pcat control plasmid Search Results


91
Addgene inc ecori afei
Ecori Afei, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/pCAG-Cre+(Plasmid+%2326647)/pm29311338-106-26-32
Average 91 stars, based on 1 article reviews
ecori afei - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

90
Promega pcat3-control reporter plasmid
Pcat3 Control Reporter Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/pcat+basic+plasmid/10__1128_slash_mcb__18__3__1725-80-6-9
Average 90 stars, based on 1 article reviews
pcat3-control reporter plasmid - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega reporter vector
Reporter Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/reporter+vector++pcat/pmc00111549-71-3-8
Average 90 stars, based on 1 article reviews
reporter vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Promega pcat-enhancer
Pcat Enhancer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/pcat+enhancer/pm17151828-33-6-16
Average 90 stars, based on 1 article reviews
pcat-enhancer - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

92
New England Biolabs pcam bsd hsp40 ctrl plasmid
Using single-crossover homologous recombination we successfully integrated a control plasmid (pCAM-BSD <t>HSP40</t> ctrl ) into the HSP40 (PF3D7_1437900) locus. Despite 7 months of continuous culture, integration of a disruption construct (pCAM-BSD HSP40 KO ) was not observed. (A) Genomic DNA isolated from blasticidin-resistant parasites transfected with pCAM-BSD HSP40 ctrl or pCAM-BSD HSP40 KO was subjected to PCR. Two sets of primers detect episomal plasmid in both cases (ctrl: 1081bp, 1133bp and KO: 902bp, 982bp). Integration events are detected by primers (∼1800bp). Integration of the control plasmid is present, while no integration of the KO plasmid is observed. Representative of three independent transfections. (B,C) Genomic DNA isolated from blasticidin-resistant parasites transfected with pCAM-BSD HSP40 ctrl or pCAM-BSD HSP40 KO was subjected to Southern blot analysis. (B) Plasmid and genomic DNA was digested with the restriction enzyme SmlI, transferred to membrane, and probed with a 719bp HSP40 control fragment. The control plasmid (pCAM-BSD HSP40 ctrl ) was successfully integrated into the HSP40 locus in four independent transfections (1-4). (C) Plasmid and genomic DNA was digested with the restriction enzyme HpaII, transferred to membrane, and probed with a 693bp HSP40 KO fragment. Integration of a disruption construct (pCAM-BSD HSP40 KO ) was not observed in two independent transfections (5,6) after 7 months of continuous culture.
Pcam Bsd Hsp40 Ctrl Plasmid, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/SmlI/bio_rxiv__842468-201-6-13
Average 92 stars, based on 1 article reviews
pcam bsd hsp40 ctrl plasmid - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

93
Addgene inc pcag gfpd2
( A ) Relative tbc-7 mRNA levels measured by quantitative real-time PCR in L4 larvae. Data normalized to values for wild-type worms. Two independent reference genes ( pmp-3 and cdc-42 ) were used. Error bars show standard error of the mean (SEM) obtained from n = 3 biological replicates and three technical replicates each. **p<0.001, *p<0.005 (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( B ) Survival of wild-type and mir-1(gk276) animals (incubated on control (L4440) or tbc-7 RNAi bacteria) after exposure to 4 hr of heat stress (35°C) (n = 30). ***p<0.001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( C ) Predicted mir-1 binding site on the 3′UTR of tbc-7 mRNA (green) and seed sequence in mir-1 (blue). Mutated nucleotides in the tbc-7 3′UTR for experiments ( E–F ) are in red. ( D ) Indicated DNA constructs were co-transformed as multi-copy extrachromosomal arrays for experiments in ( E–F ). ( E ) Expression of heterologous reporter transgenes for control unc-54 3′UTR ( gfp ) and wild-type and mutated tbc-7 3′UTR ( mCherry ) constructs in body wall muscle. ( F ) Quantification of gfp and mCherry fluorescence of transgenic animals calculated as CTF/total area of fluorophore (n = 30). ****p<0.0001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( G ) WB of <t>TBC1D15</t> and α-tubulin and ( H ) quantified bands from HeLa cells transfected with scrambled (Scr) or miR-1 mimics (n = 5). Data are mean fluorescence intensities ± SEM. **p<0.01 (Students t-test). ( I ) Predicted miR-1 binding site on the 3′UTR of TBC1D15 mRNA (green) and seed sequence in miR-1 (blue). Mutated nucleotides in the TBC1D15 3′UTR for experiments ( L–M ) are in red. ( J–K ) Quantification of flow cytometry analysis of HeLa cells co-expressing scrambled (Scr) or miR-1 mimic together with ( J ) <t>GFPd2-3′UTR</t> TBC1D15 (n = 4) or ( K ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5). Data are mean fluorescence intensities ± SEM, **p<0.01 (Students t-test).
Pcag Gfpd2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/pCAG-GFPd2+(Plasmid+%2314760)/pmc06914338-236-68-75
Average 93 stars, based on 1 article reviews
pcag gfpd2 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

91
Addgene inc pcag promoter
( A ) Relative tbc-7 mRNA levels measured by quantitative real-time PCR in L4 larvae. Data normalized to values for wild-type worms. Two independent reference genes ( pmp-3 and cdc-42 ) were used. Error bars show standard error of the mean (SEM) obtained from n = 3 biological replicates and three technical replicates each. **p<0.001, *p<0.005 (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( B ) Survival of wild-type and mir-1(gk276) animals (incubated on control (L4440) or tbc-7 RNAi bacteria) after exposure to 4 hr of heat stress (35°C) (n = 30). ***p<0.001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( C ) Predicted mir-1 binding site on the 3′UTR of tbc-7 mRNA (green) and seed sequence in mir-1 (blue). Mutated nucleotides in the tbc-7 3′UTR for experiments ( E–F ) are in red. ( D ) Indicated DNA constructs were co-transformed as multi-copy extrachromosomal arrays for experiments in ( E–F ). ( E ) Expression of heterologous reporter transgenes for control unc-54 3′UTR ( gfp ) and wild-type and mutated tbc-7 3′UTR ( mCherry ) constructs in body wall muscle. ( F ) Quantification of gfp and mCherry fluorescence of transgenic animals calculated as CTF/total area of fluorophore (n = 30). ****p<0.0001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( G ) WB of <t>TBC1D15</t> and α-tubulin and ( H ) quantified bands from HeLa cells transfected with scrambled (Scr) or miR-1 mimics (n = 5). Data are mean fluorescence intensities ± SEM. **p<0.01 (Students t-test). ( I ) Predicted miR-1 binding site on the 3′UTR of TBC1D15 mRNA (green) and seed sequence in miR-1 (blue). Mutated nucleotides in the TBC1D15 3′UTR for experiments ( L–M ) are in red. ( J–K ) Quantification of flow cytometry analysis of HeLa cells co-expressing scrambled (Scr) or miR-1 mimic together with ( J ) <t>GFPd2-3′UTR</t> TBC1D15 (n = 4) or ( K ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5). Data are mean fluorescence intensities ± SEM, **p<0.01 (Students t-test).
Pcag Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/pSQT817+(Plasmid+%2353373)/bio_rxiv__631721-97-17-21
Average 91 stars, based on 1 article reviews
pcag promoter - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

