pcr-amplified Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    The VeriFiler Direct PCR Amplification Kit is a multiplex assay designed to amplify 9 unique STR loci plus the sex determining marker amelogenin The kit s loci configuration is optimized
      Buy from Supplier


    86
    Roche polymerase chain reaction pcr amplified
    <t>PCR-Based</t> Signature-Tagged Mutagenesis (A) Schematic drawing of PCR-based STM. Pools of 72 uniquely tagged mutants were intranasally inoculated into SP-A +/+ and SP-A −/− mice; 16 h later, lungs were harvested, homogenized, and plated. Approximately 10,000 colonies were harvested from the plates for genomic DNA extraction. PCR-amplification of tags was performed on the genomic DNA to screen for the presence or absence of DNA tags of each of the 72 mutants. Mutants whose DNA tags were present in the input pool and in the SP-A −/− pool, but absent in the SP-A +/+ pool (see white arrows) were further screened for susceptibility to SP-A. (B) Agarose gel of PCR-based STM, identifying the pch mutant (left panel). Attenuation in the first SP-A +/+ mouse (right panel, m1) was confirmed in two additional SP-A +/+ mice (right panel, m2 and m3). (C) Genetic loci of P. aeruginosa, when mutated, conferred increased sensitivity to in vivo killing by SP-A. DNA regions flanking pUTmini-Tn 5 transposon insertions were cloned and sequenced. Similarity BLAST searches were performed against P. aeruginosa PA01 genomic sequence on NCBI and on http://www.pseudomonas.com . Black arrows indicate the approximate insertion site within the mutated ORFS. (D) TLC analyses indicate that the pch STM mutant is unable to synthesize pyochelin (see arrows). Wild-type PA01 grown in LB and the pch mutant grown in LB supplemented with 1 mM salicylate produced green color pyochelin (see arrows). In contrast, no observable pyochelin was produced by the pch and PA06331 strains. Pure pyochelin was used as control. (E) Restriction fragment length polymorphism analysis between parental wild-type PA01 and STM mutants confirmed that mutations in pch and <t>ptsP</t> were caused by a single insertion.
    Polymerase Chain Reaction Pcr Amplified, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Roche
    Average 86 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    85
    Millipore polymerase chain reaction pcr amplified
    Mechanims of inhibition by <t>EBNA3A</t> of the MIZ-1-dependent activation of the CDKN2B transcription. ( A ) EBNA3A-dependent downregulation of CDKN2B expression is independent of CtBP. The CDKN2p-Luc construct was transfected into HeLa cells, together with a CMV-renilla LUC plasmid as internal control and expression plasmids for EBNA3A or EBNA3A-CtBPmut and MIZ-1 as indicated in the Figure. Results are plotted relative to the co-transfected CMV-renilla-LUC plasmid. Error bars represent standard deviations from three replicate assays. Protein expression levels were controled by western blotting using an anti-EBNA3A or an anti-MIZ-1 antibody for one representative experiment (bottom panels). ( B ) EBNA3A-dependent downregulation of CDKN2B expression is independent of MYC. The LCL wt and LCL Δ3A were treated or not with the 10058-F4 MYC inhibitor. Quantification of CDKN2B mRNA levels was performed by real time <t>RT-PCR.</t> Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from three replicate assays based on two different cDNAs. ( C ) EBNA3A inhibits MIZ-1 interaction with its coactivator Nucleophosmin. MIZ-1 was immunoprecipitated from eithe the LCL wt or the LCL Δ3A with an anti-MIZ-1 specific polyclonal antibody or with an unrelated antibody. Immunoprecipitated MIZ-1 and co-immunoprecipitated Nucleophosmin (NPM) proteins were analyzed by western blotting. Inputs correspond to 5% of the cell extract used for immunoprecipitation.
    Polymerase Chain Reaction Pcr Amplified, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Millipore
    Average 85 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    99
    Illumina Inc polymerase chain reaction pcr amplified
    Error rate of various reverse transcriptases including <t>MarathonRT,</t> SSIV, and TGIRT. ( A ) Single-molecule sequencing method. The schematic diagram of primers used for RT and second-strand synthesis is shown on the top . The principle underlying single-molecule sequencing is shown on the bottom . Only errors that are consistent in all sequencing reads that share the same product barcode are considered as RT errors (red stars). Errors that are inconsistent among reads sharing the same product barcode (green stars) will have originated from the <t>PCR</t> amplification or sequencing platform. ( B ) Error rate determination for different reverse transcriptases. The table summarizing the sequencing data is shown at left . In this table, nucleotides/product (row 4) is the number of nucleotides in each RT product that are used for final analysis, after the low quality bases at the ends were trimmed. Total nucleotides (row 5) is the total number of nucleotides involved in the analysis. The total number of reads (row 2) is the raw number of sequencing reads in either forward (R1) or reverse (R2) direction for each polymerase. The unique product (row 3) is a set of sequencing reads that share the same UMI (unique molecular identifier), and only unique products that have no less than three reads were included in the analysis (row 4). Nucleotide/product (row 5) shows the number of nucleotides that are incorporated by each polymerase after trimming the primer region and low-quality nucleotides at the end. Total nucleotides (row 6) is calculated by multiplying nucleotide/product (row 5) with the number of unique products (row 4), which is the total number of nucleotides analyzed. Substitution frequency (row 7) was calculated by dividing the number of total nucleotides (row 6) by the number of mutated nucleotides. Indel (insertion–deletion) frequency (row 8) was calculated by dividing the number of unique products by the number of indel events. N.A. suggests that current sequencing depth is not able to detect indels (insertion–deletion). The bar plot showing the substitutional frequency for MarathonRT, SSIV, and TGIRT is shown on the right .
    Polymerase Chain Reaction Pcr Amplified, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Illumina Inc
    Average 99 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    85
    Stratagene polymerase chain reaction pcr amplified
    Consensus sequence of env genes. The sequencing strategy used (see Materials and Methods) allowed detection of only relevant mutations. The different origins of sequenced genes and the panel of primers used gave the sequences twice on both strands. (A) Schematic map of relevant mutations observed after consensus sequencing performed directly on <t>PCR-amplified</t> env genes from infected-cell populations of different origins. Env Ori , sequences obtained from nonderived CEM <t>NDK</t> ); Env mNDK sequences obtained from different derived cell populations: CEM mNDK , H9 H , H9 S , HeLa mNDK , and SW480 mNDK . (B) Schematic map of relevant mutations observed after consensus sequencing performed on cloned env genes from different origins ligated in the expression vector. Their ability to direct cell fusion when expressed in HeLa cells has previously been tested. Env NDK and Env NDKsb , clonotypic sequences from the env gene from the nonderived CEM NDK cell population; Env CEM15 , clonotypic sequence of the cellular clone 15 presenting a strict CD4-dependent entry phenotype; Env CEM29,27 and Env HeLa2,14,48 clonotypic sequences of cellular clones presenting a CD4-independent entry phenotype. wt, wild type.
    Polymerase Chain Reaction Pcr Amplified, supplied by Stratagene, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/Stratagene
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    86
    TaKaRa polymerase chain reaction pcr amplified
    The <t>UL7-MU</t> viral strain exhibits attenuated phenotypes in a latent mouse infection model compared with the WT strain. a BALB/c mice were infected with WT HSV-1, UL7-MU or PBS via the foot pad at a dose of 5x10 3 /10 μl per mouse. The viral load was detected in the CNS of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles) by absolute real-time <t>RT-PCR.</t> Viral copy numbers were quantified according to the HSV-1 DNA standard pGM-T UL30 plasmid. b The levels of LAT expression in the CNS of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles), as determined by relative real-time RT-PCR. The graphic indicates the fold change of RNA levels in virus-infected mice compared to PBS-injected mice. The mouse housekeeping gene GAPDH was used to normalize quantities in mouse tissue. Relative quantification was performed by the comparative Ct method (△△Ct) using RNA from PBS mice as a calibrator. c Viral load detection in the spinal cord of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). d The levels of LAT expression in the spinal cord of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). e Viral load detection in the trigeminal nerve of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). f The levels of LAT expression in the trigeminal nerves of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). Data are shown as the means ± SD (experiments done once in triplicate). ∗∗∗ P
    Polymerase Chain Reaction Pcr Amplified, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified/product/TaKaRa
    Average 86 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    97
    Bio-Rad pcr amplified
    BIRM induced decrease in AR is due to increased proteasomal degradation of AR ( A ) Total <t>RNA</t> was purified from LAPC-4 treated with 10 μl/ml BIRM with or without 1 nM DHT for 48 h and semi-quantitative <t>RT-PCR</t> (i) was performed. GAPDH was amplified as an internal control. (ii) Quantitative real time PCR was performed on LAPC-4 cells treated with BIRM with 1nM DHT, the graph shows a relative AR mRNA expression normalized against a β-actin mRNA. ( B ) LAPC-4 and LNCaP cells incubated with or without BIRM (20 μl/ml) for 48 h, were pretreated with 10 μM LY294002 (PI-3Kinase inhibitor) for 1 h, or co-treatment with MG132 (proteasome inhibitor) for 4 h at the end of treatment. Decrease AR levels were monitored by Immunoblotting. ( C ) LAPC-4 cells were treated with indicated doses of BIRM for 48 h with or without MG132 treatment as described above. Immunoprecipitation was performed using anti-AR antibody and Western blotting was performed with anti-Ubiquitin antibody. Emodin treatment was performed for positive control of AR ubiquitination. ( D ) LAPC-4 cells were treated with various doses of BIRM for 48 h or 5 μg ml geldanamycin (GA) for 18 h and harvested. Cell lysate was used for Immunoprecipitation with a-Hsp90 antibody, separated by SDS-PAGE and probed with a-AR or a-acetyl lysine antibody. GA treated samples was used as a positive control of decrease interaction between AR and Hsp90. Due to high background in control band (0 μl/ml BIRM) in lane1, accurate densitometry of band intensity was difficult. However, there was > 50% decrease in the Hsp90-bound AR at 5 μl/ml BIRM. BIRM induced strong acetylation of Hsp90 at 5μl/ml. The disintegrated band at higher BIRM exposure might be associated with cells undergoing apoptosis. GA: Geldanamycin treated cell lysates, IgG: normal mouse IgG as negative control in IP.
    Pcr Amplified, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 506 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Bio-Rad
    Average 97 stars, based on 506 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcr amplified
    Rs688 is associated with <t>LDLR</t> splicing efficiency in the male human brain in vivo This figure depicts representative splicing patterns corresponding to the indicated <t>PCR</t> products as well as quantitation of exon 12 splicing efficiency in the brains of separate males (A) and females (B). Rs688 was associated significantly with splicing in males (p=0.041) but not females (p=0.43) as determined by Jonckheere-Terpstra ranked sum tests.
    Pcr Amplified, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 12322 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Thermo Fisher
    Average 99 stars, based on 12322 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    97
    Addgene inc pcr amplified
    Dependence of expression on MYC, <t>AKT</t> and BCLXL for sustained growth of transformed T cells in vitro (A) Relative mRNA expression of MYC, AKT and BCLXL was quantified using real-time <t>PCR</t> on indicated days after removal of Dox. (B) Cellular viability, apoptosis, cell size, cell cycle status and cumulative number of cells were recorded for 7 days in the presence of absence of Dox.
    Pcr Amplified, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1386 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Addgene inc
    Average 97 stars, based on 1386 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    97
    OriGene pcr amplified
    <t>Nup62</t> knockdown significantly inhibited HIV-1 infection by reducing viral DNA integration. A , C8166 cells were transduced with lentiviral vectors harboring Nup62 shRNA or empty vector and were subsequently analyzed for Nup62 expression by WB at different time points. γ-Actin was included as an internal control. B , inhibitory effect of Nup62-KD on HIV-1 replication in CD4 + C8166 T cells and macrophages. Nup62-KD and empty C8166 cells were infected with VSV-G pseudotyped luc-expressing HIV-1 (pNL-BruΔBgl/Luc) ( left panel ) or HIV-1 pNL 4.3-GFP ( right panel ). The Luc activity from cells or HIV Gag-p24 levels of supernatants was measured to monitor viral replication after 48 h. C , monocyte-derived macrophages from healthy donors were transduced with lentiviral vectors encoding Nup62-shRNA and Nup62-siRNA, as described under “Experimental Procedures.” At day 4 post-transduction, MDMs were infected with the pNL4.3-Bal virus strain. Viral replication was monitored by measuring the levels of the HIV-1 Gag-p24 antigen in supernatants at different time points after infection. D , Nup62-KD, importin α3-kDa ( Imp α 3-kDa ), and ScRNA-C8166 T cells were infected with HIV-1 pNL4.3 Env + /R − /Luc virus, and 20 h later, DNA was extracted from infected cells, and HIV-1 late reverse transcription products ( upper panel ), HIV-1 two-LTR circles ( middle panel ), and the integrated DNA levels ( lower panel ) were analyzed by <t>RQ-PCR</t> using corresponding primers, as described under “Experimental Procedures.” Means and standard errors are representative of the results for duplicate samples from a typical experiment and were confirmed in two other independent experiments.
    Pcr Amplified, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 198 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/OriGene
    Average 97 stars, based on 198 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    75
    GenScript pcr amplified bclaf1
    <t>Nup62</t> knockdown significantly inhibited HIV-1 infection by reducing viral DNA integration. A , C8166 cells were transduced with lentiviral vectors harboring Nup62 shRNA or empty vector and were subsequently analyzed for Nup62 expression by WB at different time points. γ-Actin was included as an internal control. B , inhibitory effect of Nup62-KD on HIV-1 replication in CD4 + C8166 T cells and macrophages. Nup62-KD and empty C8166 cells were infected with VSV-G pseudotyped luc-expressing HIV-1 (pNL-BruΔBgl/Luc) ( left panel ) or HIV-1 pNL 4.3-GFP ( right panel ). The Luc activity from cells or HIV Gag-p24 levels of supernatants was measured to monitor viral replication after 48 h. C , monocyte-derived macrophages from healthy donors were transduced with lentiviral vectors encoding Nup62-shRNA and Nup62-siRNA, as described under “Experimental Procedures.” At day 4 post-transduction, MDMs were infected with the pNL4.3-Bal virus strain. Viral replication was monitored by measuring the levels of the HIV-1 Gag-p24 antigen in supernatants at different time points after infection. D , Nup62-KD, importin α3-kDa ( Imp α 3-kDa ), and ScRNA-C8166 T cells were infected with HIV-1 pNL4.3 Env + /R − /Luc virus, and 20 h later, DNA was extracted from infected cells, and HIV-1 late reverse transcription products ( upper panel ), HIV-1 two-LTR circles ( middle panel ), and the integrated DNA levels ( lower panel ) were analyzed by <t>RQ-PCR</t> using corresponding primers, as described under “Experimental Procedures.” Means and standard errors are representative of the results for duplicate samples from a typical experiment and were confirmed in two other independent experiments.
    Pcr Amplified Bclaf1, supplied by GenScript, used in various techniques. Bioz Stars score: 75/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified bclaf1/product/GenScript
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplified bclaf1 - by Bioz Stars, 2020-02
    75/100 stars
      Buy from Supplier

