N3ICD-infected undifferentiated renal progenitors. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( K, L ): Above: H3-Ser10 (red) and tubulin (blue) staining of renal progenitors infected with vector expressing N3ICD ( L ) after their differentiation toward the podocyte lineage reveals aberrant mitoses characterized by micro/multinucleation (red) and abnormal spindle distribution (blue) in comparison with those infected with an empty vector (mock, [ K ]). One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- ( K ) and N3ICD-infected ( L ) renal progenitors after their differentiation toward the podocyte lineage reveals F-actin filaments distributed as stress-like bundles along the axis of the cells in mock-infected podocytes and redistribution of F-actin fibers to the periphery of the cells in podocytes infected with N3ICD. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( M, N ): Assessment by real-time quantitative reverse transcription polymerase chain reaction (RT-PCR) of Aurora kinase B ( M ), p21 Cip1/WAF-1 and p27 Kip1 ( N ) mRNA expression in mock- and N3ICD-infected undifferentiated renal progenitors. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. ( O, P ): Assessment by real-time quantitative RT-PCR of Aurora kinase B ( O ) and p27 Kip1 , p21 Cip1/WAF-1 ( P ) mRNA expression in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. Abbreviation: FACS, fluorescence activated cell sorting.

    Journal: Stem Cells (Dayton, Ohio)

    Article Title: Notch Activation Differentially Regulates Renal Progenitors Proliferation and Differentiation Toward the Podocyte Lineage in Glomerular Disorders

    doi: 10.1002/stem.492

    Figure Lengend Snippet: Regulation of cell cycle progression, mitosis, cell death, and cytoskeleton organization in N3ICD-infected human renal progenitors before and after differentiation toward the podocyte lineage. ( A, B ): Cell cycle analysis performed on ( A ) mock- and ( B ) N3ICD-infected renal progenitors. One representative of four independent experiments is shown. ( C, D ): Cell cycle analysis performed on ( C ) mock- and ( D ) N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. One representative of four independent experiments is shown. ( E, F ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors as assessed by annexin-V and propidium iodide (PI) staining. One representative of four independent experiments is shown. ( G, H ): FACS analysis of apoptosis/necrosis in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage as assessed by annexin-V and PI staining reveals an increase in the percentage of PI/annexin V positive cells in N3ICD-infected cells. One representative of four independent experiments is shown. ( I, J ): Above: H3-Ser10 (red) and tubulin (blue) staining of mock- and N3ICD-infected undifferentiated renal progenitors reveals normal mitoses. For mock-infected cells, a representative metaphase is shown, while for N3ICD-infected cells, a representative anaphase is shown. One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- and N3ICD-infected undifferentiated renal progenitors. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( K, L ): Above: H3-Ser10 (red) and tubulin (blue) staining of renal progenitors infected with vector expressing N3ICD ( L ) after their differentiation toward the podocyte lineage reveals aberrant mitoses characterized by micro/multinucleation (red) and abnormal spindle distribution (blue) in comparison with those infected with an empty vector (mock, [ K ]). One representative of six independent experiments is shown. Scale bar = 10 μm. Below: Phalloidin staining (red) of mock- ( K ) and N3ICD-infected ( L ) renal progenitors after their differentiation toward the podocyte lineage reveals F-actin filaments distributed as stress-like bundles along the axis of the cells in mock-infected podocytes and redistribution of F-actin fibers to the periphery of the cells in podocytes infected with N3ICD. Topro-3 (blue) counterstains nuclei. One representative of six independent experiments is shown. Scale bar = 50 μm. ( M, N ): Assessment by real-time quantitative reverse transcription polymerase chain reaction (RT-PCR) of Aurora kinase B ( M ), p21 Cip1/WAF-1 and p27 Kip1 ( N ) mRNA expression in mock- and N3ICD-infected undifferentiated renal progenitors. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. ( O, P ): Assessment by real-time quantitative RT-PCR of Aurora kinase B ( O ) and p27 Kip1 , p21 Cip1/WAF-1 ( P ) mRNA expression in mock- and N3ICD-infected renal progenitors after their differentiation toward the podocyte lineage. Results are expressed as mean ± SEM of triplicate assessments in seven separate experiments. Abbreviation: FACS, fluorescence activated cell sorting.

