Journal: Developmental cell

Article Title: Usp25-Erlin1/2 activity limits cholesterol flux to restrict virus infection.

doi: 10.1016/j.devcel.2023.08.013

Figure Lengend Snippet: Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, FLAG-IFIT5, influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.

Article Snippet: Vero ATCC CCL-81 Oligonucleotides GGCACCAAGGCACATAACGG (sgRNA) This study N/A GAGACTGAAAGATTACCTCA (sgRNA) This study N/A AGCAAAAGCAGG (uni-12) This study N/A AGTAGAAACAAGG (uni-13) This study N/A GACCAATCCTGTCACCTCTGA (M Gene-Forward) This study N/A AGGGCATTTTGGACAAAGCGTCTA (M Gene-Reverse) This study N/A CACCATTGGCAATGAGCGGTTC (b-actin-Forward) This study N/A AGGTCTTTGCGGATGTCCACGT (b-actin-Reverse) This study N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene Addgene plasmid #62988 Usp25-PX459 This study N/A Flag-tagged-Usp25 Xu et al.49 N/A Flag-tagged-Usp25 (C178S) Xu et al.49 N/A Myc-tagged- RIG I te Velthuis et al.50 N/A Flag-tagged-M2 This study N/A 3xFlag IFIT1 Addgene Addgene plasmid #53554 3xFlag IFIT5 Addgene Addgene plasmid #53556 HA-Ubiquitin Addgene Addgene plasmid #18712 HA-Ubiquitin-K6 Addgene Addgene plasmid #22900 HA-Ubiquitin-K11 Addgene Addgene plasmid #22901 HA-Ubiquitin-K27 Addgene Addgene plasmid #22902 HA-Ubiquitin-K29 Addgene Addgene plasmid #22903 HA-Ubiquitin-K33 Addgene Addgene plasmid #17607 HA-Ubiquitin-K48 Addgene Addgene plasmid #17605 HA-Ubiquitin-K63 Addgene Addgene plasmid #17606 mCherry-GFP-LC3 Addgene Addgene plasmid #110060 Myc-tagged-SMURF1 Addgene Addgene plasmid #13676 Flag-tagged-SMURF1 (C699A) Addgene Addgene plasmid #11753 VSV-G Addgene Addgene plasmid #8454 Software and Algorithms Prism 8.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ ImageJ NIH https://imagej.net/ImageJ ZEN confocal software Zeiss https://www.zeiss.com/microscopy/int/ products/microscope-software/zen.html FlowJo Flowjo https://www.flowjo.com/solutions/flowjo/ downloads Legendplex v8.0 Biolegend https://www.biolegend.com/en-us/ legendplex Ingenuity Pathway Analysis software QIAGEN https://digitalinsights.qiagen.com/ products-overview/discovery-insightsportfolio/analysis-and-visualization/ qiagen-ipa/ e3 Developmental Cell 58, 2495–2509.e1–e6, November 20, 2023

Techniques: Infection, Immunoprecipitation, Mass Spectrometry, Isolation, Expressing, FLAG-tag, Western Blot, Control, SDS Page, Autoradiography, Transfection, Mutagenesis, Cell Culture, Quantitation Assay

Journal: Scientific Reports

Article Title: Fundamental parameters of the developing thymic epithelium in the mouse

doi: 10.1038/s41598-018-29460-0

Figure Lengend Snippet: Dynamic changes of TEC densities in the developing thymus. ( a ) Section of a Foxn1 : YFP NLS ; Foxn1 : mCardinal cyt transgenic thymus of a E15.5 mouse; nuclei of TECs are marked with yellow fluorescence, their cytoplasm with red fluorescence. In the left panel, a DAPI stain of nuclei is combined with the yellow nuclear fluorescence; the large cortex and the small medullary region are indicated. In the right panel, DAPI fluorescence is combined with cytoplasmic fluorescence (most clearly recognizable at this magnification for medullary TECs) and nuclei automatically identified by Imaris 8.4.1 software (marked as dots). ( b ) Section of a Foxn1 : YFP NLS ; Foxn1 : mCardinal cyt transgenic thymus of a P10 mouse. Nuclear DAPI and YFP fluorescence signals are shown individually and as a merged image; the right-most panel indicates the software-generated distribution of TEC nuclei. Scale bars, 0.1 mm. ( c ) Density of TEC nuclei in the medullary and cortical regions as a function of age. Each symbol represents a representative section of a single mouse. ( d ) Ratio of medullary and cortical regions as a function of age. Each symbol represents a representative section of a single mouse. In ( c and d ), each symbol indicates the value obtained from a single representative section from an individual thymus. ( e ) Comparative analysis of cortical and medullary TECs. Using flow cytometry, the ratio of Ly51 + UEA1 − /Ly51 − UEA1 + cells was determined as a proxy for cortical and medullary cells. The cTEC/mTEC ratio was determined from histological sections, taking into account the densities of TEC nuclei and the fractions of cortex and medullary regions in the thymi.

Article Snippet: The mCardinal cDNA was amplified from plasmid #51311 (Addgene) with primers 5′-GAG GCGGCCGC GATCCGATGGTGAGCAAGG and 5′-GAG GCGGCCGC TTACTTGTACAGCTCGTCCATG.

Techniques: Transgenic Assay, Fluorescence, Staining, Software, Generated, Flow Cytometry

Journal: International Journal of Molecular Sciences

Article Title: Gene Therapy Approach for Treatment of Obese Agouti Mice

doi: 10.3390/ijms252212144

Figure Lengend Snippet: Schematic representation of plasmid map pAAV-FoxP4, pAAV-PRDM16, and pAAV-FST.

Article Snippet: The mouse PRDM16 gene was amplified from a commercially available plasmid, pcDNA3.1 PRDM16 (Addgene plasmid #15503; RRID: Addgene_15503).

Techniques: Plasmid Preparation

Journal: International Journal of Molecular Sciences

Article Title: Gene Therapy Approach for Treatment of Obese Agouti Mice

doi: 10.3390/ijms252212144

Figure Lengend Snippet: Progression of body weight change relative to weight before AAV administration in agouti mice treated at 12 weeks of age with an intra-WAT injection of empty AAV (Control), AAV-FoxP4, AAV-PRDM16, or AAV-FST vectors. Data are presented as mean ± S.D. values of three mice for each group. * p < 0.1 control group vs. AAV-FoxP4 group, # p < 0.1 control group vs. AAV-PRDM16 group, † p < 0.1 control group vs. AAV-FST group.

Article Snippet: The mouse PRDM16 gene was amplified from a commercially available plasmid, pcDNA3.1 PRDM16 (Addgene plasmid #15503; RRID: Addgene_15503).

Techniques: Injection, Control

Journal: International Journal of Molecular Sciences

Article Title: Gene Therapy Approach for Treatment of Obese Agouti Mice

doi: 10.3390/ijms252212144

Figure Lengend Snippet: The fold changes of the identified lipids between the AAV9-FST, AAV8-FoxP4, and AAV8-PRDM16 groups against the control (empty AAV). Fold change and p -value were calculated in Metaboanalyst 5.0 [ 15 ]. Lipids showing p -value > 0.05 are marked «Ns» (non-significant).

Article Snippet: The mouse PRDM16 gene was amplified from a commercially available plasmid, pcDNA3.1 PRDM16 (Addgene plasmid #15503; RRID: Addgene_15503).

Techniques: Control