    78
    Genewiz pcr amplified loci
    Screening of HTLV-1 <t>LTR-luc</t> stable integrants. (A) Luciferase activity in stably integrated HTLV-1 LTR Jurkat clones was measured in terms of relative light units. Control represents the luciferase activity from the cells that were stably integrated with pGL3-basic vector and pRSV-neo. Each value shown represents the average of duplicate transfection reactions and is representative of at least two independent experiments. Error bars indicate standard deviation (±) from one representative experiment. (B) For verifying HTLV-1 LTR-luc integration, all five clones (C1–C5) were examined and confirmed qualitatively for HTLV-1 LTR-luc integration for both LTR and luciferase genes independently by <t>PCR</t> amplification of LTR with product size 183 bp and Southern blot hybridization using luciferase probe following PCR amplification of luciferase gene with product size 1.6 kb. The control clone represents the Jurkat clone stably integrated with pGL3-basic vector and pRSV-neo in the absence of the HTLV-1 LTR. The positive control in each case is the pU3R-luc plasmid. (D) For quantifying HTLV-1 provirus copy numbers by real-time PCR in the stably integrated clones, all five clones (C1–C5) were selected for real-time PCR analysis to determine the copy number of copies of the integrated LTR per 100 cells. Standard curves for β-actin and the HTLV-1 LTR were generated from Jurkat and TARL-2 cell lines, respectively, with the coefficient of correlation, r 2 , being greater than 0.996 for both.
    Pcr Amplified Loci, supplied by Genewiz, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified loci/product/Genewiz
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    pcr amplified loci - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    80
    Thermo Fisher pcr amplified sox11
    Screening of HTLV-1 <t>LTR-luc</t> stable integrants. (A) Luciferase activity in stably integrated HTLV-1 LTR Jurkat clones was measured in terms of relative light units. Control represents the luciferase activity from the cells that were stably integrated with pGL3-basic vector and pRSV-neo. Each value shown represents the average of duplicate transfection reactions and is representative of at least two independent experiments. Error bars indicate standard deviation (±) from one representative experiment. (B) For verifying HTLV-1 LTR-luc integration, all five clones (C1–C5) were examined and confirmed qualitatively for HTLV-1 LTR-luc integration for both LTR and luciferase genes independently by <t>PCR</t> amplification of LTR with product size 183 bp and Southern blot hybridization using luciferase probe following PCR amplification of luciferase gene with product size 1.6 kb. The control clone represents the Jurkat clone stably integrated with pGL3-basic vector and pRSV-neo in the absence of the HTLV-1 LTR. The positive control in each case is the pU3R-luc plasmid. (D) For quantifying HTLV-1 provirus copy numbers by real-time PCR in the stably integrated clones, all five clones (C1–C5) were selected for real-time PCR analysis to determine the copy number of copies of the integrated LTR per 100 cells. Standard curves for β-actin and the HTLV-1 LTR were generated from Jurkat and TARL-2 cell lines, respectively, with the coefficient of correlation, r 2 , being greater than 0.996 for both.
    Pcr Amplified Sox11, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified sox11/product/Thermo Fisher
    Average 80 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    pcr amplified sox11 - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    86
    Addgene inc pcr amplified mrfp
    Screening of HTLV-1 <t>LTR-luc</t> stable integrants. (A) Luciferase activity in stably integrated HTLV-1 LTR Jurkat clones was measured in terms of relative light units. Control represents the luciferase activity from the cells that were stably integrated with pGL3-basic vector and pRSV-neo. Each value shown represents the average of duplicate transfection reactions and is representative of at least two independent experiments. Error bars indicate standard deviation (±) from one representative experiment. (B) For verifying HTLV-1 LTR-luc integration, all five clones (C1–C5) were examined and confirmed qualitatively for HTLV-1 LTR-luc integration for both LTR and luciferase genes independently by <t>PCR</t> amplification of LTR with product size 183 bp and Southern blot hybridization using luciferase probe following PCR amplification of luciferase gene with product size 1.6 kb. The control clone represents the Jurkat clone stably integrated with pGL3-basic vector and pRSV-neo in the absence of the HTLV-1 LTR. The positive control in each case is the pU3R-luc plasmid. (D) For quantifying HTLV-1 provirus copy numbers by real-time PCR in the stably integrated clones, all five clones (C1–C5) were selected for real-time PCR analysis to determine the copy number of copies of the integrated LTR per 100 cells. Standard curves for β-actin and the HTLV-1 LTR were generated from Jurkat and TARL-2 cell lines, respectively, with the coefficient of correlation, r 2 , being greater than 0.996 for both.
    Pcr Amplified Mrfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified mrfp/product/Addgene inc
    Average 86 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    pcr amplified mrfp - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    75
    TaKaRa polymerase chain reaction pcr amplified dna fragments
    Screening of HTLV-1 <t>LTR-luc</t> stable integrants. (A) Luciferase activity in stably integrated HTLV-1 LTR Jurkat clones was measured in terms of relative light units. Control represents the luciferase activity from the cells that were stably integrated with pGL3-basic vector and pRSV-neo. Each value shown represents the average of duplicate transfection reactions and is representative of at least two independent experiments. Error bars indicate standard deviation (±) from one representative experiment. (B) For verifying HTLV-1 LTR-luc integration, all five clones (C1–C5) were examined and confirmed qualitatively for HTLV-1 LTR-luc integration for both LTR and luciferase genes independently by <t>PCR</t> amplification of LTR with product size 183 bp and Southern blot hybridization using luciferase probe following PCR amplification of luciferase gene with product size 1.6 kb. The control clone represents the Jurkat clone stably integrated with pGL3-basic vector and pRSV-neo in the absence of the HTLV-1 LTR. The positive control in each case is the pU3R-luc plasmid. (D) For quantifying HTLV-1 provirus copy numbers by real-time PCR in the stably integrated clones, all five clones (C1–C5) were selected for real-time PCR analysis to determine the copy number of copies of the integrated LTR per 100 cells. Standard curves for β-actin and the HTLV-1 LTR were generated from Jurkat and TARL-2 cell lines, respectively, with the coefficient of correlation, r 2 , being greater than 0.996 for both.
    Polymerase Chain Reaction Pcr Amplified Dna Fragments, supplied by TaKaRa, used in various techniques. Bioz Stars score: 75/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplified dna fragments/product/TaKaRa
    Average 75 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplified dna fragments - by Bioz Stars, 2020-02
    75/100 stars
      Buy from Supplier