    Article Snippet: Human Renal Progenitor Infection N1ICD (5275–7332 bp), N2ICD (5094–7413 bp), or N3ICD (4954–6996 bp) were polymerase chain reaction (PCR)-amplified from renal progenitor cells cDNA and cloned into the bicistronic pLVX-IRES-sGreen1 lentiviral vector (Clontech, Mountain View, CA, USA, http://www.clontech.com ) leading to the gene-of-interest and the ZsGreen1 fluorescent protein to be simultaneously coexpressed from a single mRNA transcript.

    Techniques: Infection, Cell Cycle Assay, FACS, Staining, Plasmid Preparation, Expressing, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Fluorescence

    Mechanims of inhibition by EBNA3A of the MIZ-1-dependent activation of the CDKN2B transcription. ( A ) EBNA3A-dependent downregulation of CDKN2B expression is independent of CtBP. The CDKN2p-Luc construct was transfected into HeLa cells, together with a CMV-renilla LUC plasmid as internal control and expression plasmids for EBNA3A or EBNA3A-CtBPmut and MIZ-1 as indicated in the Figure. Results are plotted relative to the co-transfected CMV-renilla-LUC plasmid. Error bars represent standard deviations from three replicate assays. Protein expression levels were controled by western blotting using an anti-EBNA3A or an anti-MIZ-1 antibody for one representative experiment (bottom panels). ( B ) EBNA3A-dependent downregulation of CDKN2B expression is independent of MYC. The LCL wt and LCL Δ3A were treated or not with the 10058-F4 MYC inhibitor. Quantification of CDKN2B mRNA levels was performed by real time RT-PCR. Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from three replicate assays based on two different cDNAs. ( C ) EBNA3A inhibits MIZ-1 interaction with its coactivator Nucleophosmin. MIZ-1 was immunoprecipitated from eithe the LCL wt or the LCL Δ3A with an anti-MIZ-1 specific polyclonal antibody or with an unrelated antibody. Immunoprecipitated MIZ-1 and co-immunoprecipitated Nucleophosmin (NPM) proteins were analyzed by western blotting. Inputs correspond to 5% of the cell extract used for immunoprecipitation.

    Journal: Nucleic Acids Research

    Article Title: Epstein–Barr virus nuclear antigen 3A protein regulates CDKN2B transcription via interaction with MIZ-1

    doi: 10.1093/nar/gku697

    Figure Lengend Snippet: Mechanims of inhibition by EBNA3A of the MIZ-1-dependent activation of the CDKN2B transcription. ( A ) EBNA3A-dependent downregulation of CDKN2B expression is independent of CtBP. The CDKN2p-Luc construct was transfected into HeLa cells, together with a CMV-renilla LUC plasmid as internal control and expression plasmids for EBNA3A or EBNA3A-CtBPmut and MIZ-1 as indicated in the Figure. Results are plotted relative to the co-transfected CMV-renilla-LUC plasmid. Error bars represent standard deviations from three replicate assays. Protein expression levels were controled by western blotting using an anti-EBNA3A or an anti-MIZ-1 antibody for one representative experiment (bottom panels). ( B ) EBNA3A-dependent downregulation of CDKN2B expression is independent of MYC. The LCL wt and LCL Δ3A were treated or not with the 10058-F4 MYC inhibitor. Quantification of CDKN2B mRNA levels was performed by real time RT-PCR. Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from three replicate assays based on two different cDNAs. ( C ) EBNA3A inhibits MIZ-1 interaction with its coactivator Nucleophosmin. MIZ-1 was immunoprecipitated from eithe the LCL wt or the LCL Δ3A with an anti-MIZ-1 specific polyclonal antibody or with an unrelated antibody. Immunoprecipitated MIZ-1 and co-immunoprecipitated Nucleophosmin (NPM) proteins were analyzed by western blotting. Inputs correspond to 5% of the cell extract used for immunoprecipitation.