95
Addgene inc pcag gfp
( A ) Relative tbc-7 mRNA levels measured by quantitative real-time PCR in L4 larvae. Data normalized to values for wild-type worms. Two independent reference genes ( pmp-3 and cdc-42 ) were used. Error bars show standard error of the mean (SEM) obtained from n = 3 biological replicates and three technical replicates each. **p<0.001, *p<0.005 (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( B ) Survival of wild-type and mir-1(gk276) animals (incubated on control (L4440) or tbc-7 RNAi bacteria) after exposure to 4 hr of heat stress (35°C) (n = 30). ***p<0.001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( C ) Predicted mir-1 binding site on the 3′UTR of tbc-7 mRNA (green) and seed sequence in mir-1 (blue). Mutated nucleotides in the tbc-7 3′UTR for experiments ( E–F ) are in red. ( D ) Indicated DNA constructs were co-transformed as multi-copy extrachromosomal arrays for experiments in ( E–F ). ( E ) Expression of heterologous reporter transgenes for control unc-54 3′UTR ( gfp ) and wild-type and mutated tbc-7 3′UTR ( mCherry ) constructs in body wall muscle. ( F ) Quantification of gfp and mCherry fluorescence of transgenic animals calculated as CTF/total area of fluorophore (n = 30). ****p<0.0001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( G ) WB of <t>TBC1D15</t> and α-tubulin and ( H ) quantified bands from HeLa cells transfected with scrambled (Scr) or miR-1 mimics (n = 5). Data are mean fluorescence intensities ± SEM. **p<0.01 (Students t-test). ( I ) Predicted miR-1 binding site on the 3′UTR of TBC1D15 mRNA (green) and seed sequence in miR-1 (blue). Mutated nucleotides in the TBC1D15 3′UTR for experiments ( L–M ) are in red. ( J–K ) Quantification of flow cytometry analysis of HeLa cells co-expressing scrambled (Scr) or miR-1 mimic together with ( J ) <t>GFPd2-3′UTR</t> TBC1D15 (n = 4) or ( K ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5). Data are mean fluorescence intensities ± SEM, **p<0.01 (Students t-test).
Pcag Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/pCAG-GFP+(Plasmid+%2311150)/pmc11152136-286-5-9
Average 95 stars, based on 1 article reviews
pcag gfp - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

94
Addgene inc vec pbs 0005 0006 psuper control shrna
( A ) Relative tbc-7 mRNA levels measured by quantitative real-time PCR in L4 larvae. Data normalized to values for wild-type worms. Two independent reference genes ( pmp-3 and cdc-42 ) were used. Error bars show standard error of the mean (SEM) obtained from n = 3 biological replicates and three technical replicates each. **p<0.001, *p<0.005 (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( B ) Survival of wild-type and mir-1(gk276) animals (incubated on control (L4440) or tbc-7 RNAi bacteria) after exposure to 4 hr of heat stress (35°C) (n = 30). ***p<0.001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( C ) Predicted mir-1 binding site on the 3′UTR of tbc-7 mRNA (green) and seed sequence in mir-1 (blue). Mutated nucleotides in the tbc-7 3′UTR for experiments ( E–F ) are in red. ( D ) Indicated DNA constructs were co-transformed as multi-copy extrachromosomal arrays for experiments in ( E–F ). ( E ) Expression of heterologous reporter transgenes for control unc-54 3′UTR ( gfp ) and wild-type and mutated tbc-7 3′UTR ( mCherry ) constructs in body wall muscle. ( F ) Quantification of gfp and mCherry fluorescence of transgenic animals calculated as CTF/total area of fluorophore (n = 30). ****p<0.0001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( G ) WB of <t>TBC1D15</t> and α-tubulin and ( H ) quantified bands from HeLa cells transfected with scrambled (Scr) or miR-1 mimics (n = 5). Data are mean fluorescence intensities ± SEM. **p<0.01 (Students t-test). ( I ) Predicted miR-1 binding site on the 3′UTR of TBC1D15 mRNA (green) and seed sequence in miR-1 (blue). Mutated nucleotides in the TBC1D15 3′UTR for experiments ( L–M ) are in red. ( J–K ) Quantification of flow cytometry analysis of HeLa cells co-expressing scrambled (Scr) or miR-1 mimic together with ( J ) <t>GFPd2-3′UTR</t> TBC1D15 (n = 4) or ( K ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5). Data are mean fluorescence intensities ± SEM, **p<0.01 (Students t-test).
Vec Pbs 0005 0006 Psuper Control Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/pCAG-Cre+(Plasmid+%2313775)/pm32348754-217-118-104
Average 94 stars, based on 1 article reviews
vec pbs 0005 0006 psuper control shrna - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

90
Promega pcat-promoter vectors
( A ) Relative tbc-7 mRNA levels measured by quantitative real-time PCR in L4 larvae. Data normalized to values for wild-type worms. Two independent reference genes ( pmp-3 and cdc-42 ) were used. Error bars show standard error of the mean (SEM) obtained from n = 3 biological replicates and three technical replicates each. **p<0.001, *p<0.005 (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( B ) Survival of wild-type and mir-1(gk276) animals (incubated on control (L4440) or tbc-7 RNAi bacteria) after exposure to 4 hr of heat stress (35°C) (n = 30). ***p<0.001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( C ) Predicted mir-1 binding site on the 3′UTR of tbc-7 mRNA (green) and seed sequence in mir-1 (blue). Mutated nucleotides in the tbc-7 3′UTR for experiments ( E–F ) are in red. ( D ) Indicated DNA constructs were co-transformed as multi-copy extrachromosomal arrays for experiments in ( E–F ). ( E ) Expression of heterologous reporter transgenes for control unc-54 3′UTR ( gfp ) and wild-type and mutated tbc-7 3′UTR ( mCherry ) constructs in body wall muscle. ( F ) Quantification of gfp and mCherry fluorescence of transgenic animals calculated as CTF/total area of fluorophore (n = 30). ****p<0.0001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( G ) WB of <t>TBC1D15</t> and α-tubulin and ( H ) quantified bands from HeLa cells transfected with scrambled (Scr) or miR-1 mimics (n = 5). Data are mean fluorescence intensities ± SEM. **p<0.01 (Students t-test). ( I ) Predicted miR-1 binding site on the 3′UTR of TBC1D15 mRNA (green) and seed sequence in miR-1 (blue). Mutated nucleotides in the TBC1D15 3′UTR for experiments ( L–M ) are in red. ( J–K ) Quantification of flow cytometry analysis of HeLa cells co-expressing scrambled (Scr) or miR-1 mimic together with ( J ) <t>GFPd2-3′UTR</t> TBC1D15 (n = 4) or ( K ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5). Data are mean fluorescence intensities ± SEM, **p<0.01 (Students t-test).
Pcat Promoter Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/pcat+promoter/10__1074_slash_jbc__271__8__4561-67-5-7
Average 90 stars, based on 1 article reviews
pcat-promoter vectors - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