    76
    GeneDx Inc polymerase chain reaction amplified fragments
    Screening of HTLV-1 <t>LTR-luc</t> stable integrants. (A) Luciferase activity in stably integrated HTLV-1 LTR Jurkat clones was measured in terms of relative light units. Control represents the luciferase activity from the cells that were stably integrated with pGL3-basic vector and pRSV-neo. Each value shown represents the average of duplicate transfection reactions and is representative of at least two independent experiments. Error bars indicate standard deviation (±) from one representative experiment. (B) For verifying HTLV-1 LTR-luc integration, all five clones (C1–C5) were examined and confirmed qualitatively for HTLV-1 LTR-luc integration for both LTR and luciferase genes independently by <t>PCR</t> amplification of LTR with product size 183 bp and Southern blot hybridization using luciferase probe following PCR amplification of luciferase gene with product size 1.6 kb. The control clone represents the Jurkat clone stably integrated with pGL3-basic vector and pRSV-neo in the absence of the HTLV-1 LTR. The positive control in each case is the pU3R-luc plasmid. (D) For quantifying HTLV-1 provirus copy numbers by real-time PCR in the stably integrated clones, all five clones (C1–C5) were selected for real-time PCR analysis to determine the copy number of copies of the integrated LTR per 100 cells. Standard curves for β-actin and the HTLV-1 LTR were generated from Jurkat and TARL-2 cell lines, respectively, with the coefficient of correlation, r 2 , being greater than 0.996 for both.
    Polymerase Chain Reaction Amplified Fragments, supplied by GeneDx Inc, used in various techniques. Bioz Stars score: 76/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction amplified fragments/product/GeneDx Inc
    Average 76 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction amplified fragments - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    79
    Merck KGaA pcr amplified usingkod polymerase
    Screening of HTLV-1 <t>LTR-luc</t> stable integrants. (A) Luciferase activity in stably integrated HTLV-1 LTR Jurkat clones was measured in terms of relative light units. Control represents the luciferase activity from the cells that were stably integrated with pGL3-basic vector and pRSV-neo. Each value shown represents the average of duplicate transfection reactions and is representative of at least two independent experiments. Error bars indicate standard deviation (±) from one representative experiment. (B) For verifying HTLV-1 LTR-luc integration, all five clones (C1–C5) were examined and confirmed qualitatively for HTLV-1 LTR-luc integration for both LTR and luciferase genes independently by <t>PCR</t> amplification of LTR with product size 183 bp and Southern blot hybridization using luciferase probe following PCR amplification of luciferase gene with product size 1.6 kb. The control clone represents the Jurkat clone stably integrated with pGL3-basic vector and pRSV-neo in the absence of the HTLV-1 LTR. The positive control in each case is the pU3R-luc plasmid. (D) For quantifying HTLV-1 provirus copy numbers by real-time PCR in the stably integrated clones, all five clones (C1–C5) were selected for real-time PCR analysis to determine the copy number of copies of the integrated LTR per 100 cells. Standard curves for β-actin and the HTLV-1 LTR were generated from Jurkat and TARL-2 cell lines, respectively, with the coefficient of correlation, r 2 , being greater than 0.996 for both.
    Pcr Amplified Usingkod Polymerase, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 79/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified usingkod polymerase/product/Merck KGaA
    Average 79 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    pcr amplified usingkod polymerase - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    79
    Thermo Fisher pcr amplified promoter fragments
    Screening of HTLV-1 <t>LTR-luc</t> stable integrants. (A) Luciferase activity in stably integrated HTLV-1 LTR Jurkat clones was measured in terms of relative light units. Control represents the luciferase activity from the cells that were stably integrated with pGL3-basic vector and pRSV-neo. Each value shown represents the average of duplicate transfection reactions and is representative of at least two independent experiments. Error bars indicate standard deviation (±) from one representative experiment. (B) For verifying HTLV-1 LTR-luc integration, all five clones (C1–C5) were examined and confirmed qualitatively for HTLV-1 LTR-luc integration for both LTR and luciferase genes independently by <t>PCR</t> amplification of LTR with product size 183 bp and Southern blot hybridization using luciferase probe following PCR amplification of luciferase gene with product size 1.6 kb. The control clone represents the Jurkat clone stably integrated with pGL3-basic vector and pRSV-neo in the absence of the HTLV-1 LTR. The positive control in each case is the pU3R-luc plasmid. (D) For quantifying HTLV-1 provirus copy numbers by real-time PCR in the stably integrated clones, all five clones (C1–C5) were selected for real-time PCR analysis to determine the copy number of copies of the integrated LTR per 100 cells. Standard curves for β-actin and the HTLV-1 LTR were generated from Jurkat and TARL-2 cell lines, respectively, with the coefficient of correlation, r 2 , being greater than 0.996 for both.
    Pcr Amplified Promoter Fragments, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified promoter fragments/product/Thermo Fisher
    Average 79 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    pcr amplified promoter fragments - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    87
    ATUM pcr amplified dna
    <t>PCR-RFLP</t> patterns for H. pullorum and H. canadensis of 1.2-kb 16S rRNA Helicobacter -specific PCR products. (A) Alu I digestion; (B) Hha I digestion; (C) Apa LI digestion. The 1.2-kb PCR product of the Helicobacter 16S rRNA gene was digested for 3 h with selected endonucleases and then separated by electrophoresis on a 6% Visigel matrix. Lane M, 100-bp <t>DNA</t> ladder; lane 1, H. pullorum NCTC 12824; lane 2, H. pullorum NCTC 12827; lane 3, H. pullorum human isolate MIT 98-5493; lane 4, H. pullorum human isolate MIT 98-5494; lanes 5 to 8, H. canadensis isolates NLEP-16143, NLEP-16767, NLEP-17813, and NLEP-99-3017.
    Pcr Amplified Dna, supplied by ATUM, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified dna/product/ATUM
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr amplified dna - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    95
    Bio-Rad pcr amplified dna
    <t>PCR-RFLP</t> patterns for H. pullorum and H. canadensis of 1.2-kb 16S rRNA Helicobacter -specific PCR products. (A) Alu I digestion; (B) Hha I digestion; (C) Apa LI digestion. The 1.2-kb PCR product of the Helicobacter 16S rRNA gene was digested for 3 h with selected endonucleases and then separated by electrophoresis on a 6% Visigel matrix. Lane M, 100-bp <t>DNA</t> ladder; lane 1, H. pullorum NCTC 12824; lane 2, H. pullorum NCTC 12827; lane 3, H. pullorum human isolate MIT 98-5493; lane 4, H. pullorum human isolate MIT 98-5494; lanes 5 to 8, H. canadensis isolates NLEP-16143, NLEP-16767, NLEP-17813, and NLEP-99-3017.
    Pcr Amplified Dna, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 95/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified dna/product/Bio-Rad
    Average 95 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    pcr amplified dna - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    97
    Agilent technologies pcr amplified
    Meiotic splicing in tgs1 Δ cells. RNAs isolated from wild-type and tgs1Δ diploid strains sampled immediately prior to transfer to sporulation medium (lane 3) or 4 h (lane 4) and 8 h (lane 5) post-transfer to sporulation medium were reverse transcribed and the <t>cDNAs</t> were <t>PCR-amplified</t> with gene-specific primers flanking the introns of meiotic transcripts SPO22, PCH2 and SAE3 and the constitutively spliced GLC7 transcript. The antisense PCR primers were 5′ 32 P-labeled in each case. The labeled PCR products were resolved by native agarose gel electrophoresis. The RNA samples in lanes 1 were PCR-amplified without reverse transcription, as a control for potential genomic DNA contamination. Lane 2 includes aliquots of the products of PCR-amplification of genomic DNA, which are the same size as the RT–PCR products derived from the intron-containing RNAs. The RT–PCR products from wild-type ( 16 ) and tgs1 Δ diploids were analyzed on the same gel and visualized by autoradiography. The positions of the RT–PCR products of unspliced and spliced transcripts are indicated at ‘right’.
    Pcr Amplified, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 97/100, based on 722 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Agilent technologies
    Average 97 stars, based on 722 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    97
    Beckman Coulter pcr amplified
    Meiotic splicing in tgs1 Δ cells. RNAs isolated from wild-type and tgs1Δ diploid strains sampled immediately prior to transfer to sporulation medium (lane 3) or 4 h (lane 4) and 8 h (lane 5) post-transfer to sporulation medium were reverse transcribed and the <t>cDNAs</t> were <t>PCR-amplified</t> with gene-specific primers flanking the introns of meiotic transcripts SPO22, PCH2 and SAE3 and the constitutively spliced GLC7 transcript. The antisense PCR primers were 5′ 32 P-labeled in each case. The labeled PCR products were resolved by native agarose gel electrophoresis. The RNA samples in lanes 1 were PCR-amplified without reverse transcription, as a control for potential genomic DNA contamination. Lane 2 includes aliquots of the products of PCR-amplification of genomic DNA, which are the same size as the RT–PCR products derived from the intron-containing RNAs. The RT–PCR products from wild-type ( 16 ) and tgs1 Δ diploids were analyzed on the same gel and visualized by autoradiography. The positions of the RT–PCR products of unspliced and spliced transcripts are indicated at ‘right’.
    Pcr Amplified, supplied by Beckman Coulter, used in various techniques. Bioz Stars score: 97/100, based on 162 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Beckman Coulter
    Average 97 stars, based on 162 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    89
    Eton Bioscience pcr amplified
    Meiotic splicing in tgs1 Δ cells. RNAs isolated from wild-type and tgs1Δ diploid strains sampled immediately prior to transfer to sporulation medium (lane 3) or 4 h (lane 4) and 8 h (lane 5) post-transfer to sporulation medium were reverse transcribed and the <t>cDNAs</t> were <t>PCR-amplified</t> with gene-specific primers flanking the introns of meiotic transcripts SPO22, PCH2 and SAE3 and the constitutively spliced GLC7 transcript. The antisense PCR primers were 5′ 32 P-labeled in each case. The labeled PCR products were resolved by native agarose gel electrophoresis. The RNA samples in lanes 1 were PCR-amplified without reverse transcription, as a control for potential genomic DNA contamination. Lane 2 includes aliquots of the products of PCR-amplification of genomic DNA, which are the same size as the RT–PCR products derived from the intron-containing RNAs. The RT–PCR products from wild-type ( 16 ) and tgs1 Δ diploids were analyzed on the same gel and visualized by autoradiography. The positions of the RT–PCR products of unspliced and spliced transcripts are indicated at ‘right’.
    Pcr Amplified, supplied by Eton Bioscience, used in various techniques. Bioz Stars score: 89/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Eton Bioscience
    Average 89 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    97
    Eurofins pcr amplified
    Meiotic splicing in tgs1 Δ cells. RNAs isolated from wild-type and tgs1Δ diploid strains sampled immediately prior to transfer to sporulation medium (lane 3) or 4 h (lane 4) and 8 h (lane 5) post-transfer to sporulation medium were reverse transcribed and the <t>cDNAs</t> were <t>PCR-amplified</t> with gene-specific primers flanking the introns of meiotic transcripts SPO22, PCH2 and SAE3 and the constitutively spliced GLC7 transcript. The antisense PCR primers were 5′ 32 P-labeled in each case. The labeled PCR products were resolved by native agarose gel electrophoresis. The RNA samples in lanes 1 were PCR-amplified without reverse transcription, as a control for potential genomic DNA contamination. Lane 2 includes aliquots of the products of PCR-amplification of genomic DNA, which are the same size as the RT–PCR products derived from the intron-containing RNAs. The RT–PCR products from wild-type ( 16 ) and tgs1 Δ diploids were analyzed on the same gel and visualized by autoradiography. The positions of the RT–PCR products of unspliced and spliced transcripts are indicated at ‘right’.
    Pcr Amplified, supplied by Eurofins, used in various techniques. Bioz Stars score: 97/100, based on 76 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Eurofins
    Average 97 stars, based on 76 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    97
    Evrogen pcr amplified
    A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed <t>PCR</t> (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.
    Pcr Amplified, supplied by Evrogen, used in various techniques. Bioz Stars score: 97/100, based on 113 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Evrogen
    Average 97 stars, based on 113 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    97
    GE Healthcare pcr amplified
    <t>MARCH1</t> expression is increased in WAT from obese humans and mice and regulates insulin signalling in target tissues. ( a ) <t>qRT-PCR</t> measurement of March1 expression in WAT of adult male C57BL/6 J mice fed either regular chow or high-fat diet. ( b ) qRT-PCR measurement of MARCH1 expression in WAT from lean ( n =8) and obese ( n =13) human adolescent subjects. ( c ) Immunoblot analysis of AKT Ser 473 phosphorylation in differentiated 3T3-L1 adipocytes expressing indicated shRNAs. ( d ) Relative 14 C-2-deoxyglucose uptake ( n =4) in differentiated 3T3-L1 adipocytes expressing either NS or March1 shRNA. ( e ) Relative glycogen synthesis ( n =3) in differentiated 3T3-L1 adipocytes expressing either NS or March1 shRNA. ( f ) Immunoblot analysis of AKT Ser 473 phosphorylation in HepG2 hepatocytes expressing either NS or MARCH1 shRNA. ( g ) Relative glycogen synthesis ( n =3) in HepG2 hepatocytes expressing either NS or MARCH1 shRNA. In d , e , g , *compares NS and MARCH1 shRNAs in presence of insulin. In all panels, data are mean±s.e.m. and * P
    Pcr Amplified, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 97/100, based on 1188 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/GE Healthcare
    Average 97 stars, based on 1188 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    97
    GenScript pcr amplified
    (A) Effect of <t>ORFV119</t> on NF-κB mediated gene expression. OFTu cells were infected with OV-IA82, OV-IA82-Δ119, or OV-IA82-RV119 Flag (MOI, 10), and levels of TNFα, TLR2, NF-κB1 and IL36α mRNA assessed by real-time <t>PCR</t> at 2 h p.i. Fold changes are relative to OV-IA82 treatment. Results are the mean values of three independent experiments. (*, P
    Pcr Amplified, supplied by GenScript, used in various techniques. Bioz Stars score: 97/100, based on 111 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/GenScript
    Average 97 stars, based on 111 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    97
    Macrogen pcr amplified
    BDNF makes cap-independent translation of <t>DSCR1.4</t> mRNA more actively by increasing DAP5 expression. a , b BDNF treatment on DIV 3 hippocampal neuron increases protein levels of DAP5 and DSCR1.4 but not DSCR1.4 mRNA level. Vehicle (DDW) or 30 μM BDNF were treated for 1 h. a The protein levels were confirmed by Western blot. GAPDH and phosphorylation of ERK were used as a loading control and marker of BDNF activity, respectively. b Endogenous DSCR1.4 mRNA levels were analyzed by <t>qRT-PCR</t> and were normalized to β-actin. The bars represent the mean ± SEM ( n = 3). c Cap-independent translation is essential for DSCR1.4 protein accumulation by BDNF. DIV 3 hippocampal neurons were treated with vehicle (DMSO), 100 μM RAD001(RAD) or 50 mg/ml cycloheximide (CHX) for 3 h followed by BDNF treatment for 1 h. The levels of each protein were confirmed by Western blot. The numbers at the bottom indicate the fold relative to a vehicle. The amount of DSCR1.4 was normalized to GAPDH. d , e BDNF raises cap-independent translation activity of DSCR1.4 mRNA. At 24 h after d pRF hDSCR1.4 5′UTR or e pRF mDSCR1.4 5′UTR vectors were transfected into DIV 2 hippocampal neurons, Vehicle (DDW) and BDNF were treated to the neurons for 1 h. The bars represent the mean ± SEM ( e ; n = 5, F; n = 3). f BDNF increases the interaction between DAP5 and DSCR1.4 5′UTR. In vitro transcribed biotin-DSCR1.4 5′UTR was incubated with extracts of the vehicle (DDW) or 30 μM BDNF-treated DIV 3 mouse hippocampal neurons. DAP5 binding was measured by Western blot. Phospho-ERK was used to confirm the activity of BDNF. GADPH was used as a loading control and negative control. g , h BDNF increases the cap-independent local translation of DSCR1.4 mRNA in axon as well as soma. EGFP and pRF mDSCR1.4 5′ 3′ UTR vectors were co-transfected into DIV 2 mouse hippocampal neurons. At 24 h later, 100 μM anisomycin was treated for 3 h and then 30 μM BDNF was treated for 1 h, followed by 5 μM puromycin treatment for 40 min. To detect newly synthesized FLUC proteins, Puro-PLA assay was conducted. g Representative image obtained from confocal microscopy. h The graph shows relative fluorescence intensity measured by Image J. The bars represent the mean ± SEM (Vehicle; n = 11, Anisomycin; n = 12, BDNF; n = 11, BDNF + Anisomycin; n = 11). Scale bar, 30 μm. Data information: In d , e , h , * P
    Pcr Amplified, supplied by Macrogen, used in various techniques. Bioz Stars score: 97/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Macrogen
    Average 97 stars, based on 124 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    98
    Promega pcr amplified
    Nova2 (neuro-oncological ventral antigen 2) affects the splicing of Ppar-γ (peroxisome proliferator-activated receptor-gamma) and expression of its target genes in ECs (endothelial cells). ( A ) Several Ppar-γ mRNAs are generated by alternative transcription start sites and alternative splicing (AS) of different exons in the 5′ terminal region (for simplicity, only the first exons A1, A2, and B were schematized). Ppar-γ1 mRNA contains exons A1 and A2, spliced together with exons 1–6, whereas, in Ppar-γ2 , exon B is present instead of exon A1 and A2. The upstream ATG in exon B determinates the inclusion of 28 (mouse) or 30 (human) amino acids at the N-terminal of Ppar-γ2 protein. Boxes = exons; thin lines = introns. A/B = ligand-independent transactivation domain; DBD = <t>DNA</t> binding domain; LBD = ligand-binding domain. Arrows indicate primers used in <t>RT-PCR</t> reactions in C and D. ( B ) A total of 523 out of 1437 (36.4%) of DEGs were identified as Ppar-γ target genes in ChEA_2016 (adjusted p -value
    Pcr Amplified, supplied by Promega, used in various techniques. Bioz Stars score: 98/100, based on 4343 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Promega
    Average 98 stars, based on 4343 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    N/A
    dNTP Mix GCamplifier is specially designed for amplification of GC rich DNA templates The kit contains a modified dGTP analog that significantly reduces the stability of GC rich sequences thereby
      Buy from Supplier

    97
    Qiagen pcr amplified
    Nova2 (neuro-oncological ventral antigen 2) affects the splicing of Ppar-γ (peroxisome proliferator-activated receptor-gamma) and expression of its target genes in ECs (endothelial cells). ( A ) Several Ppar-γ mRNAs are generated by alternative transcription start sites and alternative splicing (AS) of different exons in the 5′ terminal region (for simplicity, only the first exons A1, A2, and B were schematized). Ppar-γ1 mRNA contains exons A1 and A2, spliced together with exons 1–6, whereas, in Ppar-γ2 , exon B is present instead of exon A1 and A2. The upstream ATG in exon B determinates the inclusion of 28 (mouse) or 30 (human) amino acids at the N-terminal of Ppar-γ2 protein. Boxes = exons; thin lines = introns. A/B = ligand-independent transactivation domain; DBD = <t>DNA</t> binding domain; LBD = ligand-binding domain. Arrows indicate primers used in <t>RT-PCR</t> reactions in C and D. ( B ) A total of 523 out of 1437 (36.4%) of DEGs were identified as Ppar-γ target genes in ChEA_2016 (adjusted p -value
    Pcr Amplified, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1956 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/Qiagen
    Average 97 stars, based on 1956 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    Image Search Results


    PCR-Based Signature-Tagged Mutagenesis (A) Schematic drawing of PCR-based STM. Pools of 72 uniquely tagged mutants were intranasally inoculated into SP-A +/+ and SP-A −/− mice; 16 h later, lungs were harvested, homogenized, and plated. Approximately 10,000 colonies were harvested from the plates for genomic DNA extraction. PCR-amplification of tags was performed on the genomic DNA to screen for the presence or absence of DNA tags of each of the 72 mutants. Mutants whose DNA tags were present in the input pool and in the SP-A −/− pool, but absent in the SP-A +/+ pool (see white arrows) were further screened for susceptibility to SP-A. (B) Agarose gel of PCR-based STM, identifying the pch mutant (left panel). Attenuation in the first SP-A +/+ mouse (right panel, m1) was confirmed in two additional SP-A +/+ mice (right panel, m2 and m3). (C) Genetic loci of P. aeruginosa, when mutated, conferred increased sensitivity to in vivo killing by SP-A. DNA regions flanking pUTmini-Tn 5 transposon insertions were cloned and sequenced. Similarity BLAST searches were performed against P. aeruginosa PA01 genomic sequence on NCBI and on http://www.pseudomonas.com . Black arrows indicate the approximate insertion site within the mutated ORFS. (D) TLC analyses indicate that the pch STM mutant is unable to synthesize pyochelin (see arrows). Wild-type PA01 grown in LB and the pch mutant grown in LB supplemented with 1 mM salicylate produced green color pyochelin (see arrows). In contrast, no observable pyochelin was produced by the pch and PA06331 strains. Pure pyochelin was used as control. (E) Restriction fragment length polymorphism analysis between parental wild-type PA01 and STM mutants confirmed that mutations in pch and ptsP were caused by a single insertion.

    Journal: PLoS Pathogens

    Article Title: Comparative Signature-Tagged Mutagenesis Identifies Pseudomonas Factors Conferring Resistance to the Pulmonary Collectin SP-A

    doi: 10.1371/journal.ppat.0010031

    Figure Lengend Snippet: PCR-Based Signature-Tagged Mutagenesis (A) Schematic drawing of PCR-based STM. Pools of 72 uniquely tagged mutants were intranasally inoculated into SP-A +/+ and SP-A −/− mice; 16 h later, lungs were harvested, homogenized, and plated. Approximately 10,000 colonies were harvested from the plates for genomic DNA extraction. PCR-amplification of tags was performed on the genomic DNA to screen for the presence or absence of DNA tags of each of the 72 mutants. Mutants whose DNA tags were present in the input pool and in the SP-A −/− pool, but absent in the SP-A +/+ pool (see white arrows) were further screened for susceptibility to SP-A. (B) Agarose gel of PCR-based STM, identifying the pch mutant (left panel). Attenuation in the first SP-A +/+ mouse (right panel, m1) was confirmed in two additional SP-A +/+ mice (right panel, m2 and m3). (C) Genetic loci of P. aeruginosa, when mutated, conferred increased sensitivity to in vivo killing by SP-A. DNA regions flanking pUTmini-Tn 5 transposon insertions were cloned and sequenced. Similarity BLAST searches were performed against P. aeruginosa PA01 genomic sequence on NCBI and on http://www.pseudomonas.com . Black arrows indicate the approximate insertion site within the mutated ORFS. (D) TLC analyses indicate that the pch STM mutant is unable to synthesize pyochelin (see arrows). Wild-type PA01 grown in LB and the pch mutant grown in LB supplemented with 1 mM salicylate produced green color pyochelin (see arrows). In contrast, no observable pyochelin was produced by the pch and PA06331 strains. Pure pyochelin was used as control. (E) Restriction fragment length polymorphism analysis between parental wild-type PA01 and STM mutants confirmed that mutations in pch and ptsP were caused by a single insertion.

    Article Snippet: To complement the ptsP mutation, a 4.5-kb DNA fragment containing both the promoter and the ygdP-ptsP-PA0338 operon ( C) was PCR-amplified from the wild-type parental strain PA01 using the Expand Long Template PCR System (Roche Diagnostic, Basel, Switzerland), and cloned into E. coli-P. aeruginosa shuttle plasmid pUCP19 [ ] to obtain pUCP19-ptsP .