    Article Snippet: Each ORF was polymerase chain reaction (PCR)-amplified (KOD polymerase, Novagen) from pSG5-EBNA3A/3B/3C ( ) using reverse and forward primers containing the attB1 and attB2 recombination sites respectively, then cloned into pDONR207 (BP Clonase, Invitrogen).

    Techniques: Inhibition, Activation Assay, Expressing, Construct, Transfection, Plasmid Preparation, Western Blot, Quantitative RT-PCR, Standard Deviation, Immunoprecipitation

    CDKN2B expression in lymphoblastoid cell lines is highly dependent on the presence or absence of EBNA3A. Analysis of CDKN2B mRNA expression levels from a normal LCL (wt) or an LCL established from the same donor but infected with an EBNA3A-deficient recombinant virus (D2 E3AmtB3) (LCLΔ3A) by either standard RT-PCR using actin mRNA as an internal control ( A ) or by real time RT-PCR ( B ). Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from four independent experiments. ( C ) ΔE3A-LCL doxE3A cells were induced for EBNA3A expression by treatment with 200 ng/ml Dox for 24, 48 or 72 h or left untreated. The percentage of cells expressing the NGFR—a control gene expressed simultaneously with EBNA3A from a common bicistronic promoter—upon Dox treatment was evaluated by FACS to be 65% after 72 h. CDKN2B transcripts in total RNA were quantified by RTqPCR normalized to GAPDH RNA. EBNA3A protein levels were analyzed by western blotting (bottom panel). The data shown are derived from a single experiment but are representative of three experiments. Error bars represent standard deviation from three qPCR replicates.

    Journal: Nucleic Acids Research

    Article Title: Epstein–Barr virus nuclear antigen 3A protein regulates CDKN2B transcription via interaction with MIZ-1

    doi: 10.1093/nar/gku697

    Figure Lengend Snippet: CDKN2B expression in lymphoblastoid cell lines is highly dependent on the presence or absence of EBNA3A. Analysis of CDKN2B mRNA expression levels from a normal LCL (wt) or an LCL established from the same donor but infected with an EBNA3A-deficient recombinant virus (D2 E3AmtB3) (LCLΔ3A) by either standard RT-PCR using actin mRNA as an internal control ( A ) or by real time RT-PCR ( B ). Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from four independent experiments. ( C ) ΔE3A-LCL doxE3A cells were induced for EBNA3A expression by treatment with 200 ng/ml Dox for 24, 48 or 72 h or left untreated. The percentage of cells expressing the NGFR—a control gene expressed simultaneously with EBNA3A from a common bicistronic promoter—upon Dox treatment was evaluated by FACS to be 65% after 72 h. CDKN2B transcripts in total RNA were quantified by RTqPCR normalized to GAPDH RNA. EBNA3A protein levels were analyzed by western blotting (bottom panel). The data shown are derived from a single experiment but are representative of three experiments. Error bars represent standard deviation from three qPCR replicates.

    Article Snippet: Each ORF was polymerase chain reaction (PCR)-amplified (KOD polymerase, Novagen) from pSG5-EBNA3A/3B/3C ( ) using reverse and forward primers containing the attB1 and attB2 recombination sites respectively, then cloned into pDONR207 (BP Clonase, Invitrogen).

    Techniques: Expressing, Infection, Recombinant, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Standard Deviation, FACS, Western Blot, Derivative Assay, Real-time Polymerase Chain Reaction