94
OriGene control scrambled sequence scr
Fig. 3. PLGF increases ZEB2 levels in OVC cells. We trans fected the OVCAR3 cells with either a PLGF overexpressing plasmid (PLGF), or a small short hairpin interfering RNA for PLGF (shPLGF). The OVCAR3 cells were transfec ted with a <t>scrambled</t> <t>sequence</t> as a <t>control</t> <t>(scr).</t> (A-B) The PLGF levels by mRNA (A) and by Western blot (B). (C-D) The ZEB2 levels by mRNA (C) and by Western blot (D). * p < 0.05, N = 5.
Control Scrambled Sequence Scr, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/pCas-Scramble/pm26824454-46-18-26
Average 94 stars, based on 1 article reviews
control scrambled sequence scr - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

99
ATCC pca cell lines 22rv1
Generation of XRCC 1 knockout PCa cell lines and their functional validation. ( A and B ) Immunoblot showing the expression of XRCC1 protein in C4-2B (A) and <t>22RV1</t> (B) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-2. Actin was used as a loading control. ( C and D ) Cell growth inhibition assay of the same cells as in panels (A) and (B) with increasing concentrations of MMS. The cells were incubated in the drug-containing media for 1 h, after which the fresh drug-free media was added, and the cells were allowed to grow for 6 days. The data represent the average % survival relative to control cells ± SEM of three biologically independent samples.
Pca Cell Lines 22rv1, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcat+control+plasmid/22Rv1/pmc12015684-68-1-24
Average 99 stars, based on 1 article reviews
pca cell lines 22rv1 - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

Image Search Results


Using single-crossover homologous recombination we successfully integrated a control plasmid (pCAM-BSD HSP40 ctrl ) into the HSP40 (PF3D7_1437900) locus. Despite 7 months of continuous culture, integration of a disruption construct (pCAM-BSD HSP40 KO ) was not observed. (A) Genomic DNA isolated from blasticidin-resistant parasites transfected with pCAM-BSD HSP40 ctrl or pCAM-BSD HSP40 KO was subjected to PCR. Two sets of primers detect episomal plasmid in both cases (ctrl: 1081bp, 1133bp and KO: 902bp, 982bp). Integration events are detected by primers (∼1800bp). Integration of the control plasmid is present, while no integration of the KO plasmid is observed. Representative of three independent transfections. (B,C) Genomic DNA isolated from blasticidin-resistant parasites transfected with pCAM-BSD HSP40 ctrl or pCAM-BSD HSP40 KO was subjected to Southern blot analysis. (B) Plasmid and genomic DNA was digested with the restriction enzyme SmlI, transferred to membrane, and probed with a 719bp HSP40 control fragment. The control plasmid (pCAM-BSD HSP40 ctrl ) was successfully integrated into the HSP40 locus in four independent transfections (1-4). (C) Plasmid and genomic DNA was digested with the restriction enzyme HpaII, transferred to membrane, and probed with a 693bp HSP40 KO fragment. Integration of a disruption construct (pCAM-BSD HSP40 KO ) was not observed in two independent transfections (5,6) after 7 months of continuous culture.

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: Using single-crossover homologous recombination we successfully integrated a control plasmid (pCAM-BSD HSP40 ctrl ) into the HSP40 (PF3D7_1437900) locus. Despite 7 months of continuous culture, integration of a disruption construct (pCAM-BSD HSP40 KO ) was not observed. (A) Genomic DNA isolated from blasticidin-resistant parasites transfected with pCAM-BSD HSP40 ctrl or pCAM-BSD HSP40 KO was subjected to PCR. Two sets of primers detect episomal plasmid in both cases (ctrl: 1081bp, 1133bp and KO: 902bp, 982bp). Integration events are detected by primers (∼1800bp). Integration of the control plasmid is present, while no integration of the KO plasmid is observed. Representative of three independent transfections. (B,C) Genomic DNA isolated from blasticidin-resistant parasites transfected with pCAM-BSD HSP40 ctrl or pCAM-BSD HSP40 KO was subjected to Southern blot analysis. (B) Plasmid and genomic DNA was digested with the restriction enzyme SmlI, transferred to membrane, and probed with a 719bp HSP40 control fragment. The control plasmid (pCAM-BSD HSP40 ctrl ) was successfully integrated into the HSP40 locus in four independent transfections (1-4). (C) Plasmid and genomic DNA was digested with the restriction enzyme HpaII, transferred to membrane, and probed with a 693bp HSP40 KO fragment. Integration of a disruption construct (pCAM-BSD HSP40 KO ) was not observed in two independent transfections (5,6) after 7 months of continuous culture.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Homologous Recombination, Plasmid Preparation, Construct, Isolation, Transfection, Southern Blot

ATPase activity of purified HSP70. (A) Recombinant HSP70 (73 kDa) and HSP40 (48 kDa) were purified from E. coli. Proteins are visualized on SDS gel with Coomassie blue stain (B) The ATPase activities of 45 μg of HSP70 was measured every 12 seconds for 40 minutes. HSP70 had increased ATPase activity in the presence of HSP40 (8.9 μg; green) than alone (blue). HSP40 (gray) and no protein (black) were used as controls, n=4. (C) The slopes of the lines in (B). (D) The rate of ATP turnover increases linearly with increased HSP70 concentration, n=2.