    Techniques: Polymerase Chain Reaction, Mutagenesis, Mouse Assay, DNA Extraction, Amplification, Agarose Gel Electrophoresis, In Vivo, Clone Assay, Sequencing, Thin Layer Chromatography, Produced

    Mechanims of inhibition by EBNA3A of the MIZ-1-dependent activation of the CDKN2B transcription. ( A ) EBNA3A-dependent downregulation of CDKN2B expression is independent of CtBP. The CDKN2p-Luc construct was transfected into HeLa cells, together with a CMV-renilla LUC plasmid as internal control and expression plasmids for EBNA3A or EBNA3A-CtBPmut and MIZ-1 as indicated in the Figure. Results are plotted relative to the co-transfected CMV-renilla-LUC plasmid. Error bars represent standard deviations from three replicate assays. Protein expression levels were controled by western blotting using an anti-EBNA3A or an anti-MIZ-1 antibody for one representative experiment (bottom panels). ( B ) EBNA3A-dependent downregulation of CDKN2B expression is independent of MYC. The LCL wt and LCL Δ3A were treated or not with the 10058-F4 MYC inhibitor. Quantification of CDKN2B mRNA levels was performed by real time RT-PCR. Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from three replicate assays based on two different cDNAs. ( C ) EBNA3A inhibits MIZ-1 interaction with its coactivator Nucleophosmin. MIZ-1 was immunoprecipitated from eithe the LCL wt or the LCL Δ3A with an anti-MIZ-1 specific polyclonal antibody or with an unrelated antibody. Immunoprecipitated MIZ-1 and co-immunoprecipitated Nucleophosmin (NPM) proteins were analyzed by western blotting. Inputs correspond to 5% of the cell extract used for immunoprecipitation.

    Journal: Nucleic Acids Research

    Article Title: Epstein–Barr virus nuclear antigen 3A protein regulates CDKN2B transcription via interaction with MIZ-1

    doi: 10.1093/nar/gku697

    Figure Lengend Snippet: Mechanims of inhibition by EBNA3A of the MIZ-1-dependent activation of the CDKN2B transcription. ( A ) EBNA3A-dependent downregulation of CDKN2B expression is independent of CtBP. The CDKN2p-Luc construct was transfected into HeLa cells, together with a CMV-renilla LUC plasmid as internal control and expression plasmids for EBNA3A or EBNA3A-CtBPmut and MIZ-1 as indicated in the Figure. Results are plotted relative to the co-transfected CMV-renilla-LUC plasmid. Error bars represent standard deviations from three replicate assays. Protein expression levels were controled by western blotting using an anti-EBNA3A or an anti-MIZ-1 antibody for one representative experiment (bottom panels). ( B ) EBNA3A-dependent downregulation of CDKN2B expression is independent of MYC. The LCL wt and LCL Δ3A were treated or not with the 10058-F4 MYC inhibitor. Quantification of CDKN2B mRNA levels was performed by real time RT-PCR. Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from three replicate assays based on two different cDNAs. ( C ) EBNA3A inhibits MIZ-1 interaction with its coactivator Nucleophosmin. MIZ-1 was immunoprecipitated from eithe the LCL wt or the LCL Δ3A with an anti-MIZ-1 specific polyclonal antibody or with an unrelated antibody. Immunoprecipitated MIZ-1 and co-immunoprecipitated Nucleophosmin (NPM) proteins were analyzed by western blotting. Inputs correspond to 5% of the cell extract used for immunoprecipitation.

    Article Snippet: Each ORF was polymerase chain reaction (PCR)-amplified (KOD polymerase, Novagen) from pSG5-EBNA3A/3B/3C ( ) using reverse and forward primers containing the attB1 and attB2 recombination sites respectively, then cloned into pDONR207 (BP Clonase, Invitrogen).

    Techniques: Inhibition, Activation Assay, Expressing, Construct, Transfection, Plasmid Preparation, Western Blot, Quantitative RT-PCR, Standard Deviation, Immunoprecipitation

    CDKN2B expression in lymphoblastoid cell lines is highly dependent on the presence or absence of EBNA3A. Analysis of CDKN2B mRNA expression levels from a normal LCL (wt) or an LCL established from the same donor but infected with an EBNA3A-deficient recombinant virus (D2 E3AmtB3) (LCLΔ3A) by either standard RT-PCR using actin mRNA as an internal control ( A ) or by real time RT-PCR ( B ). Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from four independent experiments. ( C ) ΔE3A-LCL doxE3A cells were induced for EBNA3A expression by treatment with 200 ng/ml Dox for 24, 48 or 72 h or left untreated. The percentage of cells expressing the NGFR—a control gene expressed simultaneously with EBNA3A from a common bicistronic promoter—upon Dox treatment was evaluated by FACS to be 65% after 72 h. CDKN2B transcripts in total RNA were quantified by RTqPCR normalized to GAPDH RNA. EBNA3A protein levels were analyzed by western blotting (bottom panel). The data shown are derived from a single experiment but are representative of three experiments. Error bars represent standard deviation from three qPCR replicates.

    Journal: Nucleic Acids Research

    Article Title: Epstein–Barr virus nuclear antigen 3A protein regulates CDKN2B transcription via interaction with MIZ-1

    doi: 10.1093/nar/gku697

    Figure Lengend Snippet: CDKN2B expression in lymphoblastoid cell lines is highly dependent on the presence or absence of EBNA3A. Analysis of CDKN2B mRNA expression levels from a normal LCL (wt) or an LCL established from the same donor but infected with an EBNA3A-deficient recombinant virus (D2 E3AmtB3) (LCLΔ3A) by either standard RT-PCR using actin mRNA as an internal control ( A ) or by real time RT-PCR ( B ). Histogram bars represent values relative to housekeeping gene GAPDH . Error bars represent standard deviation from four independent experiments. ( C ) ΔE3A-LCL doxE3A cells were induced for EBNA3A expression by treatment with 200 ng/ml Dox for 24, 48 or 72 h or left untreated. The percentage of cells expressing the NGFR—a control gene expressed simultaneously with EBNA3A from a common bicistronic promoter—upon Dox treatment was evaluated by FACS to be 65% after 72 h. CDKN2B transcripts in total RNA were quantified by RTqPCR normalized to GAPDH RNA. EBNA3A protein levels were analyzed by western blotting (bottom panel). The data shown are derived from a single experiment but are representative of three experiments. Error bars represent standard deviation from three qPCR replicates.

    Article Snippet: Each ORF was polymerase chain reaction (PCR)-amplified (KOD polymerase, Novagen) from pSG5-EBNA3A/3B/3C ( ) using reverse and forward primers containing the attB1 and attB2 recombination sites respectively, then cloned into pDONR207 (BP Clonase, Invitrogen).

    Techniques: Expressing, Infection, Recombinant, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Standard Deviation, FACS, Western Blot, Derivative Assay, Real-time Polymerase Chain Reaction

    Error rate of various reverse transcriptases including MarathonRT, SSIV, and TGIRT. ( A ) Single-molecule sequencing method. The schematic diagram of primers used for RT and second-strand synthesis is shown on the top . The principle underlying single-molecule sequencing is shown on the bottom . Only errors that are consistent in all sequencing reads that share the same product barcode are considered as RT errors (red stars). Errors that are inconsistent among reads sharing the same product barcode (green stars) will have originated from the PCR amplification or sequencing platform. ( B ) Error rate determination for different reverse transcriptases. The table summarizing the sequencing data is shown at left . In this table, nucleotides/product (row 4) is the number of nucleotides in each RT product that are used for final analysis, after the low quality bases at the ends were trimmed. Total nucleotides (row 5) is the total number of nucleotides involved in the analysis. The total number of reads (row 2) is the raw number of sequencing reads in either forward (R1) or reverse (R2) direction for each polymerase. The unique product (row 3) is a set of sequencing reads that share the same UMI (unique molecular identifier), and only unique products that have no less than three reads were included in the analysis (row 4). Nucleotide/product (row 5) shows the number of nucleotides that are incorporated by each polymerase after trimming the primer region and low-quality nucleotides at the end. Total nucleotides (row 6) is calculated by multiplying nucleotide/product (row 5) with the number of unique products (row 4), which is the total number of nucleotides analyzed. Substitution frequency (row 7) was calculated by dividing the number of total nucleotides (row 6) by the number of mutated nucleotides. Indel (insertion–deletion) frequency (row 8) was calculated by dividing the number of unique products by the number of indel events. N.A. suggests that current sequencing depth is not able to detect indels (insertion–deletion). The bar plot showing the substitutional frequency for MarathonRT, SSIV, and TGIRT is shown on the right .

    Journal: RNA

    Article Title: An ultraprocessive, accurate reverse transcriptase encoded by a metazoan group II intron

    doi: 10.1261/rna.063479.117

    Figure Lengend Snippet: Error rate of various reverse transcriptases including MarathonRT, SSIV, and TGIRT. ( A ) Single-molecule sequencing method. The schematic diagram of primers used for RT and second-strand synthesis is shown on the top . The principle underlying single-molecule sequencing is shown on the bottom . Only errors that are consistent in all sequencing reads that share the same product barcode are considered as RT errors (red stars). Errors that are inconsistent among reads sharing the same product barcode (green stars) will have originated from the PCR amplification or sequencing platform. ( B ) Error rate determination for different reverse transcriptases. The table summarizing the sequencing data is shown at left . In this table, nucleotides/product (row 4) is the number of nucleotides in each RT product that are used for final analysis, after the low quality bases at the ends were trimmed. Total nucleotides (row 5) is the total number of nucleotides involved in the analysis. The total number of reads (row 2) is the raw number of sequencing reads in either forward (R1) or reverse (R2) direction for each polymerase. The unique product (row 3) is a set of sequencing reads that share the same UMI (unique molecular identifier), and only unique products that have no less than three reads were included in the analysis (row 4). Nucleotide/product (row 5) shows the number of nucleotides that are incorporated by each polymerase after trimming the primer region and low-quality nucleotides at the end. Total nucleotides (row 6) is calculated by multiplying nucleotide/product (row 5) with the number of unique products (row 4), which is the total number of nucleotides analyzed. Substitution frequency (row 7) was calculated by dividing the number of total nucleotides (row 6) by the number of mutated nucleotides. Indel (insertion–deletion) frequency (row 8) was calculated by dividing the number of unique products by the number of indel events. N.A. suggests that current sequencing depth is not able to detect indels (insertion–deletion). The bar plot showing the substitutional frequency for MarathonRT, SSIV, and TGIRT is shown on the right .

    Article Snippet: Finally, the PCR-amplified products were pooled and samples for MarathonRT were sequenced on an Illumina Miseq sequencer in paired-end mode for 250 cycles (PE250) with 20% PhiX spike-in, whereas samples for SSIV and TGIRT were sequenced on an Illumina Hiseq sequencer in paired-end mode for 75 cycles (PE75) as 1% spike-in at YCGA.

    Techniques: Sequencing, Polymerase Chain Reaction, Amplification

    Consensus sequence of env genes. The sequencing strategy used (see Materials and Methods) allowed detection of only relevant mutations. The different origins of sequenced genes and the panel of primers used gave the sequences twice on both strands. (A) Schematic map of relevant mutations observed after consensus sequencing performed directly on PCR-amplified env genes from infected-cell populations of different origins. Env Ori , sequences obtained from nonderived CEM NDK ); Env mNDK sequences obtained from different derived cell populations: CEM mNDK , H9 H , H9 S , HeLa mNDK , and SW480 mNDK . (B) Schematic map of relevant mutations observed after consensus sequencing performed on cloned env genes from different origins ligated in the expression vector. Their ability to direct cell fusion when expressed in HeLa cells has previously been tested. Env NDK and Env NDKsb , clonotypic sequences from the env gene from the nonderived CEM NDK cell population; Env CEM15 , clonotypic sequence of the cellular clone 15 presenting a strict CD4-dependent entry phenotype; Env CEM29,27 and Env HeLa2,14,48 clonotypic sequences of cellular clones presenting a CD4-independent entry phenotype. wt, wild type.

    Journal: Journal of Virology

    Article Title: Spontaneous Mutations in the env Gene of the Human Immunodeficiency Virus Type 1 NDK Isolate Are Associated with a CD4-Independent Entry Phenotype

    doi:

    Figure Lengend Snippet: Consensus sequence of env genes. The sequencing strategy used (see Materials and Methods) allowed detection of only relevant mutations. The different origins of sequenced genes and the panel of primers used gave the sequences twice on both strands. (A) Schematic map of relevant mutations observed after consensus sequencing performed directly on PCR-amplified env genes from infected-cell populations of different origins. Env Ori , sequences obtained from nonderived CEM NDK ); Env mNDK sequences obtained from different derived cell populations: CEM mNDK , H9 H , H9 S , HeLa mNDK , and SW480 mNDK . (B) Schematic map of relevant mutations observed after consensus sequencing performed on cloned env genes from different origins ligated in the expression vector. Their ability to direct cell fusion when expressed in HeLa cells has previously been tested. Env NDK and Env NDKsb , clonotypic sequences from the env gene from the nonderived CEM NDK cell population; Env CEM15 , clonotypic sequence of the cellular clone 15 presenting a strict CD4-dependent entry phenotype; Env CEM29,27 and Env HeLa2,14,48 clonotypic sequences of cellular clones presenting a CD4-independent entry phenotype. wt, wild type.

    Article Snippet: The env cassette expression vector contained a PCR-amplified, blunted HIV-1 NDK LTR cloned in the blunted Sac I site of pBSKS+ (Stratagene).

    Techniques: Sequencing, Polymerase Chain Reaction, Amplification, Infection, Derivative Assay, Clone Assay, Expressing, Plasmid Preparation

    The UL7-MU viral strain exhibits attenuated phenotypes in a latent mouse infection model compared with the WT strain. a BALB/c mice were infected with WT HSV-1, UL7-MU or PBS via the foot pad at a dose of 5x10 3 /10 μl per mouse. The viral load was detected in the CNS of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles) by absolute real-time RT-PCR. Viral copy numbers were quantified according to the HSV-1 DNA standard pGM-T UL30 plasmid. b The levels of LAT expression in the CNS of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles), as determined by relative real-time RT-PCR. The graphic indicates the fold change of RNA levels in virus-infected mice compared to PBS-injected mice. The mouse housekeeping gene GAPDH was used to normalize quantities in mouse tissue. Relative quantification was performed by the comparative Ct method (△△Ct) using RNA from PBS mice as a calibrator. c Viral load detection in the spinal cord of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). d The levels of LAT expression in the spinal cord of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). e Viral load detection in the trigeminal nerve of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). f The levels of LAT expression in the trigeminal nerves of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). Data are shown as the means ± SD (experiments done once in triplicate). ∗∗∗ P

    Journal: Virology Journal

    Article Title: The mutated tegument protein UL7 attenuates the virulence of herpes simplex virus 1 by reducing the modulation of α-4 gene transcription

    doi: 10.1186/s12985-016-0600-9

    Figure Lengend Snippet: The UL7-MU viral strain exhibits attenuated phenotypes in a latent mouse infection model compared with the WT strain. a BALB/c mice were infected with WT HSV-1, UL7-MU or PBS via the foot pad at a dose of 5x10 3 /10 μl per mouse. The viral load was detected in the CNS of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles) by absolute real-time RT-PCR. Viral copy numbers were quantified according to the HSV-1 DNA standard pGM-T UL30 plasmid. b The levels of LAT expression in the CNS of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles), as determined by relative real-time RT-PCR. The graphic indicates the fold change of RNA levels in virus-infected mice compared to PBS-injected mice. The mouse housekeeping gene GAPDH was used to normalize quantities in mouse tissue. Relative quantification was performed by the comparative Ct method (△△Ct) using RNA from PBS mice as a calibrator. c Viral load detection in the spinal cord of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). d The levels of LAT expression in the spinal cord of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). e Viral load detection in the trigeminal nerve of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). f The levels of LAT expression in the trigeminal nerves of mice challenged with WT (open boxes), UL7-MU (filled circles) or PBS (filled triangles). Data are shown as the means ± SD (experiments done once in triplicate). ∗∗∗ P

    Article Snippet: The genomic region surrounding the CRISPR target site of the UL7 gene was PCR-amplified using PrimeSTAR DNA polymerase (TAKARA, Dalian, Liaoning, China) with the primers UL7-sense and UL7-antisense.