    Reprogramming constructs and morphology of marmoset monkey iPS cells. A) and B ) Constructs containing the reprogramming cassette. Expression of the reprogramming factors is driven by the CAG promoter (Pcag). Stop codons of the first five reprogramming factors were substituted with coding sequences for 2A peptides (F2A, T2A, E2A). IRES, internal ribosomal entry site; pA, poly A signal; 5ˈ-TR, 5ˈ-terminal repeat; 3ˈ-TR, 3ˈ-terminal repeat; S, SOX2 ; O, OCT4 ; K, KLF4 ; M, c-MYC ; L, LIN28 ; N, NANOG ; C, Cerulean; P, puromycin resistance gene. C) Expression of the Transposase (PBase) is driven by the Cytomegalovirus promoter (Pcmv). D) Morphology of iPS cell colonies. The morphology of the generated iPSCs (DPZcj_iPSC1) and the marmoset ES cell line cjes001 are indistinguishable from each other. Bars = 100 μm E) Karyotype analysis of DPZcj_iPSC1. Karyogram showing a normal Karyotype 46, XY (left). Right: PCR analysis confirming the male genotype. Primers used amplify a fragment of the Sex-determining region Y gene ( SRY ) and the X or Y chromosome-linked genes DDX3 ( DDX3-X , DDX3-Y ). The analysis was done with genomic DNA from a newborn female marmoset (♀), a newborn male marmoset (♂), an established female ES cell line (cjes001) and the generated iPS cell line DPZcj_iPSC1. Water was used as negative control (H 2 O).

    Journal: PLoS ONE

    Article Title: Non-Viral Generation of Marmoset Monkey iPS Cells by a Six-Factor-in-One-Vector Approach

    doi: 10.1371/journal.pone.0118424

    Figure Lengend Snippet: Reprogramming constructs and morphology of marmoset monkey iPS cells. A) and B ) Constructs containing the reprogramming cassette. Expression of the reprogramming factors is driven by the CAG promoter (Pcag). Stop codons of the first five reprogramming factors were substituted with coding sequences for 2A peptides (F2A, T2A, E2A). IRES, internal ribosomal entry site; pA, poly A signal; 5ˈ-TR, 5ˈ-terminal repeat; 3ˈ-TR, 3ˈ-terminal repeat; S, SOX2 ; O, OCT4 ; K, KLF4 ; M, c-MYC ; L, LIN28 ; N, NANOG ; C, Cerulean; P, puromycin resistance gene. C) Expression of the Transposase (PBase) is driven by the Cytomegalovirus promoter (Pcmv). D) Morphology of iPS cell colonies. The morphology of the generated iPSCs (DPZcj_iPSC1) and the marmoset ES cell line cjes001 are indistinguishable from each other. Bars = 100 μm E) Karyotype analysis of DPZcj_iPSC1. Karyogram showing a normal Karyotype 46, XY (left). Right: PCR analysis confirming the male genotype. Primers used amplify a fragment of the Sex-determining region Y gene ( SRY ) and the X or Y chromosome-linked genes DDX3 ( DDX3-X , DDX3-Y ). The analysis was done with genomic DNA from a newborn female marmoset (♀), a newborn male marmoset (♂), an established female ES cell line (cjes001) and the generated iPS cell line DPZcj_iPSC1. Water was used as negative control (H 2 O).

    Article Snippet: Cloning / Plasmid construction Open reading frames of the reprogramming factors were PCR-amplified (KOD Hot Start DNA Polymerase, Novagen) from P51 single strand cDNA of the common marmoset ESC line cjes001 [ ] and cloned into the plasmid vector pBluescriptIISK- (Stratagene).

    Techniques: Construct, Expressing, Generated, Polymerase Chain Reaction, Negative Control

    Testing of pluripotency. A ) Immunofluorescence stainings of EB outgrowths. Embryoid bodies from the iPS cell line DPZcj_iPSC1 and an established ES cell line (cjes001) were plated and outgrowths were analyzed for expression of markers of the three germ layers: β-Tubulin 3 (β-Tub III), α-fetoprotein (AFP) and smooth muscle actin (SMA). EB outgrowths show positive staining for all markers. Antibodies were successfully tested also on native tissue by conventional immunohistochemistry (data not shown). Bars = 100 μm. B) Immunohistochemical analysis of a teratoma. Tumor tissue was analyzed for expression of markers of the three germ layers: SOX9, β-Tubulin 3 (β-Tub III), and smooth muscle actin (SMA). The tumor shows positive staining for all markers and was classified as teratoma. Bars = 100 μm C) PCR analysis of genomic DNA from the teratoma and several mouse tissues for presence of the reprogramming cassette. Two tissue pieces were dissected out of the teratoma (Tumor 1+2). As positive control, the reprogramming construct pTT-PB-SOKMLN (Plasmid) was used as template. Different primer pairs specific for the reprogramming cassette were used. As control, a fragment of the murine Sox2 ORF (mm Sox2 ) was amplified. Injected cells seem to be present also at other sites than the injection site.