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: ATPase activity of purified HSP70. (A) Recombinant HSP70 (73 kDa) and HSP40 (48 kDa) were purified from E. coli. Proteins are visualized on SDS gel with Coomassie blue stain (B) The ATPase activities of 45 μg of HSP70 was measured every 12 seconds for 40 minutes. HSP70 had increased ATPase activity in the presence of HSP40 (8.9 μg; green) than alone (blue). HSP40 (gray) and no protein (black) were used as controls, n=4. (C) The slopes of the lines in (B). (D) The rate of ATP turnover increases linearly with increased HSP70 concentration, n=2.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Activity Assay, Purification, Recombinant, SDS-Gel, Staining, Concentration Assay

(A) Pre-bleed antisera immunoblot of recombinant protein, RBC lysate, and wildtype P. falciparum lysate. (B) Anti-HSP40 immunoblot of recombinant protein, RBC lysate, and wildtype P. falciparum lysate. A single band is observed at 48 kDa in parasite lysate corresponding to the expected size of HSP40. (A,B) Pre-bleed and Anti-HSP40 were used at 1:5,000. (C) Spectral counts from Hsp40s identified by mass spectrometry after IP of parasite lysate with pre-bleed antisera or anti-HSP40. Fold change is the ratio of the average spectral counts between anti-HSP40 and pre-bleed. HSP40 is the only Hsp40 protein with a robust fold change and protein coverage.

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: (A) Pre-bleed antisera immunoblot of recombinant protein, RBC lysate, and wildtype P. falciparum lysate. (B) Anti-HSP40 immunoblot of recombinant protein, RBC lysate, and wildtype P. falciparum lysate. A single band is observed at 48 kDa in parasite lysate corresponding to the expected size of HSP40. (A,B) Pre-bleed and Anti-HSP40 were used at 1:5,000. (C) Spectral counts from Hsp40s identified by mass spectrometry after IP of parasite lysate with pre-bleed antisera or anti-HSP40. Fold change is the ratio of the average spectral counts between anti-HSP40 and pre-bleed. HSP40 is the only Hsp40 protein with a robust fold change and protein coverage.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Western Blot, Recombinant, Mass Spectrometry

(A) Immunofluorescence confocal microscopy of trophozoite, stained with anti-HSP40 (1:5,000) and Hoechst 33258 nuclear stain. HSP40 appears cytosolic. (B) Electron micrograph of Immunolabeling: primary, rabbit anti-HSP40 (1:250), mouse anti-PDI (1:100); secondary, goat anti-rabbit IgG 18nm colloidal gold, goat anti-mouse 12nm. HSP40 (orange arrowheads) looks cytosolic in the parasites, with some apparent membrane association. A portion of HSP40 co-localizes with PDI, an established ER marker (white arrowheads). Scale, 500 nm.

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: (A) Immunofluorescence confocal microscopy of trophozoite, stained with anti-HSP40 (1:5,000) and Hoechst 33258 nuclear stain. HSP40 appears cytosolic. (B) Electron micrograph of Immunolabeling: primary, rabbit anti-HSP40 (1:250), mouse anti-PDI (1:100); secondary, goat anti-rabbit IgG 18nm colloidal gold, goat anti-mouse 12nm. HSP40 (orange arrowheads) looks cytosolic in the parasites, with some apparent membrane association. A portion of HSP40 co-localizes with PDI, an established ER marker (white arrowheads). Scale, 500 nm.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Immunofluorescence, Confocal Microscopy, Staining, Immunolabeling, Marker

Inhibition of either IPP synthesis or protein farnesylation results in reduced membrane-association of HSP40. (A,B) Representative anti-HSP40 immunoblots of control and FSM (20μM) treated (A) or FTI (10μM) treated (B) P. falciparum total lysate and membrane fractions. (C,D) Quantification of several immunoblots adjusted to loading control. HSP40 is significantly reduced in the membrane fraction after inhibition of IPP synthesis (C) and inhibition of farnesylation (D). Anti-HAD1 and Anti-Exp-2, loading controls for total lysate and membrane fractions, respectively. ** p≤0.01, *** p≤0.001 unpaired t-test with Welch’s correction. (E-H) HSP40 membrane association is reduced after FSM and FTI treatment. Apparent membrane-associated HSP40 (10nm gold particles, arrowheads) is reduced after inhibition of IPP synthesis and farnesylation. The number of membrane-associated HSP40 per micrograph is quantified for control and treated parasites (G,H). A single control cohort was quantified. A decrease in the number of membrane-associated HSP40 particles is observed. * p≤0.05, unpaired t-test with Welch’s correction. Scale, 500 nm.

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: Inhibition of either IPP synthesis or protein farnesylation results in reduced membrane-association of HSP40. (A,B) Representative anti-HSP40 immunoblots of control and FSM (20μM) treated (A) or FTI (10μM) treated (B) P. falciparum total lysate and membrane fractions. (C,D) Quantification of several immunoblots adjusted to loading control. HSP40 is significantly reduced in the membrane fraction after inhibition of IPP synthesis (C) and inhibition of farnesylation (D). Anti-HAD1 and Anti-Exp-2, loading controls for total lysate and membrane fractions, respectively. ** p≤0.01, *** p≤0.001 unpaired t-test with Welch’s correction. (E-H) HSP40 membrane association is reduced after FSM and FTI treatment. Apparent membrane-associated HSP40 (10nm gold particles, arrowheads) is reduced after inhibition of IPP synthesis and farnesylation. The number of membrane-associated HSP40 per micrograph is quantified for control and treated parasites (G,H). A single control cohort was quantified. A decrease in the number of membrane-associated HSP40 particles is observed. * p≤0.05, unpaired t-test with Welch’s correction. Scale, 500 nm.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Inhibition, Western Blot

(A) Representative anti-HSP40 immunoblots of control, BMS (200nM) and GGTI (2μM) treated P. falciparum total lysate and membrane fractions. (B) Quantification of several immunoblots adjusted with loading control. HSP40 is significantly reduced in the membrane fraction after inhibition of farnesylation (BMS) and not geranylgeranylation (GGTI). Anti-HAD1 and Anti-Exp-2, loading controls for total lysate and membrane fractions, respectively. ** p≤0.01, unpaired t-test with Welch’s correction.