    Techniques: Infection, Mouse Assay, Quantitative RT-PCR, Plasmid Preparation, Expressing, Injection

    UL7 protein is involved in regulating the transcriptional activation of the HSV-1 α-4 gene. a Comparison of α-4 transcriptional efficiencies during the proliferetion of UL7-MU (filled circles) and WT viral strains (open boxes). Gene expression levels were detected using absolute real-time RT-PCR. Gene copy numbers were quantified according to the gene RNA standard. b HEK293T cells were co-transfected with pGL-α-4, pGL-UL23 or pGL-UL41 and UL7-WT, UL7-MU or control plasmid for 36 h before luciferase activities were quantified. Data are shown as means ± SD. ∗∗ P

    Journal: Virology Journal

    Article Title: The mutated tegument protein UL7 attenuates the virulence of herpes simplex virus 1 by reducing the modulation of α-4 gene transcription

    doi: 10.1186/s12985-016-0600-9

    Figure Lengend Snippet: UL7 protein is involved in regulating the transcriptional activation of the HSV-1 α-4 gene. a Comparison of α-4 transcriptional efficiencies during the proliferetion of UL7-MU (filled circles) and WT viral strains (open boxes). Gene expression levels were detected using absolute real-time RT-PCR. Gene copy numbers were quantified according to the gene RNA standard. b HEK293T cells were co-transfected with pGL-α-4, pGL-UL23 or pGL-UL41 and UL7-WT, UL7-MU or control plasmid for 36 h before luciferase activities were quantified. Data are shown as means ± SD. ∗∗ P

    Article Snippet: The genomic region surrounding the CRISPR target site of the UL7 gene was PCR-amplified using PrimeSTAR DNA polymerase (TAKARA, Dalian, Liaoning, China) with the primers UL7-sense and UL7-antisense.

    Techniques: Activation Assay, Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, Luciferase

    Identification of the mutated UL7 gene in the viral strain. a Design of the g-RNA sequences for UL7 gene mutation, with the target sites of the g-RNAs (UL7-1 and UL7-2) labeled in yellow. The fragments amplified by oligo 1 and oligo 2 were used in the SURVEYOR assay. b SURVEYOR detection of the mutated genes. Top: SURVEYOR assay of HSV-1 genomic DNA extracted from HEK293T cells expressing UL7-1 and UL7-2 individually or together infected with HSV-1 (P1); bottom: SURVEYOR assay of HSV-1 genomic DNA extracted from HEK293T cells expressing UL7-1 and UL7-2 individually or together infected with HSV-1 progeny virus (P2). c Identification of the mutated UL7 gene in the viral strain. The UL7 mutant was identified via PCR using UL7-sense and UL7-antisense primers. The mutated UL7 gene is indicated with a red box

    Journal: Virology Journal

    Article Title: The mutated tegument protein UL7 attenuates the virulence of herpes simplex virus 1 by reducing the modulation of α-4 gene transcription

    doi: 10.1186/s12985-016-0600-9

    Figure Lengend Snippet: Identification of the mutated UL7 gene in the viral strain. a Design of the g-RNA sequences for UL7 gene mutation, with the target sites of the g-RNAs (UL7-1 and UL7-2) labeled in yellow. The fragments amplified by oligo 1 and oligo 2 were used in the SURVEYOR assay. b SURVEYOR detection of the mutated genes. Top: SURVEYOR assay of HSV-1 genomic DNA extracted from HEK293T cells expressing UL7-1 and UL7-2 individually or together infected with HSV-1 (P1); bottom: SURVEYOR assay of HSV-1 genomic DNA extracted from HEK293T cells expressing UL7-1 and UL7-2 individually or together infected with HSV-1 progeny virus (P2). c Identification of the mutated UL7 gene in the viral strain. The UL7 mutant was identified via PCR using UL7-sense and UL7-antisense primers. The mutated UL7 gene is indicated with a red box

    Article Snippet: The genomic region surrounding the CRISPR target site of the UL7 gene was PCR-amplified using PrimeSTAR DNA polymerase (TAKARA, Dalian, Liaoning, China) with the primers UL7-sense and UL7-antisense.

    Techniques: Mutagenesis, Labeling, Amplification, Expressing, Infection, Polymerase Chain Reaction

    BIRM induced decrease in AR is due to increased proteasomal degradation of AR ( A ) Total RNA was purified from LAPC-4 treated with 10 μl/ml BIRM with or without 1 nM DHT for 48 h and semi-quantitative RT-PCR (i) was performed. GAPDH was amplified as an internal control. (ii) Quantitative real time PCR was performed on LAPC-4 cells treated with BIRM with 1nM DHT, the graph shows a relative AR mRNA expression normalized against a β-actin mRNA. ( B ) LAPC-4 and LNCaP cells incubated with or without BIRM (20 μl/ml) for 48 h, were pretreated with 10 μM LY294002 (PI-3Kinase inhibitor) for 1 h, or co-treatment with MG132 (proteasome inhibitor) for 4 h at the end of treatment. Decrease AR levels were monitored by Immunoblotting. ( C ) LAPC-4 cells were treated with indicated doses of BIRM for 48 h with or without MG132 treatment as described above. Immunoprecipitation was performed using anti-AR antibody and Western blotting was performed with anti-Ubiquitin antibody. Emodin treatment was performed for positive control of AR ubiquitination. ( D ) LAPC-4 cells were treated with various doses of BIRM for 48 h or 5 μg ml geldanamycin (GA) for 18 h and harvested. Cell lysate was used for Immunoprecipitation with a-Hsp90 antibody, separated by SDS-PAGE and probed with a-AR or a-acetyl lysine antibody. GA treated samples was used as a positive control of decrease interaction between AR and Hsp90. Due to high background in control band (0 μl/ml BIRM) in lane1, accurate densitometry of band intensity was difficult. However, there was > 50% decrease in the Hsp90-bound AR at 5 μl/ml BIRM. BIRM induced strong acetylation of Hsp90 at 5μl/ml. The disintegrated band at higher BIRM exposure might be associated with cells undergoing apoptosis. GA: Geldanamycin treated cell lysates, IgG: normal mouse IgG as negative control in IP.

    Journal: Oncotarget

    Article Title: The andean anticancer herbal product BIRM causes destabilization of androgen receptor and induces caspase-8 mediated-apoptosis in prostate cancer

    doi: 10.18632/oncotarget.12393

    Figure Lengend Snippet: BIRM induced decrease in AR is due to increased proteasomal degradation of AR ( A ) Total RNA was purified from LAPC-4 treated with 10 μl/ml BIRM with or without 1 nM DHT for 48 h and semi-quantitative RT-PCR (i) was performed. GAPDH was amplified as an internal control. (ii) Quantitative real time PCR was performed on LAPC-4 cells treated with BIRM with 1nM DHT, the graph shows a relative AR mRNA expression normalized against a β-actin mRNA. ( B ) LAPC-4 and LNCaP cells incubated with or without BIRM (20 μl/ml) for 48 h, were pretreated with 10 μM LY294002 (PI-3Kinase inhibitor) for 1 h, or co-treatment with MG132 (proteasome inhibitor) for 4 h at the end of treatment. Decrease AR levels were monitored by Immunoblotting. ( C ) LAPC-4 cells were treated with indicated doses of BIRM for 48 h with or without MG132 treatment as described above. Immunoprecipitation was performed using anti-AR antibody and Western blotting was performed with anti-Ubiquitin antibody. Emodin treatment was performed for positive control of AR ubiquitination. ( D ) LAPC-4 cells were treated with various doses of BIRM for 48 h or 5 μg ml geldanamycin (GA) for 18 h and harvested. Cell lysate was used for Immunoprecipitation with a-Hsp90 antibody, separated by SDS-PAGE and probed with a-AR or a-acetyl lysine antibody. GA treated samples was used as a positive control of decrease interaction between AR and Hsp90. Due to high background in control band (0 μl/ml BIRM) in lane1, accurate densitometry of band intensity was difficult. However, there was > 50% decrease in the Hsp90-bound AR at 5 μl/ml BIRM. BIRM induced strong acetylation of Hsp90 at 5μl/ml. The disintegrated band at higher BIRM exposure might be associated with cells undergoing apoptosis. GA: Geldanamycin treated cell lysates, IgG: normal mouse IgG as negative control in IP.

    Article Snippet: RNA was reverse transcribed and PCR-amplified, expressions of AR and PSA mRNA were analyzed by semi-quantitative RT-PCR and real time quantitative PCR (qPCR) using Bio-rad icycler IQ as described before [ , ].

    Techniques: Purification, Quantitative RT-PCR, Amplification, Real-time Polymerase Chain Reaction, Expressing, Incubation, Immunoprecipitation, Western Blot, Positive Control, SDS Page, Negative Control

    Rs688 is associated with LDLR splicing efficiency in the male human brain in vivo This figure depicts representative splicing patterns corresponding to the indicated PCR products as well as quantitation of exon 12 splicing efficiency in the brains of separate males (A) and females (B). Rs688 was associated significantly with splicing in males (p=0.041) but not females (p=0.43) as determined by Jonckheere-Terpstra ranked sum tests.

    Journal: Human molecular genetics

    Article Title: Sex-dependent Association of a Common Low Density Lipoprotein Receptor Polymorphism with RNA Splicing Efficiency in the Brain and Alzheimers Disease

    doi: 10.1093/hmg/ddm365

    Figure Lengend Snippet: Rs688 is associated with LDLR splicing efficiency in the male human brain in vivo This figure depicts representative splicing patterns corresponding to the indicated PCR products as well as quantitation of exon 12 splicing efficiency in the brains of separate males (A) and females (B). Rs688 was associated significantly with splicing in males (p=0.041) but not females (p=0.43) as determined by Jonckheere-Terpstra ranked sum tests.

    Article Snippet: Briefly, RNA was converted to cDNA (SuperScript II, Invitrogen) and sequences corresponding to LDLR minigene splice products were PCR-amplified (Platinum Taq, Invitrogen) by using a sense primer corresponding to vector sequence at the beginning of the transcription product (5’ACTAGTCCAGTGTGGTGGAATTGCC 3’) and an antisense primer corresponding to sequence within LDLR exon 14 (5’- CATCGTGGTGGATCCTGTTC).

    Techniques: In Vivo, Polymerase Chain Reaction, Quantitation Assay

    Rs688 modulates LDLR splicing efficiency in neuroblastoma cells in vitro LDLR minigenes containing rs688C and rs688T alleles, or the same haplotypes wherein rs688C and rs688T were specifically converted by site-directed mutagenesis, were transfected into SH-SY5Y cells in parallel and RNA isolated for analyses 24 hours later. These results depict representative images of the splicing results with PCR products corresponding to LDLR exons 10−11−12−13−14, as well as LDLR exons 10−11−13−14 (delta 12 LDLR), and LDLR exons 10−13−14 (delta 11 − 12 LDLR). Quantification of rs688 effects on splicing is also depicted; data points represent separate analyses beginning with cell transfection. The rs688T allele was associated with decreased splicing efficiency regardless of background haplotype, as reflected by Kruskal-Wallis statistical analyses (p=0.026).

    Journal: Human molecular genetics

    Article Title: Sex-dependent Association of a Common Low Density Lipoprotein Receptor Polymorphism with RNA Splicing Efficiency in the Brain and Alzheimers Disease

    doi: 10.1093/hmg/ddm365

    Figure Lengend Snippet: Rs688 modulates LDLR splicing efficiency in neuroblastoma cells in vitro LDLR minigenes containing rs688C and rs688T alleles, or the same haplotypes wherein rs688C and rs688T were specifically converted by site-directed mutagenesis, were transfected into SH-SY5Y cells in parallel and RNA isolated for analyses 24 hours later. These results depict representative images of the splicing results with PCR products corresponding to LDLR exons 10−11−12−13−14, as well as LDLR exons 10−11−13−14 (delta 12 LDLR), and LDLR exons 10−13−14 (delta 11 − 12 LDLR). Quantification of rs688 effects on splicing is also depicted; data points represent separate analyses beginning with cell transfection. The rs688T allele was associated with decreased splicing efficiency regardless of background haplotype, as reflected by Kruskal-Wallis statistical analyses (p=0.026).

    Article Snippet: Briefly, RNA was converted to cDNA (SuperScript II, Invitrogen) and sequences corresponding to LDLR minigene splice products were PCR-amplified (Platinum Taq, Invitrogen) by using a sense primer corresponding to vector sequence at the beginning of the transcription product (5’ACTAGTCCAGTGTGGTGGAATTGCC 3’) and an antisense primer corresponding to sequence within LDLR exon 14 (5’- CATCGTGGTGGATCCTGTTC).

    Techniques: In Vitro, Mutagenesis, Transfection, Isolation, Polymerase Chain Reaction

    Dependence of expression on MYC, AKT and BCLXL for sustained growth of transformed T cells in vitro (A) Relative mRNA expression of MYC, AKT and BCLXL was quantified using real-time PCR on indicated days after removal of Dox. (B) Cellular viability, apoptosis, cell size, cell cycle status and cumulative number of cells were recorded for 7 days in the presence of absence of Dox.

    Journal: Oncotarget

    Article Title: Transformation of mouse T cells requires MYC and AKT activity in conjunction with inhibition of intrinsic apoptosis

    doi: 10.18632/oncotarget.25113

    Figure Lengend Snippet: Dependence of expression on MYC, AKT and BCLXL for sustained growth of transformed T cells in vitro (A) Relative mRNA expression of MYC, AKT and BCLXL was quantified using real-time PCR on indicated days after removal of Dox. (B) Cellular viability, apoptosis, cell size, cell cycle status and cumulative number of cells were recorded for 7 days in the presence of absence of Dox.

    Article Snippet: Myr-HA-AKT was PCR-amplified from 901 pLNCX-myr-HA-Akt1 (a gift from William Sellers (Addgene plasmid #9005), [ ]) using forward primer; ACTGT GAATTC ACCACCATGGGGTCTTCAAAATCTAAAC and reverse primer; TGCAT CTCGAG TCAGGCCGTGCCGCTGGCCG followed by ligation into the EcoRI/XhoI site of pMSCV-IRES-EGFPZeo.