    Journal: PLoS ONE

    Article Title: Non-Viral Generation of Marmoset Monkey iPS Cells by a Six-Factor-in-One-Vector Approach

    doi: 10.1371/journal.pone.0118424

    Figure Lengend Snippet: Testing of pluripotency. A ) Immunofluorescence stainings of EB outgrowths. Embryoid bodies from the iPS cell line DPZcj_iPSC1 and an established ES cell line (cjes001) were plated and outgrowths were analyzed for expression of markers of the three germ layers: β-Tubulin 3 (β-Tub III), α-fetoprotein (AFP) and smooth muscle actin (SMA). EB outgrowths show positive staining for all markers. Antibodies were successfully tested also on native tissue by conventional immunohistochemistry (data not shown). Bars = 100 μm. B) Immunohistochemical analysis of a teratoma. Tumor tissue was analyzed for expression of markers of the three germ layers: SOX9, β-Tubulin 3 (β-Tub III), and smooth muscle actin (SMA). The tumor shows positive staining for all markers and was classified as teratoma. Bars = 100 μm C) PCR analysis of genomic DNA from the teratoma and several mouse tissues for presence of the reprogramming cassette. Two tissue pieces were dissected out of the teratoma (Tumor 1+2). As positive control, the reprogramming construct pTT-PB-SOKMLN (Plasmid) was used as template. Different primer pairs specific for the reprogramming cassette were used. As control, a fragment of the murine Sox2 ORF (mm Sox2 ) was amplified. Injected cells seem to be present also at other sites than the injection site.

    Article Snippet: Cloning / Plasmid construction Open reading frames of the reprogramming factors were PCR-amplified (KOD Hot Start DNA Polymerase, Novagen) from P51 single strand cDNA of the common marmoset ESC line cjes001 [ ] and cloned into the plasmid vector pBluescriptIISK- (Stratagene).

    Techniques: Immunofluorescence, Expressing, Staining, Immunohistochemistry, Polymerase Chain Reaction, Positive Control, Construct, Plasmid Preparation, Amplification, Injection

    Nup62 knockdown significantly inhibited HIV-1 infection by reducing viral DNA integration. A , C8166 cells were transduced with lentiviral vectors harboring Nup62 shRNA or empty vector and were subsequently analyzed for Nup62 expression by WB at different time points. γ-Actin was included as an internal control. B , inhibitory effect of Nup62-KD on HIV-1 replication in CD4 + C8166 T cells and macrophages. Nup62-KD and empty C8166 cells were infected with VSV-G pseudotyped luc-expressing HIV-1 (pNL-BruΔBgl/Luc) ( left panel ) or HIV-1 pNL 4.3-GFP ( right panel ). The Luc activity from cells or HIV Gag-p24 levels of supernatants was measured to monitor viral replication after 48 h. C , monocyte-derived macrophages from healthy donors were transduced with lentiviral vectors encoding Nup62-shRNA and Nup62-siRNA, as described under “Experimental Procedures.” At day 4 post-transduction, MDMs were infected with the pNL4.3-Bal virus strain. Viral replication was monitored by measuring the levels of the HIV-1 Gag-p24 antigen in supernatants at different time points after infection. D , Nup62-KD, importin α3-kDa ( Imp α 3-kDa ), and ScRNA-C8166 T cells were infected with HIV-1 pNL4.3 Env + /R − /Luc virus, and 20 h later, DNA was extracted from infected cells, and HIV-1 late reverse transcription products ( upper panel ), HIV-1 two-LTR circles ( middle panel ), and the integrated DNA levels ( lower panel ) were analyzed by RQ-PCR using corresponding primers, as described under “Experimental Procedures.” Means and standard errors are representative of the results for duplicate samples from a typical experiment and were confirmed in two other independent experiments.