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: (A) Representative anti-HSP40 immunoblots of control, BMS (200nM) and GGTI (2μM) treated P. falciparum total lysate and membrane fractions. (B) Quantification of several immunoblots adjusted with loading control. HSP40 is significantly reduced in the membrane fraction after inhibition of farnesylation (BMS) and not geranylgeranylation (GGTI). Anti-HAD1 and Anti-Exp-2, loading controls for total lysate and membrane fractions, respectively. ** p≤0.01, unpaired t-test with Welch’s correction.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Western Blot, Inhibition

Both farnesylation and palmitoylation contribute to HSP40 membrane-association, but only farnesylation is required for thermotolerance. (A) Representative anti-HSP40 immunoblots of control, FTI (10μM), 2BP (100μM), and combination of FTI- and 2BP-treated P. falciparum total lysate and membrane fractions. (B) Quantification of several immunoblots adjusted with loading control. The membrane-associated proportion of HSP40 is significantly reduced upon inhibition of farnesylation (FTI) or palmitoylation (2BP). Inhibition of both farnesylation and palmitoylation (FTI + 2BP) further reduces HSP40 membrane-association, as compared to single inhibitor treatment. Anti-HAD1 and Anti-Exp-2, loading controls for total lysate and membrane fractions, respectively. n = 3; * p≤0.05; ** p≤0.01; *** p≤0.001 unpaired t-test with Welch’s correction. (C-J) Parasites were treated with either FTI (10μM), 2BP (100μM), or both prior to heat (40°C) or cold (25°C) shock. FTI-treated parasite growth is significantly reduced after heat (D) and cold shock (H). Growth in 2BP-treated parasites is unchanged after heat or cold shock. (E,I). Parasites treated with both FTI and 2BP were sensitive to temperature stress (F,J). n = 3; * p≤0.05, ** p≤0.01; *** p≤0.001; **** p≤0.0001, 2-way ANOVA, p-values adjusted for multiple comparisons using Sidak’s multiple comparison test. Abbreviations: control (ctrl), heat shock (hs), cold shock (cs).

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: Both farnesylation and palmitoylation contribute to HSP40 membrane-association, but only farnesylation is required for thermotolerance. (A) Representative anti-HSP40 immunoblots of control, FTI (10μM), 2BP (100μM), and combination of FTI- and 2BP-treated P. falciparum total lysate and membrane fractions. (B) Quantification of several immunoblots adjusted with loading control. The membrane-associated proportion of HSP40 is significantly reduced upon inhibition of farnesylation (FTI) or palmitoylation (2BP). Inhibition of both farnesylation and palmitoylation (FTI + 2BP) further reduces HSP40 membrane-association, as compared to single inhibitor treatment. Anti-HAD1 and Anti-Exp-2, loading controls for total lysate and membrane fractions, respectively. n = 3; * p≤0.05; ** p≤0.01; *** p≤0.001 unpaired t-test with Welch’s correction. (C-J) Parasites were treated with either FTI (10μM), 2BP (100μM), or both prior to heat (40°C) or cold (25°C) shock. FTI-treated parasite growth is significantly reduced after heat (D) and cold shock (H). Growth in 2BP-treated parasites is unchanged after heat or cold shock. (E,I). Parasites treated with both FTI and 2BP were sensitive to temperature stress (F,J). n = 3; * p≤0.05, ** p≤0.01; *** p≤0.001; **** p≤0.0001, 2-way ANOVA, p-values adjusted for multiple comparisons using Sidak’s multiple comparison test. Abbreviations: control (ctrl), heat shock (hs), cold shock (cs).

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Western Blot, Inhibition

(A) Gene ontology analysis reveals three significant HSP40-associated biological processes in asexual P. falciparum. All significant associations are lost in FSM-treated parasites. (B,C) The interactions of HSP40 with Tubulin α chain [Tub α; Q6ZLZ9], Tubulin chain [Tub β; Q7KQL5], Actin-1 [Act1; Q8I4X0], and GAPDH [Q8IKK7] are significantly reduced after inhibition of IPP synthesis and/or farnesylation. Interestingly, interactions with HSP70 [Q8IB24] are significantly increased after farnesylation inhibition, but not after inhibition of IPP synthesis. Protein-protein interactions were determined by mass spectrometry after IP of parasite lysate with anti-HSP40. Results for FSM (5μM)- and FTI (10μM)-treated parasites are compared to untreated controls. n = 3; multiple unpaired t-tests.

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: (A) Gene ontology analysis reveals three significant HSP40-associated biological processes in asexual P. falciparum. All significant associations are lost in FSM-treated parasites. (B,C) The interactions of HSP40 with Tubulin α chain [Tub α; Q6ZLZ9], Tubulin chain [Tub β; Q7KQL5], Actin-1 [Act1; Q8I4X0], and GAPDH [Q8IKK7] are significantly reduced after inhibition of IPP synthesis and/or farnesylation. Interestingly, interactions with HSP70 [Q8IB24] are significantly increased after farnesylation inhibition, but not after inhibition of IPP synthesis. Protein-protein interactions were determined by mass spectrometry after IP of parasite lysate with anti-HSP40. Results for FSM (5μM)- and FTI (10μM)-treated parasites are compared to untreated controls. n = 3; multiple unpaired t-tests.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques: Inhibition, Mass Spectrometry

IPP-dependent HSP40 farnesylation promotes its interaction with Tubulin α chain (Tub α) Tubulin β chain (Tub β), Actin-1 (Act1), and GAPDH. ER-localized farnesyl-HSP40 likely mediates membrane trafficking in the early secretory pathway of the parasite, via direct interaction with these key client proteins.

Journal: bioRxiv

Article Title: Protein prenylation and Hsp40 in thermotolerance of Plasmodium falciparum malaria parasites

doi: 10.1101/842468

Figure Lengend Snippet: IPP-dependent HSP40 farnesylation promotes its interaction with Tubulin α chain (Tub α) Tubulin β chain (Tub β), Actin-1 (Act1), and GAPDH. ER-localized farnesyl-HSP40 likely mediates membrane trafficking in the early secretory pathway of the parasite, via direct interaction with these key client proteins.

Article Snippet: These genomic DNA samples, along with pCAM-BSD-HSP40 ctrl plasmid, were digested with SmlI (New England Biolabs).

Techniques:

( A ) Relative tbc-7 mRNA levels measured by quantitative real-time PCR in L4 larvae. Data normalized to values for wild-type worms. Two independent reference genes ( pmp-3 and cdc-42 ) were used. Error bars show standard error of the mean (SEM) obtained from n = 3 biological replicates and three technical replicates each. **p<0.001, *p<0.005 (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( B ) Survival of wild-type and mir-1(gk276) animals (incubated on control (L4440) or tbc-7 RNAi bacteria) after exposure to 4 hr of heat stress (35°C) (n = 30). ***p<0.001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( C ) Predicted mir-1 binding site on the 3′UTR of tbc-7 mRNA (green) and seed sequence in mir-1 (blue). Mutated nucleotides in the tbc-7 3′UTR for experiments ( E–F ) are in red. ( D ) Indicated DNA constructs were co-transformed as multi-copy extrachromosomal arrays for experiments in ( E–F ). ( E ) Expression of heterologous reporter transgenes for control unc-54 3′UTR ( gfp ) and wild-type and mutated tbc-7 3′UTR ( mCherry ) constructs in body wall muscle. ( F ) Quantification of gfp and mCherry fluorescence of transgenic animals calculated as CTF/total area of fluorophore (n = 30). ****p<0.0001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( G ) WB of TBC1D15 and α-tubulin and ( H ) quantified bands from HeLa cells transfected with scrambled (Scr) or miR-1 mimics (n = 5). Data are mean fluorescence intensities ± SEM. **p<0.01 (Students t-test). ( I ) Predicted miR-1 binding site on the 3′UTR of TBC1D15 mRNA (green) and seed sequence in miR-1 (blue). Mutated nucleotides in the TBC1D15 3′UTR for experiments ( L–M ) are in red. ( J–K ) Quantification of flow cytometry analysis of HeLa cells co-expressing scrambled (Scr) or miR-1 mimic together with ( J ) GFPd2-3′UTR TBC1D15 (n = 4) or ( K ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5). Data are mean fluorescence intensities ± SEM, **p<0.01 (Students t-test).