    Techniques: Expressing, Transformation Assay, In Vitro, Real-time Polymerase Chain Reaction

    Nup62 knockdown significantly inhibited HIV-1 infection by reducing viral DNA integration. A , C8166 cells were transduced with lentiviral vectors harboring Nup62 shRNA or empty vector and were subsequently analyzed for Nup62 expression by WB at different time points. γ-Actin was included as an internal control. B , inhibitory effect of Nup62-KD on HIV-1 replication in CD4 + C8166 T cells and macrophages. Nup62-KD and empty C8166 cells were infected with VSV-G pseudotyped luc-expressing HIV-1 (pNL-BruΔBgl/Luc) ( left panel ) or HIV-1 pNL 4.3-GFP ( right panel ). The Luc activity from cells or HIV Gag-p24 levels of supernatants was measured to monitor viral replication after 48 h. C , monocyte-derived macrophages from healthy donors were transduced with lentiviral vectors encoding Nup62-shRNA and Nup62-siRNA, as described under “Experimental Procedures.” At day 4 post-transduction, MDMs were infected with the pNL4.3-Bal virus strain. Viral replication was monitored by measuring the levels of the HIV-1 Gag-p24 antigen in supernatants at different time points after infection. D , Nup62-KD, importin α3-kDa ( Imp α 3-kDa ), and ScRNA-C8166 T cells were infected with HIV-1 pNL4.3 Env + /R − /Luc virus, and 20 h later, DNA was extracted from infected cells, and HIV-1 late reverse transcription products ( upper panel ), HIV-1 two-LTR circles ( middle panel ), and the integrated DNA levels ( lower panel ) were analyzed by RQ-PCR using corresponding primers, as described under “Experimental Procedures.” Means and standard errors are representative of the results for duplicate samples from a typical experiment and were confirmed in two other independent experiments.

    Journal: The Journal of Biological Chemistry

    Article Title: Contribution of Host Nucleoporin 62 in HIV-1 Integrase Chromatin Association and Viral DNA Integration

    doi: 10.1074/jbc.M111.317057

    Figure Lengend Snippet: Nup62 knockdown significantly inhibited HIV-1 infection by reducing viral DNA integration. A , C8166 cells were transduced with lentiviral vectors harboring Nup62 shRNA or empty vector and were subsequently analyzed for Nup62 expression by WB at different time points. γ-Actin was included as an internal control. B , inhibitory effect of Nup62-KD on HIV-1 replication in CD4 + C8166 T cells and macrophages. Nup62-KD and empty C8166 cells were infected with VSV-G pseudotyped luc-expressing HIV-1 (pNL-BruΔBgl/Luc) ( left panel ) or HIV-1 pNL 4.3-GFP ( right panel ). The Luc activity from cells or HIV Gag-p24 levels of supernatants was measured to monitor viral replication after 48 h. C , monocyte-derived macrophages from healthy donors were transduced with lentiviral vectors encoding Nup62-shRNA and Nup62-siRNA, as described under “Experimental Procedures.” At day 4 post-transduction, MDMs were infected with the pNL4.3-Bal virus strain. Viral replication was monitored by measuring the levels of the HIV-1 Gag-p24 antigen in supernatants at different time points after infection. D , Nup62-KD, importin α3-kDa ( Imp α 3-kDa ), and ScRNA-C8166 T cells were infected with HIV-1 pNL4.3 Env + /R − /Luc virus, and 20 h later, DNA was extracted from infected cells, and HIV-1 late reverse transcription products ( upper panel ), HIV-1 two-LTR circles ( middle panel ), and the integrated DNA levels ( lower panel ) were analyzed by RQ-PCR using corresponding primers, as described under “Experimental Procedures.” Means and standard errors are representative of the results for duplicate samples from a typical experiment and were confirmed in two other independent experiments.

    Article Snippet: To construct SVCMV-T7-Nup62(1–325) or T7-Nup62(328–522) plasmid, the cDNAs encoding Homo sapiens Nup62(1–325) and Nup62(328–522) were PCR-amplified with the corresponding primers from pCMV6-entry-Nup62-myc (OriGene Technologies) and cloned into the SVCMVin-T7 vector at the 3′ end of a T7 tag using BamHI/HindIII or BglII/HindIII restriction sites.

    Techniques: Infection, Transduction, shRNA, Plasmid Preparation, Expressing, Western Blot, Activity Assay, Derivative Assay, Polymerase Chain Reaction

    Screening of HTLV-1 LTR-luc stable integrants. (A) Luciferase activity in stably integrated HTLV-1 LTR Jurkat clones was measured in terms of relative light units. Control represents the luciferase activity from the cells that were stably integrated with pGL3-basic vector and pRSV-neo. Each value shown represents the average of duplicate transfection reactions and is representative of at least two independent experiments. Error bars indicate standard deviation (±) from one representative experiment. (B) For verifying HTLV-1 LTR-luc integration, all five clones (C1–C5) were examined and confirmed qualitatively for HTLV-1 LTR-luc integration for both LTR and luciferase genes independently by PCR amplification of LTR with product size 183 bp and Southern blot hybridization using luciferase probe following PCR amplification of luciferase gene with product size 1.6 kb. The control clone represents the Jurkat clone stably integrated with pGL3-basic vector and pRSV-neo in the absence of the HTLV-1 LTR. The positive control in each case is the pU3R-luc plasmid. (D) For quantifying HTLV-1 provirus copy numbers by real-time PCR in the stably integrated clones, all five clones (C1–C5) were selected for real-time PCR analysis to determine the copy number of copies of the integrated LTR per 100 cells. Standard curves for β-actin and the HTLV-1 LTR were generated from Jurkat and TARL-2 cell lines, respectively, with the coefficient of correlation, r 2 , being greater than 0.996 for both.

    Journal: PLoS ONE

    Article Title: HTLV-1 Tax Mediated Downregulation of miRNAs Associated with Chromatin Remodeling Factors in T Cells with Stably Integrated Viral Promoter

    doi: 10.1371/journal.pone.0034490

    Figure Lengend Snippet: Screening of HTLV-1 LTR-luc stable integrants. (A) Luciferase activity in stably integrated HTLV-1 LTR Jurkat clones was measured in terms of relative light units. Control represents the luciferase activity from the cells that were stably integrated with pGL3-basic vector and pRSV-neo. Each value shown represents the average of duplicate transfection reactions and is representative of at least two independent experiments. Error bars indicate standard deviation (±) from one representative experiment. (B) For verifying HTLV-1 LTR-luc integration, all five clones (C1–C5) were examined and confirmed qualitatively for HTLV-1 LTR-luc integration for both LTR and luciferase genes independently by PCR amplification of LTR with product size 183 bp and Southern blot hybridization using luciferase probe following PCR amplification of luciferase gene with product size 1.6 kb. The control clone represents the Jurkat clone stably integrated with pGL3-basic vector and pRSV-neo in the absence of the HTLV-1 LTR. The positive control in each case is the pU3R-luc plasmid. (D) For quantifying HTLV-1 provirus copy numbers by real-time PCR in the stably integrated clones, all five clones (C1–C5) were selected for real-time PCR analysis to determine the copy number of copies of the integrated LTR per 100 cells. Standard curves for β-actin and the HTLV-1 LTR were generated from Jurkat and TARL-2 cell lines, respectively, with the coefficient of correlation, r 2 , being greater than 0.996 for both.

    Article Snippet: To rule out the possibility of a mutation within the integrated viral promoter being responsible for the observed variation in the LTR activity in the clones, the five clones were PCR-amplified using the primers RV3 and GL2 with specificity for the insert (integrated HTLV-1 LTR-luc) within the multiple cloning site of the pGL3 vector and sequenced (GENEWIZ, Inc, South Plainfield, NJ).

    Techniques: Luciferase, Activity Assay, Stable Transfection, Clone Assay, Plasmid Preparation, Transfection, Standard Deviation, Polymerase Chain Reaction, Amplification, Southern Blot, Hybridization, Positive Control, Real-time Polymerase Chain Reaction, Generated

    PCR-RFLP patterns for H. pullorum and H. canadensis of 1.2-kb 16S rRNA Helicobacter -specific PCR products. (A) Alu I digestion; (B) Hha I digestion; (C) Apa LI digestion. The 1.2-kb PCR product of the Helicobacter 16S rRNA gene was digested for 3 h with selected endonucleases and then separated by electrophoresis on a 6% Visigel matrix. Lane M, 100-bp DNA ladder; lane 1, H. pullorum NCTC 12824; lane 2, H. pullorum NCTC 12827; lane 3, H. pullorum human isolate MIT 98-5493; lane 4, H. pullorum human isolate MIT 98-5494; lanes 5 to 8, H. canadensis isolates NLEP-16143, NLEP-16767, NLEP-17813, and NLEP-99-3017.

    Journal: Journal of Clinical Microbiology

    Article Title: Helicobacter canadensis sp. nov. Isolated from Humans with Diarrhea as an Example of an Emerging Pathogen

    doi:

    Figure Lengend Snippet: PCR-RFLP patterns for H. pullorum and H. canadensis of 1.2-kb 16S rRNA Helicobacter -specific PCR products. (A) Alu I digestion; (B) Hha I digestion; (C) Apa LI digestion. The 1.2-kb PCR product of the Helicobacter 16S rRNA gene was digested for 3 h with selected endonucleases and then separated by electrophoresis on a 6% Visigel matrix. Lane M, 100-bp DNA ladder; lane 1, H. pullorum NCTC 12824; lane 2, H. pullorum NCTC 12827; lane 3, H. pullorum human isolate MIT 98-5493; lane 4, H. pullorum human isolate MIT 98-5494; lanes 5 to 8, H. canadensis isolates NLEP-16143, NLEP-16767, NLEP-17813, and NLEP-99-3017.

    Article Snippet: PCR-amplified DNA (20 μl) was digested with 10 U of enzyme in the appropriate buffer recommended by the enzyme manufacturer at 37°C for 3 h. Restriction patterns were compared after the digested PCR products were separated on a 6% Visigel separation matrix.

    Techniques: Polymerase Chain Reaction, Electrophoresis

    Meiotic splicing in tgs1 Δ cells. RNAs isolated from wild-type and tgs1Δ diploid strains sampled immediately prior to transfer to sporulation medium (lane 3) or 4 h (lane 4) and 8 h (lane 5) post-transfer to sporulation medium were reverse transcribed and the cDNAs were PCR-amplified with gene-specific primers flanking the introns of meiotic transcripts SPO22, PCH2 and SAE3 and the constitutively spliced GLC7 transcript. The antisense PCR primers were 5′ 32 P-labeled in each case. The labeled PCR products were resolved by native agarose gel electrophoresis. The RNA samples in lanes 1 were PCR-amplified without reverse transcription, as a control for potential genomic DNA contamination. Lane 2 includes aliquots of the products of PCR-amplification of genomic DNA, which are the same size as the RT–PCR products derived from the intron-containing RNAs. The RT–PCR products from wild-type ( 16 ) and tgs1 Δ diploids were analyzed on the same gel and visualized by autoradiography. The positions of the RT–PCR products of unspliced and spliced transcripts are indicated at ‘right’.

    Journal: Nucleic Acids Research

    Article Title: An essential role for trimethylguanosine RNA caps in Saccharomyces cerevisiae meiosis and their requirement for splicing of SAE3 and PCH2 meiotic pre-mRNAs

    doi: 10.1093/nar/gkr083

    Figure Lengend Snippet: Meiotic splicing in tgs1 Δ cells. RNAs isolated from wild-type and tgs1Δ diploid strains sampled immediately prior to transfer to sporulation medium (lane 3) or 4 h (lane 4) and 8 h (lane 5) post-transfer to sporulation medium were reverse transcribed and the cDNAs were PCR-amplified with gene-specific primers flanking the introns of meiotic transcripts SPO22, PCH2 and SAE3 and the constitutively spliced GLC7 transcript. The antisense PCR primers were 5′ 32 P-labeled in each case. The labeled PCR products were resolved by native agarose gel electrophoresis. The RNA samples in lanes 1 were PCR-amplified without reverse transcription, as a control for potential genomic DNA contamination. Lane 2 includes aliquots of the products of PCR-amplification of genomic DNA, which are the same size as the RT–PCR products derived from the intron-containing RNAs. The RT–PCR products from wild-type ( 16 ) and tgs1 Δ diploids were analyzed on the same gel and visualized by autoradiography. The positions of the RT–PCR products of unspliced and spliced transcripts are indicated at ‘right’.

    Article Snippet: The cDNAs for meiotic transcripts were then PCR-amplified in 25 μl reaction mixtures containing 1X native Pfu buffer, 0.2 mM dNTPs, 0.8 μM gene-specific sense strand primer and 0.8 μM 5′-32 P-labeled gene-specific antisense strand primer , 0.05 U/μl Pfu DNA Polymerase (Agilent Technologies) and 2 μl of each cDNA sample.

    Techniques: Isolation, Polymerase Chain Reaction, Amplification, Labeling, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Derivative Assay, Autoradiography

    A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.

    Journal: Nucleic Acids Research

    Article Title: Efficient CRISPR/Cas9-mediated editing of trinucleotide repeat expansion in myotonic dystrophy patient-derived iPS and myogenic cells

    doi: 10.1093/nar/gky548

    Figure Lengend Snippet: A dual gRNA approach for CRISPR/Cas9-mediated correction of DM1-iPSC Myo and evidence for trinucleotide CTG repeat excision. ( A ) Diagrammatic representation for targeting of the 3 ‘UTR region of the DMPK gene using a dual gRNA approach for CRISPR/Cas9-mediated gene correction. The dual gRNAs ( 5′ 3′-CTG repeat -gRNA ) target Cas9 on either side of the CTG repeat region for excision of the expanded trinucleotide repeat. ( B ) Cas9 immunofluorescence staining of CRISPR/Cas9 treated DM1-iPSC-Myo cells, at 1-week post transduction. The upper panel shows representative images of DM1-iPSC-Myo cells stained for Cas9 (in red) and co-stained with DAPI for nuclei (in blue) (scale bar = 50 μm). The lower panel shows the graph for the quantitation of microscopy data for Cas9 positive cells. ( C ) Representative electropherograms of Triplet Repeat Primed PCR (TP) products from DM1-iPSC-Myo after CRISPR/Cas9-mediated gene editing from three independent experiments for each of the three treatments (Cas9 and 5′ 3′-CTG repeat -gRNA; Cas9 and scrambled gRNA; 5′-CTG repeat -gRNA, 3′-CTG repeat -gRNA and no Cas9) and untreated control conditions (WT-iPSC-Myo and DM1-iPSC-Myo). ( D ) Sanger sequencing results of on-target activity. The DMPK target locus was amplified by primers flanking the 2 SNPs [ C > T ; G > A : mutant > wild-type allele] and the CTG repeat region [ (CTG) ∼1371 /(CTG) 5 ]. The SNPs allowed discrimination of mutant ( C G ) and wild-type alleles (T A). Analysis of CRISPR/Cas9 activity on the targeted mutant allele showed a large deletion [(–) ∼4188 bp] between the 5′-CTG repeat -gRNA and 3′-CTG repeat -gRNA target sites. CRISPR/Cas9 activity on wild type allele was also detected by deletions between the corresponding gRNA target sites. Representative sequences of the wild-type allele with commonly found deletions and insertions are depicted in the figure. SNPs marked in red are seen in the mutant allele and those in blue are present in the wild type allele. Insertions are indicated by (+) and deletions are indicated by (–). Small letters represent the inserted nucleotides.

    Article Snippet: The gRNA expression cassette composed of the pol III U6 promoter-gRNA-scaffold, which was then PCR-amplified with BsiWI and SpeI flanking restriction enzyme sites and cloned into a lentiviral vector backbone ( ) along with Blue fluorescent protein (BFP; Evrogen; FP172) a reporter expressed under cytomegalovirus (CMV ) promoter ( ).