    Journal: The Journal of Biological Chemistry

    Article Title: Contribution of Host Nucleoporin 62 in HIV-1 Integrase Chromatin Association and Viral DNA Integration

    doi: 10.1074/jbc.M111.317057

    Figure Lengend Snippet: Nup62 knockdown significantly inhibited HIV-1 infection by reducing viral DNA integration. A , C8166 cells were transduced with lentiviral vectors harboring Nup62 shRNA or empty vector and were subsequently analyzed for Nup62 expression by WB at different time points. γ-Actin was included as an internal control. B , inhibitory effect of Nup62-KD on HIV-1 replication in CD4 + C8166 T cells and macrophages. Nup62-KD and empty C8166 cells were infected with VSV-G pseudotyped luc-expressing HIV-1 (pNL-BruΔBgl/Luc) ( left panel ) or HIV-1 pNL 4.3-GFP ( right panel ). The Luc activity from cells or HIV Gag-p24 levels of supernatants was measured to monitor viral replication after 48 h. C , monocyte-derived macrophages from healthy donors were transduced with lentiviral vectors encoding Nup62-shRNA and Nup62-siRNA, as described under “Experimental Procedures.” At day 4 post-transduction, MDMs were infected with the pNL4.3-Bal virus strain. Viral replication was monitored by measuring the levels of the HIV-1 Gag-p24 antigen in supernatants at different time points after infection. D , Nup62-KD, importin α3-kDa ( Imp α 3-kDa ), and ScRNA-C8166 T cells were infected with HIV-1 pNL4.3 Env + /R − /Luc virus, and 20 h later, DNA was extracted from infected cells, and HIV-1 late reverse transcription products ( upper panel ), HIV-1 two-LTR circles ( middle panel ), and the integrated DNA levels ( lower panel ) were analyzed by RQ-PCR using corresponding primers, as described under “Experimental Procedures.” Means and standard errors are representative of the results for duplicate samples from a typical experiment and were confirmed in two other independent experiments.

    Article Snippet: To construct SVCMV-T7-Nup62(1–325) or T7-Nup62(328–522) plasmid, the cDNAs encoding Homo sapiens Nup62(1–325) and Nup62(328–522) were PCR-amplified with the corresponding primers from pCMV6-entry-Nup62-myc (OriGene Technologies) and cloned into the SVCMVin-T7 vector at the 3′ end of a T7 tag using BamHI/HindIII or BglII/HindIII restriction sites.

    Techniques: Infection, Transduction, shRNA, Plasmid Preparation, Expressing, Western Blot, Activity Assay, Derivative Assay, Polymerase Chain Reaction

    Dependence of expression on MYC, AKT and BCLXL for sustained growth of transformed T cells in vitro (A) Relative mRNA expression of MYC, AKT and BCLXL was quantified using real-time PCR on indicated days after removal of Dox. (B) Cellular viability, apoptosis, cell size, cell cycle status and cumulative number of cells were recorded for 7 days in the presence of absence of Dox.

    Journal: Oncotarget

    Article Title: Transformation of mouse T cells requires MYC and AKT activity in conjunction with inhibition of intrinsic apoptosis

    doi: 10.18632/oncotarget.25113

    Figure Lengend Snippet: Dependence of expression on MYC, AKT and BCLXL for sustained growth of transformed T cells in vitro (A) Relative mRNA expression of MYC, AKT and BCLXL was quantified using real-time PCR on indicated days after removal of Dox. (B) Cellular viability, apoptosis, cell size, cell cycle status and cumulative number of cells were recorded for 7 days in the presence of absence of Dox.

    Article Snippet: Myr-HA-AKT was PCR-amplified from 901 pLNCX-myr-HA-Akt1 (a gift from William Sellers (Addgene plasmid #9005), [ ]) using forward primer; ACTGT GAATTC ACCACCATGGGGTCTTCAAAATCTAAAC and reverse primer; TGCAT CTCGAG TCAGGCCGTGCCGCTGGCCG followed by ligation into the EcoRI/XhoI site of pMSCV-IRES-EGFPZeo.

    Techniques: Expressing, Transformation Assay, In Vitro, Real-time Polymerase Chain Reaction