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) Relative tbc-7 mRNA levels measured by quantitative real-time PCR in L4 larvae. Data normalized to values for wild-type worms. Two independent reference genes ( pmp-3 and cdc-42 ) were used. Error bars show standard error of the mean (SEM) obtained from n = 3 biological replicates and three technical replicates each. **p<0.001, *p<0.005 (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( B ) Survival of wild-type and mir-1(gk276) animals (incubated on control (L4440) or tbc-7 RNAi bacteria) after exposure to 4 hr of heat stress (35°C) (n = 30). ***p<0.001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( C ) Predicted mir-1 binding site on the 3′UTR of tbc-7 mRNA (green) and seed sequence in mir-1 (blue). Mutated nucleotides in the tbc-7 3′UTR for experiments ( E–F ) are in red. ( D ) Indicated DNA constructs were co-transformed as multi-copy extrachromosomal arrays for experiments in ( E–F ). ( E ) Expression of heterologous reporter transgenes for control unc-54 3′UTR ( gfp ) and wild-type and mutated tbc-7 3′UTR ( mCherry ) constructs in body wall muscle. ( F ) Quantification of gfp and mCherry fluorescence of transgenic animals calculated as CTF/total area of fluorophore (n = 30). ****p<0.0001, n.s. not significant (one-way ANOVA analysis, followed by Dunnett’s multiple comparison test). ( G ) WB of TBC1D15 and α-tubulin and ( H ) quantified bands from HeLa cells transfected with scrambled (Scr) or miR-1 mimics (n = 5). Data are mean fluorescence intensities ± SEM. **p<0.01 (Students t-test). ( I ) Predicted miR-1 binding site on the 3′UTR of TBC1D15 mRNA (green) and seed sequence in miR-1 (blue). Mutated nucleotides in the TBC1D15 3′UTR for experiments ( L–M ) are in red. ( J–K ) Quantification of flow cytometry analysis of HeLa cells co-expressing scrambled (Scr) or miR-1 mimic together with ( J ) GFPd2-3′UTR TBC1D15 (n = 4) or ( K ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5). Data are mean fluorescence intensities ± SEM, **p<0.01 (Students t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Real-time Polymerase Chain Reaction, Comparison, Incubation, Control, Bacteria, Binding Assay, Sequencing, Construct, Transformation Assay, Expressing, Fluorescence, Transgenic Assay, Transfection, Flow Cytometry, Mutagenesis

Predicted mir-1 binding sites are found in the 3′UTRs of mRNAs that encode TBC proteins in C. elegans ( tbc-7 ), D. melanogaster (Skywalker) and humans (TBC1D15). This conservation is found in all vertebrate species examined (Targetscan). The mir-1 seed sequences are shown in blue and the predicted tbc-7 -related 3′UTRs are shown in green.

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: Predicted mir-1 binding sites are found in the 3′UTRs of mRNAs that encode TBC proteins in C. elegans ( tbc-7 ), D. melanogaster (Skywalker) and humans (TBC1D15). This conservation is found in all vertebrate species examined (Targetscan). The mir-1 seed sequences are shown in blue and the predicted tbc-7 -related 3′UTRs are shown in green.

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Binding Assay

( A ) Relative TBC1D15 mRNA levels normalized to GAPDH measured by qRT-PCR from HeLa cells expressing scrambled miRNA or miR-1 mimic. Bar graph show fold changes compared to scrambled control ± SEM (n = 3). ( B–C ) Representative fluorescence intensity histograms from flow cytometry analysis of HeLa cells expressing scrambled miRNA (Scr) or miR-1 mimic together with ( B ) GFPd2-3′UTR-TBC1D15 or ( C ) GFPd2-3’UTR-TBC1D15 containing mutated miR-1 target sequence. Quantification of these histogram data is shown in . Wild-type hsa TBC1D15 3’UTR = 5′- CUUUCCUUUUCGAUAACAUUCCU -3′ and mutated hsa TBC1D15 3’UTR = 5′- CUUUCCUUUUCGAUAAAAUUACU -3′.

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) Relative TBC1D15 mRNA levels normalized to GAPDH measured by qRT-PCR from HeLa cells expressing scrambled miRNA or miR-1 mimic. Bar graph show fold changes compared to scrambled control ± SEM (n = 3). ( B–C ) Representative fluorescence intensity histograms from flow cytometry analysis of HeLa cells expressing scrambled miRNA (Scr) or miR-1 mimic together with ( B ) GFPd2-3′UTR-TBC1D15 or ( C ) GFPd2-3’UTR-TBC1D15 containing mutated miR-1 target sequence. Quantification of these histogram data is shown in . Wild-type hsa TBC1D15 3’UTR = 5′- CUUUCCUUUUCGAUAACAUUCCU -3′ and mutated hsa TBC1D15 3’UTR = 5′- CUUUCCUUUUCGAUAAAAUUACU -3′.

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Quantitative RT-PCR, Expressing, Control, Fluorescence, Flow Cytometry, Sequencing

( A ) WB and ( B ) quantification of LC3-II normalised to α-tubulin from HeLa cells expressing Scr or miR-1 mimics +/- bafilomycin. Data are mean fluorescence intensities of bands ± SEM (n = 3–5). **p<0.01, ***p<0.001 (one-way ANOVA with Dunnett’s correction). ( C ) WB and ( D ) quantification of LC3-II normalised to α-tubulin from HeLa cells expressing empty vector (control) or TBC1D15 overexpression vector +/- bafilomycin. Data are mean fluorescence intensities of bands ± SEM normalised to α-tubulin (n = 5). n.s. not significant to the control, ***p<0.001 (two-way ANOVA with Bonferroni correction). ( E ) IF images of HeLa cells stably expressing mRFP-GFP-LC3 and transfected with empty vector (control) or TBC1D15 overexpression vector. Scale bar, 10 μm. ( F ) Quantification of green and red vesicles and ( G ) red/green vesicle ratio from ( E ) ± SEM (n = 3, 12–14 cells per replicate). **p<0.01, ***p<0.001 (Student’s t-test). ( H ) WB and ( I ) quantification of HeLa cells co-transfected with Scr or miR-1 mimic together with empty vector or TBC1D15 overexpression vector +/- bafilomycin. Data are mean fluorescence intensities of LC3-II bands normalized to α-tubulin ± SEM (n = 7). **p<0.01, ***p<0.001 (two-way ANOVA with Bonferroni correction).