    Techniques: CRISPR, CTG Assay, Immunofluorescence, Staining, Transduction, Quantitation Assay, Microscopy, Polymerase Chain Reaction, Sequencing, Activity Assay, Amplification, Mutagenesis

    MARCH1 expression is increased in WAT from obese humans and mice and regulates insulin signalling in target tissues. ( a ) qRT-PCR measurement of March1 expression in WAT of adult male C57BL/6 J mice fed either regular chow or high-fat diet. ( b ) qRT-PCR measurement of MARCH1 expression in WAT from lean ( n =8) and obese ( n =13) human adolescent subjects. ( c ) Immunoblot analysis of AKT Ser 473 phosphorylation in differentiated 3T3-L1 adipocytes expressing indicated shRNAs. ( d ) Relative 14 C-2-deoxyglucose uptake ( n =4) in differentiated 3T3-L1 adipocytes expressing either NS or March1 shRNA. ( e ) Relative glycogen synthesis ( n =3) in differentiated 3T3-L1 adipocytes expressing either NS or March1 shRNA. ( f ) Immunoblot analysis of AKT Ser 473 phosphorylation in HepG2 hepatocytes expressing either NS or MARCH1 shRNA. ( g ) Relative glycogen synthesis ( n =3) in HepG2 hepatocytes expressing either NS or MARCH1 shRNA. In d , e , g , *compares NS and MARCH1 shRNAs in presence of insulin. In all panels, data are mean±s.e.m. and * P

    Journal: Nature Communications

    Article Title: MARCH1 regulates insulin sensitivity by controlling cell surface insulin receptor levels

    doi: 10.1038/ncomms12639

    Figure Lengend Snippet: MARCH1 expression is increased in WAT from obese humans and mice and regulates insulin signalling in target tissues. ( a ) qRT-PCR measurement of March1 expression in WAT of adult male C57BL/6 J mice fed either regular chow or high-fat diet. ( b ) qRT-PCR measurement of MARCH1 expression in WAT from lean ( n =8) and obese ( n =13) human adolescent subjects. ( c ) Immunoblot analysis of AKT Ser 473 phosphorylation in differentiated 3T3-L1 adipocytes expressing indicated shRNAs. ( d ) Relative 14 C-2-deoxyglucose uptake ( n =4) in differentiated 3T3-L1 adipocytes expressing either NS or March1 shRNA. ( e ) Relative glycogen synthesis ( n =3) in differentiated 3T3-L1 adipocytes expressing either NS or March1 shRNA. ( f ) Immunoblot analysis of AKT Ser 473 phosphorylation in HepG2 hepatocytes expressing either NS or MARCH1 shRNA. ( g ) Relative glycogen synthesis ( n =3) in HepG2 hepatocytes expressing either NS or MARCH1 shRNA. In d , e , g , *compares NS and MARCH1 shRNAs in presence of insulin. In all panels, data are mean±s.e.m. and * P

    Article Snippet: The human MARCH1 promoter (2.3 kb upstream of the transcription start site) was PCR-amplified and cloned into plasmid pGL4.14 (GE Lifesciences) between KpnI and XhoI. pcDNA GFP FKHR and pcDNA GFP FKHR AAA (constitutively active) were obtained from William Sellers (Addgene #9022, #9023). pcDNA4 myc PGC-1α was obtained from Toren Finkel (Addgene #10974).

    Techniques: Expressing, Mouse Assay, Quantitative RT-PCR, shRNA

    Ectopic March1 expression is sufficient to impair hepatic insulin action in mice. Male 12-week-old C57BL/6 J mice were injected intravenously with AAV 4 weeks before study and fed regular chow. ( a ) Immunoblot analysis of GFP and March1 protein expression after AAV treatment. ( b ) qRT-PCR analysis of hepatic mRNA March1 expression after AAV treatment. ( c ) Plasma glucose and glucose infusion rates during hyperinsulinemic-euglycemic clamp studies. ( d ) Mean steady-state glucose infusion rates required to maintain euglycemia during the clamp. ( e ) EGP during the basal period and during the steady-state period of the clamp. ( f ) EGP suppression. Data are mean±s.e.m. In all panels, * P

    Journal: Nature Communications

    Article Title: MARCH1 regulates insulin sensitivity by controlling cell surface insulin receptor levels

    doi: 10.1038/ncomms12639

    Figure Lengend Snippet: Ectopic March1 expression is sufficient to impair hepatic insulin action in mice. Male 12-week-old C57BL/6 J mice were injected intravenously with AAV 4 weeks before study and fed regular chow. ( a ) Immunoblot analysis of GFP and March1 protein expression after AAV treatment. ( b ) qRT-PCR analysis of hepatic mRNA March1 expression after AAV treatment. ( c ) Plasma glucose and glucose infusion rates during hyperinsulinemic-euglycemic clamp studies. ( d ) Mean steady-state glucose infusion rates required to maintain euglycemia during the clamp. ( e ) EGP during the basal period and during the steady-state period of the clamp. ( f ) EGP suppression. Data are mean±s.e.m. In all panels, * P

    Article Snippet: The human MARCH1 promoter (2.3 kb upstream of the transcription start site) was PCR-amplified and cloned into plasmid pGL4.14 (GE Lifesciences) between KpnI and XhoI. pcDNA GFP FKHR and pcDNA GFP FKHR AAA (constitutively active) were obtained from William Sellers (Addgene #9022, #9023). pcDNA4 myc PGC-1α was obtained from Toren Finkel (Addgene #10974).

    Techniques: Expressing, Mouse Assay, Injection, Quantitative RT-PCR

    Insulin signalling represses MARCH1 transcription through FOXO1. ( a ) qRT-PCR measurement of March1 expression in wild-type mouse WAT after 6 h fasting (basal) or after 2 h of insulin stimulation (clamp). n =8 (basal) and 9 (clamp) mice per group. ( b ) qRT-PCR measurements of MARCH1 expression ( n =3) in the indicated cell lines after acute insulin stimulation at the indicated doses. ( c ) qRT-PCR measurement of FOXO1 mRNA expression ( n =3) in HeLa cells expressing either a NS or FOXO1 shRNA. ( d ) qRT-PCR measurement of MARCH1 mRNA expression ( n =3) in HeLa cells expressing either a NS or FOXO1 shRNA. ( e ) qRT-PCR measurements of MARCH1 expression ( n =3) in HeLa (left) or HepG2 (right) cells expressing empty vector, wild-type FOXO1, constitutively active FOXO1 and/or PGC-1α and treated with insulin as indicated. ( f ) Luciferase reporter assay ( n =3) for wild-type MARCH1 promoter (left) or a mutant MARCH1 promoter with a mutated FOXO1-binding site (right) in HeLa cells expressing empty vector, wild-type FOXO1 , constitutively active FOXO1 ( FOXO1 CA ), and/or PGC-1α and treated with insulin as indicated. ( g ) ChIP measurement of FOXO1 protein enrichment on the MARCH1 or ACTIN promoter with and without insulin treatment ( n =3) as indicated. Data are mean±s.e.m. In all panels, * P

    Journal: Nature Communications

    Article Title: MARCH1 regulates insulin sensitivity by controlling cell surface insulin receptor levels

    doi: 10.1038/ncomms12639

    Figure Lengend Snippet: Insulin signalling represses MARCH1 transcription through FOXO1. ( a ) qRT-PCR measurement of March1 expression in wild-type mouse WAT after 6 h fasting (basal) or after 2 h of insulin stimulation (clamp). n =8 (basal) and 9 (clamp) mice per group. ( b ) qRT-PCR measurements of MARCH1 expression ( n =3) in the indicated cell lines after acute insulin stimulation at the indicated doses. ( c ) qRT-PCR measurement of FOXO1 mRNA expression ( n =3) in HeLa cells expressing either a NS or FOXO1 shRNA. ( d ) qRT-PCR measurement of MARCH1 mRNA expression ( n =3) in HeLa cells expressing either a NS or FOXO1 shRNA. ( e ) qRT-PCR measurements of MARCH1 expression ( n =3) in HeLa (left) or HepG2 (right) cells expressing empty vector, wild-type FOXO1, constitutively active FOXO1 and/or PGC-1α and treated with insulin as indicated. ( f ) Luciferase reporter assay ( n =3) for wild-type MARCH1 promoter (left) or a mutant MARCH1 promoter with a mutated FOXO1-binding site (right) in HeLa cells expressing empty vector, wild-type FOXO1 , constitutively active FOXO1 ( FOXO1 CA ), and/or PGC-1α and treated with insulin as indicated. ( g ) ChIP measurement of FOXO1 protein enrichment on the MARCH1 or ACTIN promoter with and without insulin treatment ( n =3) as indicated. Data are mean±s.e.m. In all panels, * P

    Article Snippet: The human MARCH1 promoter (2.3 kb upstream of the transcription start site) was PCR-amplified and cloned into plasmid pGL4.14 (GE Lifesciences) between KpnI and XhoI. pcDNA GFP FKHR and pcDNA GFP FKHR AAA (constitutively active) were obtained from William Sellers (Addgene #9022, #9023). pcDNA4 myc PGC-1α was obtained from Toren Finkel (Addgene #10974).

    Techniques: Quantitative RT-PCR, Expressing, Mouse Assay, shRNA, Plasmid Preparation, Pyrolysis Gas Chromatography, Luciferase, Reporter Assay, Mutagenesis, Binding Assay, Chromatin Immunoprecipitation, Protein Enrichment

    RBM4-deficient brain exhibits aberrant expression of Dab1 exons 7/8 splice isoforms. (A) Diagram showing alternative splicing of mouse Dab1 exons 6 to 11 and primers used for RT-PCR. (B) Total RNA was isolated from each E13.5 Rbm4a knockout and wild-type (WT) mouse brain. RT-PCR was performed to analyze Dab1 , Rbm4a , Rbm4b , and Gapdh mRNAs. The bar graph represents Dab1 splice forms. *, P > 0.05. (C) RT-PCR of E13.5 brain RNA was performed to analyze E9b/c-lacking or containing Dab1 and Gapdh mRNAs. (D) RT-PCR and immunoblotting (IB) were performed to examine Dab1 , Map2 , and Gapdh mRNAs and RBM4, Tuj1, and GAPDH proteins, respectively, throughout neuronal differentiation of P19 cells. UD, undifferentiated cells; EB, retinoic acid-induced embryonic body; D2, differentiation for 2 days. (E) Total RNA and protein from control-transfected or FLAG-RBM4 vector-transfected P19 cells were analyzed by RT-PCR ( Dab1 and Gapdh ) and immunoblotting (RBM4 and GAPDH). For panels B, D, and E, the percentage of exon 7/8 inclusion was measured as +E7/8 versus total, including +E7/8, +E7, and −E7/8; average and standard deviation were obtained from at least three independent experiments or samples.

    Journal: Molecular and Cellular Biology

    Article Title: RBM4 Modulates Radial Migration via Alternative Splicing of Dab1 during Cortex Development

    doi: 10.1128/MCB.00007-18

    Figure Lengend Snippet: RBM4-deficient brain exhibits aberrant expression of Dab1 exons 7/8 splice isoforms. (A) Diagram showing alternative splicing of mouse Dab1 exons 6 to 11 and primers used for RT-PCR. (B) Total RNA was isolated from each E13.5 Rbm4a knockout and wild-type (WT) mouse brain. RT-PCR was performed to analyze Dab1 , Rbm4a , Rbm4b , and Gapdh mRNAs. The bar graph represents Dab1 splice forms. *, P > 0.05. (C) RT-PCR of E13.5 brain RNA was performed to analyze E9b/c-lacking or containing Dab1 and Gapdh mRNAs. (D) RT-PCR and immunoblotting (IB) were performed to examine Dab1 , Map2 , and Gapdh mRNAs and RBM4, Tuj1, and GAPDH proteins, respectively, throughout neuronal differentiation of P19 cells. UD, undifferentiated cells; EB, retinoic acid-induced embryonic body; D2, differentiation for 2 days. (E) Total RNA and protein from control-transfected or FLAG-RBM4 vector-transfected P19 cells were analyzed by RT-PCR ( Dab1 and Gapdh ) and immunoblotting (RBM4 and GAPDH). For panels B, D, and E, the percentage of exon 7/8 inclusion was measured as +E7/8 versus total, including +E7/8, +E7, and −E7/8; average and standard deviation were obtained from at least three independent experiments or samples.

    Article Snippet: To construct the minigene containing Dab1 exons 6 to 9, the PCR-amplified fragments from mouse genomic DNA were ligated and inserted into pcDNA 3.1 (GE Healthcare), including nucleotides 104679107 to 104680425 (1,319 bp), nucleotides 104681264 to 104682008 (745 bp), and nucleotides 104688005 to 104688732 (728 bp) of chromosome 4 (genome assembly GRCm38.p3; GenBank accession number ).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Knock-Out, Transfection, Plasmid Preparation, Standard Deviation

    RBM4 regulates alternative exon selection of Dab1 . (A) The diagram illustrates the mouse Dab1 minigene and primers used for nested RT-PCR. HEK293 cells were cotransfected with either the empty vector (lanes 1 to 3) or Dab1 minigene (lanes 4 and 5) and either the empty or FLAG-RBM4 expression vector. RT-PCR and immunoblotting were performed to detect the indicated mRNAs ( Dab1 and Gapdh ) and proteins (RBM4 and GAPDH). Relative exon 7/8 inclusion (i.e., +E7/8 versus total; E12.5 was set as 1) was obtained from three independent experiments. CMV, cytomegalovirus; BGH, bovine growth hormone. (B) The diagram illustrates the mutant Dab1 minigenes that contained a mutated 5′ splice site (m5′SS; pink arrowheads) or lacked each of the indicated CU-rich sequences (green arrowheads); the 5′ SS and CU-rich sequences are indicated below the diagram. The positions of the CU-rich sequences are indicated (−, upstream of exon 6 or 7; +, downstream of exon 8). HEK293 cells were transfected with the wild-type or each of the mutant minigenes; Dab1 minigene splicing products and Gapdh were analyzed by RT-PCR. *, either +E7 or −E7 (C) The 5′ splice site sequences of introns 7/8 of mammalian, Gallus gallus (introns 6/7), and Danio rerio Dab1 .

    Journal: Molecular and Cellular Biology

    Article Title: RBM4 Modulates Radial Migration via Alternative Splicing of Dab1 during Cortex Development

    doi: 10.1128/MCB.00007-18

    Figure Lengend Snippet: RBM4 regulates alternative exon selection of Dab1 . (A) The diagram illustrates the mouse Dab1 minigene and primers used for nested RT-PCR. HEK293 cells were cotransfected with either the empty vector (lanes 1 to 3) or Dab1 minigene (lanes 4 and 5) and either the empty or FLAG-RBM4 expression vector. RT-PCR and immunoblotting were performed to detect the indicated mRNAs ( Dab1 and Gapdh ) and proteins (RBM4 and GAPDH). Relative exon 7/8 inclusion (i.e., +E7/8 versus total; E12.5 was set as 1) was obtained from three independent experiments. CMV, cytomegalovirus; BGH, bovine growth hormone. (B) The diagram illustrates the mutant Dab1 minigenes that contained a mutated 5′ splice site (m5′SS; pink arrowheads) or lacked each of the indicated CU-rich sequences (green arrowheads); the 5′ SS and CU-rich sequences are indicated below the diagram. The positions of the CU-rich sequences are indicated (−, upstream of exon 6 or 7; +, downstream of exon 8). HEK293 cells were transfected with the wild-type or each of the mutant minigenes; Dab1 minigene splicing products and Gapdh were analyzed by RT-PCR. *, either +E7 or −E7 (C) The 5′ splice site sequences of introns 7/8 of mammalian, Gallus gallus (introns 6/7), and Danio rerio Dab1 .

    Article Snippet: To construct the minigene containing Dab1 exons 6 to 9, the PCR-amplified fragments from mouse genomic DNA were ligated and inserted into pcDNA 3.1 (GE Healthcare), including nucleotides 104679107 to 104680425 (1,319 bp), nucleotides 104681264 to 104682008 (745 bp), and nucleotides 104688005 to 104688732 (728 bp) of chromosome 4 (genome assembly GRCm38.p3; GenBank accession number ).

    Techniques: Selection, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Expressing, Mutagenesis, Transfection

    RBM4-associated brain transcripts include Dab1 . (A) Flow diagram for the strategy used to identify RBM4-associated transcripts in embryonic mouse brain. Two independent immunoprecipitation experiments of E13.5 brain lysates were performed using control (IgA) or anti-RBM4. Immunoprecipitated RNA was subjected to RNA-Seq. A total of 68 genes were common between the top 500 of each individual batch obtained through similar transcripts and event identifications (ID) (TSS represents alternative 5′ first exon and transcription start site). (B) Gene ontology analysis of the aforementioned 68 RBM4-associated transcripts with respect to molecular function categories. (C) A list of 11 potential RBM4 targets that are involved in neuronal migration. (D) The graph shows the top 500 genes plotted by the ratio of RBM4/IgA (log 10 ) versus rank in two experiments. Dab1 is indicated. (E) As in panel A, each E13.5 brain cell lysate was subjected to immunoprecipitation (IP) using anti-RBM4 or anti-IgA. RT-PCR and immunoblotting (IB) were performed to detect the indicated RNAs and proteins. Lane 1, 2% input.

    Journal: Molecular and Cellular Biology

    Article Title: RBM4 Modulates Radial Migration via Alternative Splicing of Dab1 during Cortex Development

    doi: 10.1128/MCB.00007-18

    Figure Lengend Snippet: RBM4-associated brain transcripts include Dab1 . (A) Flow diagram for the strategy used to identify RBM4-associated transcripts in embryonic mouse brain. Two independent immunoprecipitation experiments of E13.5 brain lysates were performed using control (IgA) or anti-RBM4. Immunoprecipitated RNA was subjected to RNA-Seq. A total of 68 genes were common between the top 500 of each individual batch obtained through similar transcripts and event identifications (ID) (TSS represents alternative 5′ first exon and transcription start site). (B) Gene ontology analysis of the aforementioned 68 RBM4-associated transcripts with respect to molecular function categories. (C) A list of 11 potential RBM4 targets that are involved in neuronal migration. (D) The graph shows the top 500 genes plotted by the ratio of RBM4/IgA (log 10 ) versus rank in two experiments. Dab1 is indicated. (E) As in panel A, each E13.5 brain cell lysate was subjected to immunoprecipitation (IP) using anti-RBM4 or anti-IgA. RT-PCR and immunoblotting (IB) were performed to detect the indicated RNAs and proteins. Lane 1, 2% input.

    Article Snippet: To construct the minigene containing Dab1 exons 6 to 9, the PCR-amplified fragments from mouse genomic DNA were ligated and inserted into pcDNA 3.1 (GE Healthcare), including nucleotides 104679107 to 104680425 (1,319 bp), nucleotides 104681264 to 104682008 (745 bp), and nucleotides 104688005 to 104688732 (728 bp) of chromosome 4 (genome assembly GRCm38.p3; GenBank accession number ).

    Techniques: Flow Cytometry, Immunoprecipitation, RNA Sequencing Assay, Migration, Reverse Transcription Polymerase Chain Reaction

    (A) Effect of ORFV119 on NF-κB mediated gene expression. OFTu cells were infected with OV-IA82, OV-IA82-Δ119, or OV-IA82-RV119 Flag (MOI, 10), and levels of TNFα, TLR2, NF-κB1 and IL36α mRNA assessed by real-time PCR at 2 h p.i. Fold changes are relative to OV-IA82 treatment. Results are the mean values of three independent experiments. (*, P

    Journal: PLoS Pathogens

    Article Title: A parapoxviral virion protein targets the retinoblastoma protein to inhibit NF-κB signaling

    doi: 10.1371/journal.ppat.1006779

    Figure Lengend Snippet: (A) Effect of ORFV119 on NF-κB mediated gene expression. OFTu cells were infected with OV-IA82, OV-IA82-Δ119, or OV-IA82-RV119 Flag (MOI, 10), and levels of TNFα, TLR2, NF-κB1 and IL36α mRNA assessed by real-time PCR at 2 h p.i. Fold changes are relative to OV-IA82 treatment. Results are the mean values of three independent experiments. (*, P

    Article Snippet: Plasmids To construct expression plasmids pORFV119Flag and pORFV119LxG xE-Flag , the ORFV119 or ORFV119 LxG xE coding sequences were PCR-amplified from the OV-IA82 genome and a plasmid containing synthetic ORFV119 LxG xE sequence (Genscript), respectively with primers 119-3xFlag-FW (EcoRI ): 5’-TAAGGCCTCTGAATTCAATGGACTCTCGTAGGCTC GCTCTT-3’; 119-3xFlag-RV (BamHI ): 5’-CAGAATACGTGGATCCTCAATCGCTGTCG CTGTCGCCGAG-3’ and cloned into p3xFlag-CMV-10 vector (pFlag) (Clontech, Mountain View, CA).

    Techniques: Expressing, Infection, Real-time Polymerase Chain Reaction

    BDNF makes cap-independent translation of DSCR1.4 mRNA more actively by increasing DAP5 expression. a , b BDNF treatment on DIV 3 hippocampal neuron increases protein levels of DAP5 and DSCR1.4 but not DSCR1.4 mRNA level. Vehicle (DDW) or 30 μM BDNF were treated for 1 h. a The protein levels were confirmed by Western blot. GAPDH and phosphorylation of ERK were used as a loading control and marker of BDNF activity, respectively. b Endogenous DSCR1.4 mRNA levels were analyzed by qRT-PCR and were normalized to β-actin. The bars represent the mean ± SEM ( n = 3). c Cap-independent translation is essential for DSCR1.4 protein accumulation by BDNF. DIV 3 hippocampal neurons were treated with vehicle (DMSO), 100 μM RAD001(RAD) or 50 mg/ml cycloheximide (CHX) for 3 h followed by BDNF treatment for 1 h. The levels of each protein were confirmed by Western blot. The numbers at the bottom indicate the fold relative to a vehicle. The amount of DSCR1.4 was normalized to GAPDH. d , e BDNF raises cap-independent translation activity of DSCR1.4 mRNA. At 24 h after d pRF hDSCR1.4 5′UTR or e pRF mDSCR1.4 5′UTR vectors were transfected into DIV 2 hippocampal neurons, Vehicle (DDW) and BDNF were treated to the neurons for 1 h. The bars represent the mean ± SEM ( e ; n = 5, F; n = 3). f BDNF increases the interaction between DAP5 and DSCR1.4 5′UTR. In vitro transcribed biotin-DSCR1.4 5′UTR was incubated with extracts of the vehicle (DDW) or 30 μM BDNF-treated DIV 3 mouse hippocampal neurons. DAP5 binding was measured by Western blot. Phospho-ERK was used to confirm the activity of BDNF. GADPH was used as a loading control and negative control. g , h BDNF increases the cap-independent local translation of DSCR1.4 mRNA in axon as well as soma. EGFP and pRF mDSCR1.4 5′ 3′ UTR vectors were co-transfected into DIV 2 mouse hippocampal neurons. At 24 h later, 100 μM anisomycin was treated for 3 h and then 30 μM BDNF was treated for 1 h, followed by 5 μM puromycin treatment for 40 min. To detect newly synthesized FLUC proteins, Puro-PLA assay was conducted. g Representative image obtained from confocal microscopy. h The graph shows relative fluorescence intensity measured by Image J. The bars represent the mean ± SEM (Vehicle; n = 11, Anisomycin; n = 12, BDNF; n = 11, BDNF + Anisomycin; n = 11). Scale bar, 30 μm. Data information: In d , e , h , * P

    Journal: Cell Death & Disease

    Article Title: DAP5 increases axonal outgrowth of hippocampal neurons by enhancing the cap-independent translation of DSCR1.4 mRNA

    doi: 10.1038/s41419-018-1299-x

    Figure Lengend Snippet: BDNF makes cap-independent translation of DSCR1.4 mRNA more actively by increasing DAP5 expression. a , b BDNF treatment on DIV 3 hippocampal neuron increases protein levels of DAP5 and DSCR1.4 but not DSCR1.4 mRNA level. Vehicle (DDW) or 30 μM BDNF were treated for 1 h. a The protein levels were confirmed by Western blot. GAPDH and phosphorylation of ERK were used as a loading control and marker of BDNF activity, respectively. b Endogenous DSCR1.4 mRNA levels were analyzed by qRT-PCR and were normalized to β-actin. The bars represent the mean ± SEM ( n = 3). c Cap-independent translation is essential for DSCR1.4 protein accumulation by BDNF. DIV 3 hippocampal neurons were treated with vehicle (DMSO), 100 μM RAD001(RAD) or 50 mg/ml cycloheximide (CHX) for 3 h followed by BDNF treatment for 1 h. The levels of each protein were confirmed by Western blot. The numbers at the bottom indicate the fold relative to a vehicle. The amount of DSCR1.4 was normalized to GAPDH. d , e BDNF raises cap-independent translation activity of DSCR1.4 mRNA. At 24 h after d pRF hDSCR1.4 5′UTR or e pRF mDSCR1.4 5′UTR vectors were transfected into DIV 2 hippocampal neurons, Vehicle (DDW) and BDNF were treated to the neurons for 1 h. The bars represent the mean ± SEM ( e ; n = 5, F; n = 3). f BDNF increases the interaction between DAP5 and DSCR1.4 5′UTR. In vitro transcribed biotin-DSCR1.4 5′UTR was incubated with extracts of the vehicle (DDW) or 30 μM BDNF-treated DIV 3 mouse hippocampal neurons. DAP5 binding was measured by Western blot. Phospho-ERK was used to confirm the activity of BDNF. GADPH was used as a loading control and negative control. g , h BDNF increases the cap-independent local translation of DSCR1.4 mRNA in axon as well as soma. EGFP and pRF mDSCR1.4 5′ 3′ UTR vectors were co-transfected into DIV 2 mouse hippocampal neurons. At 24 h later, 100 μM anisomycin was treated for 3 h and then 30 μM BDNF was treated for 1 h, followed by 5 μM puromycin treatment for 40 min. To detect newly synthesized FLUC proteins, Puro-PLA assay was conducted. g Representative image obtained from confocal microscopy. h The graph shows relative fluorescence intensity measured by Image J. The bars represent the mean ± SEM (Vehicle; n = 11, Anisomycin; n = 12, BDNF; n = 11, BDNF + Anisomycin; n = 11). Scale bar, 30 μm. Data information: In d , e , h , * P

    Article Snippet: Plasmids and RNA interference Bicistronic pRF DSCR1.4 5′UTR, ΔCMV RF DSCR1.4 5′UTR, and hp pRF DSCR1.4 5′UTR vectors for reporter assay were made by inserting the human DSCR1.4 (Accession no. NM_203418.1) or mouse DSCR1.4 (Accession no. NC_000082.6) 5′UTR. mDSCR1.4 5′UTR and hDSCR1.4 5′UTR were PCR-amplified by cDNA derived from N2A and SHSY5Y cells using primers as follows: hDSCR1.4 5′UTR forward primer 5′-AAGTCGACTGTCTGCCTGCAAGCATGC-3′, reverse primer 5′-GGGCTTGCTTTC TTACAGTGAAAG-3′, mDSCR1.4 5′UTR forward primers 5′- AAGTCGACCGTCTGCCCGAGGGCAT GC-3′, reverse primer 5′-GGGTCTGCTTTTTCACGGGGC-3′ (Macrogen, Seoul, Republic of Korea).

    Techniques: Expressing, Western Blot, Marker, Activity Assay, Quantitative RT-PCR, Transfection, In Vitro, Incubation, Binding Assay, Negative Control, Synthesized, Proximity Ligation Assay, Confocal Microscopy, Fluorescence

    Nova2 (neuro-oncological ventral antigen 2) affects the splicing of Ppar-γ (peroxisome proliferator-activated receptor-gamma) and expression of its target genes in ECs (endothelial cells). ( A ) Several Ppar-γ mRNAs are generated by alternative transcription start sites and alternative splicing (AS) of different exons in the 5′ terminal region (for simplicity, only the first exons A1, A2, and B were schematized). Ppar-γ1 mRNA contains exons A1 and A2, spliced together with exons 1–6, whereas, in Ppar-γ2 , exon B is present instead of exon A1 and A2. The upstream ATG in exon B determinates the inclusion of 28 (mouse) or 30 (human) amino acids at the N-terminal of Ppar-γ2 protein. Boxes = exons; thin lines = introns. A/B = ligand-independent transactivation domain; DBD = DNA binding domain; LBD = ligand-binding domain. Arrows indicate primers used in RT-PCR reactions in C and D. ( B ) A total of 523 out of 1437 (36.4%) of DEGs were identified as Ppar-γ target genes in ChEA_2016 (adjusted p -value

    Journal: Cells

    Article Title: Gene Expression Profiles Controlled by the Alternative Splicing Factor Nova2 in Endothelial Cells

    doi: 10.3390/cells8121498

    Figure Lengend Snippet: Nova2 (neuro-oncological ventral antigen 2) affects the splicing of Ppar-γ (peroxisome proliferator-activated receptor-gamma) and expression of its target genes in ECs (endothelial cells). ( A ) Several Ppar-γ mRNAs are generated by alternative transcription start sites and alternative splicing (AS) of different exons in the 5′ terminal region (for simplicity, only the first exons A1, A2, and B were schematized). Ppar-γ1 mRNA contains exons A1 and A2, spliced together with exons 1–6, whereas, in Ppar-γ2 , exon B is present instead of exon A1 and A2. The upstream ATG in exon B determinates the inclusion of 28 (mouse) or 30 (human) amino acids at the N-terminal of Ppar-γ2 protein. Boxes = exons; thin lines = introns. A/B = ligand-independent transactivation domain; DBD = DNA binding domain; LBD = ligand-binding domain. Arrows indicate primers used in RT-PCR reactions in C and D. ( B ) A total of 523 out of 1437 (36.4%) of DEGs were identified as Ppar-γ target genes in ChEA_2016 (adjusted p -value

    Article Snippet: An aliquot of the RT reaction (1–2 μL) was then PCR-amplified (with GoTaq DNA Polymerase, Promega, Madison, WI, USA), whereas, for quantitative PCR (qPCR), cDNAs were amplified with QuantiTect SYBR Green PCR (QIAGEN) or iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) by using LightCycler 480 (Roche).

    Techniques: Expressing, Generated, Binding Assay, Ligand Binding Assay, Reverse Transcription Polymerase Chain Reaction