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB and ( B ) quantification of LC3-II normalised to α-tubulin from HeLa cells expressing Scr or miR-1 mimics +/- bafilomycin. Data are mean fluorescence intensities of bands ± SEM (n = 3–5). **p<0.01, ***p<0.001 (one-way ANOVA with Dunnett’s correction). ( C ) WB and ( D ) quantification of LC3-II normalised to α-tubulin from HeLa cells expressing empty vector (control) or TBC1D15 overexpression vector +/- bafilomycin. Data are mean fluorescence intensities of bands ± SEM normalised to α-tubulin (n = 5). n.s. not significant to the control, ***p<0.001 (two-way ANOVA with Bonferroni correction). ( E ) IF images of HeLa cells stably expressing mRFP-GFP-LC3 and transfected with empty vector (control) or TBC1D15 overexpression vector. Scale bar, 10 μm. ( F ) Quantification of green and red vesicles and ( G ) red/green vesicle ratio from ( E ) ± SEM (n = 3, 12–14 cells per replicate). **p<0.01, ***p<0.001 (Student’s t-test). ( H ) WB and ( I ) quantification of HeLa cells co-transfected with Scr or miR-1 mimic together with empty vector or TBC1D15 overexpression vector +/- bafilomycin. Data are mean fluorescence intensities of LC3-II bands normalized to α-tubulin ± SEM (n = 7). **p<0.01, ***p<0.001 (two-way ANOVA with Bonferroni correction).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Expressing, Fluorescence, Plasmid Preparation, Control, Over Expression, Stable Transfection, Transfection

( A ) Quantification of the mean number of LC3-positive vesicles per HeLa cell ± SEM expressing scrambled miRNA (Scr) or independent miR-1 mimics immunostained with antibodies against LC3 (n = 3). *p<0.05, **p<0.01 (one-way ANOVA with Dunnett’s correction). ( B ) WB of HeLa cells transfected with Scr siRNA or siRNA against TBC1D15 in the presence or absence of bafilomycin (400 nM for 4 hr). ( C ) Mean fluorescence intensities of LC3-II WB bands ± SEM normalized to α-tubulin (n = 4). *p<0.05, **p<0.01 (Student’s t-test).

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) Quantification of the mean number of LC3-positive vesicles per HeLa cell ± SEM expressing scrambled miRNA (Scr) or independent miR-1 mimics immunostained with antibodies against LC3 (n = 3). *p<0.05, **p<0.01 (one-way ANOVA with Dunnett’s correction). ( B ) WB of HeLa cells transfected with Scr siRNA or siRNA against TBC1D15 in the presence or absence of bafilomycin (400 nM for 4 hr). ( C ) Mean fluorescence intensities of LC3-II WB bands ± SEM normalized to α-tubulin (n = 4). *p<0.05, **p<0.01 (Student’s t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Expressing, Transfection, Fluorescence

( A ) Quantification of the percentage of cells containing HTT-positive aggregates co-expressing scrambled (Scr) or miR-1 mimics with EGFP-HTT Q74 for 48 hr ± SEM (n = 3, 200–400 cells per replicate). ***p<0.001 (one-way ANOVA). ( B ) CRISPR/Cas9 ATG16L1 knockout HeLa cells co-expressing scrambled (Scr) or miR-1 mimics with EGFP-HTT Q74 for 48 hr. Quantification of the percentage of cells containing HTT-positive aggregates ± SEM (n = 3, 200–400 cells per replicate). *p<0.05 (Student’s t-test), n.s. not significant (one-way ANOVA). ( C–E ) Quantification of the percentage of cells containing HTT-positive aggregates in HeLa cells co-expressing EGFP-HTT Q74 with ( C ) scrambled (Scr) or siRNA against TBC1D15 for 48 hr (n = 4, 200–400 cells per replicate), ( D ) empty or TBC1D15 overexpression vector for 24 hr (n = 3, 200–400 cells per replicate), or ( E ) a combination of Scr or miR-1 mimic together with empty or TBC1D15 overexpression vector for 48 hr (n = 6, 200–400 cells per replicate) ± SEM. ( C–D ) *p<0.05, **p<0.005, n.s. not significant (Student’s t-test) or ( E ) (two-way ANOVA with Dunnett’s correction).

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) Quantification of the percentage of cells containing HTT-positive aggregates co-expressing scrambled (Scr) or miR-1 mimics with EGFP-HTT Q74 for 48 hr ± SEM (n = 3, 200–400 cells per replicate). ***p<0.001 (one-way ANOVA). ( B ) CRISPR/Cas9 ATG16L1 knockout HeLa cells co-expressing scrambled (Scr) or miR-1 mimics with EGFP-HTT Q74 for 48 hr. Quantification of the percentage of cells containing HTT-positive aggregates ± SEM (n = 3, 200–400 cells per replicate). *p<0.05 (Student’s t-test), n.s. not significant (one-way ANOVA). ( C–E ) Quantification of the percentage of cells containing HTT-positive aggregates in HeLa cells co-expressing EGFP-HTT Q74 with ( C ) scrambled (Scr) or siRNA against TBC1D15 for 48 hr (n = 4, 200–400 cells per replicate), ( D ) empty or TBC1D15 overexpression vector for 24 hr (n = 3, 200–400 cells per replicate), or ( E ) a combination of Scr or miR-1 mimic together with empty or TBC1D15 overexpression vector for 48 hr (n = 6, 200–400 cells per replicate) ± SEM. ( C–D ) *p<0.05, **p<0.005, n.s. not significant (Student’s t-test) or ( E ) (two-way ANOVA with Dunnett’s correction).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Expressing, CRISPR, Knock-Out, Over Expression, Plasmid Preparation

( A ) WB and ( B ) quantification of Tbc1d15 normalized to α-tubulin of cortical neurons from mice treated with recombinant mouse IFN-β (100 U/ml) for 1–24 hr (n = 4). Data are mean fluorescence intensities of bands ± SEM. n.s. not significant to the control, *p < 0.05, **p < 0.01, ***p < 0.001 (one-way ANOVA). ( C ) RT-PCR of miR-1a-3p normalized to miR-191 from mouse cortical neurons treated with recombinant mouse IFN-β (100 U/ml) for 24 hr (n = 3). **p < 0.01 (Student’s t-test). ( D–E ) Flow cytometry analysis of HeLa cells expressing ( D ) GFPd2-3′UTR TBC1D15 (n = 4) or ( E ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5) treated with recombinant human IFN-β (1000 U/ml) for 6 or 24 hr. Data are presented as fluorescence intensity histograms and bar graphs showing mean fluorescence intensities ± SEM. *p<0.05, ***p<0.0001 (one-way ANOVA). ( F ) Quantification of HTT Q74 aggregates in HeLa cells expressing EGFP-HTT Q74 treated with recombinant human IFN-β (1000 U/ml) for 24 hr. Graph shows percentage of cells containing EGFP-HTT Q74 -positive aggregates (n = 4, 400 cells per replicate) ± SEM. **p<0.01 (Student’s t-test). ( G ) Quantification of HTT Q74 aggregates in HeLa cells expressing GFP-Off-control or GFP-Off-miR-1 (miR-1 hairpin inhibitor) with EGFP-HTT Q74 and treated with recombinant human IFN-β (1000 U/ml) for 48 hr. Graph represents percentage of cells containing EGFP-HTT Q74 -positive aggregates (n = 5, 400 cells per replicate) ± SEM. ***p<0.001, ****p<0.0001 (two-way ANOVA with Bonferroni correction). ( H ) WB of LC3, GFP and α-tubulin and ( I ) quantification of LC3-II normalized to α-tubulin from HeLa cells stably expressing GFP-Off-Control and GFP-Off-miR-1 treated with recombinant human IFN-β (1000 U/ml) for 6 hr, bafilomycin (400 mM) for 4 hr or in combination (n = 4) ± SEM. *p<0.05, **p<0.01, n.s. not significant (Student’s t-test).

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB and ( B ) quantification of Tbc1d15 normalized to α-tubulin of cortical neurons from mice treated with recombinant mouse IFN-β (100 U/ml) for 1–24 hr (n = 4). Data are mean fluorescence intensities of bands ± SEM. n.s. not significant to the control, *p < 0.05, **p < 0.01, ***p < 0.001 (one-way ANOVA). ( C ) RT-PCR of miR-1a-3p normalized to miR-191 from mouse cortical neurons treated with recombinant mouse IFN-β (100 U/ml) for 24 hr (n = 3). **p < 0.01 (Student’s t-test). ( D–E ) Flow cytometry analysis of HeLa cells expressing ( D ) GFPd2-3′UTR TBC1D15 (n = 4) or ( E ) mutated GFPd2-3′UTR TBC1D15 mutant (n = 5) treated with recombinant human IFN-β (1000 U/ml) for 6 or 24 hr. Data are presented as fluorescence intensity histograms and bar graphs showing mean fluorescence intensities ± SEM. *p<0.05, ***p<0.0001 (one-way ANOVA). ( F ) Quantification of HTT Q74 aggregates in HeLa cells expressing EGFP-HTT Q74 treated with recombinant human IFN-β (1000 U/ml) for 24 hr. Graph shows percentage of cells containing EGFP-HTT Q74 -positive aggregates (n = 4, 400 cells per replicate) ± SEM. **p<0.01 (Student’s t-test). ( G ) Quantification of HTT Q74 aggregates in HeLa cells expressing GFP-Off-control or GFP-Off-miR-1 (miR-1 hairpin inhibitor) with EGFP-HTT Q74 and treated with recombinant human IFN-β (1000 U/ml) for 48 hr. Graph represents percentage of cells containing EGFP-HTT Q74 -positive aggregates (n = 5, 400 cells per replicate) ± SEM. ***p<0.001, ****p<0.0001 (two-way ANOVA with Bonferroni correction). ( H ) WB of LC3, GFP and α-tubulin and ( I ) quantification of LC3-II normalized to α-tubulin from HeLa cells stably expressing GFP-Off-Control and GFP-Off-miR-1 treated with recombinant human IFN-β (1000 U/ml) for 6 hr, bafilomycin (400 mM) for 4 hr or in combination (n = 4) ± SEM. *p<0.05, **p<0.01, n.s. not significant (Student’s t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Recombinant, Fluorescence, Control, Reverse Transcription Polymerase Chain Reaction, Flow Cytometry, Expressing, Mutagenesis, Stable Transfection

( A ) WB and ( B ) quantification of Tbc1d15 (normalized to vinculin) in the brain of wild-type ( Ifnb +/+ ) and Ifnb –/– 3 month old male mice (n = 4). Data are mean fluorescence intensities of bands ± SEM. **p < 0.01 (Student’s t-test).

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB and ( B ) quantification of Tbc1d15 (normalized to vinculin) in the brain of wild-type ( Ifnb +/+ ) and Ifnb –/– 3 month old male mice (n = 4). Data are mean fluorescence intensities of bands ± SEM. **p < 0.01 (Student’s t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Fluorescence

( A ) RT-PCR of miR-1–3 p normalized to miR-191 from HeLa cells treated with recombinant human IFN-β (1000 U/ml) for 6 hr (n = 3). **p < 0.01 (Student’s t-test). ( B ) WB and ( C ) quantification of TBC1D15 bands normalised to vinculin from HeLa cells treated with recombinant human IFN-β for 6 or 24 hr (n = 4). Data are mean fluorescence intensities ± SEM. *p < 0.05, **p < 0.01 (one-way ANOVA).

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) RT-PCR of miR-1–3 p normalized to miR-191 from HeLa cells treated with recombinant human IFN-β (1000 U/ml) for 6 hr (n = 3). **p < 0.01 (Student’s t-test). ( B ) WB and ( C ) quantification of TBC1D15 bands normalised to vinculin from HeLa cells treated with recombinant human IFN-β for 6 or 24 hr (n = 4). Data are mean fluorescence intensities ± SEM. *p < 0.05, **p < 0.01 (one-way ANOVA).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Reverse Transcription Polymerase Chain Reaction, Recombinant, Fluorescence

( A ) WB of TBC1D15, LC3 and α-tubulin in HeLa cells expressing empty or TBC1D15 overexpression vector, treated with recombinant human IFN-β (1000 U/ml) for 6 hr, bafilomycin (400 mM) for 4 hr, or a combination of both. ( B ) Quantification of mean fluorescence intensities of LC3-II bands from ( A ) (n = 4) ± SEM. *p < 0.05, **p < 0.01 ***p < 0.001 (Student’s t-test). ( C ) HeLa cells co-expressing EGFP-HTT Q74 with either empty or TBC1D15 overexpression vector with or without recombinant human IFN-β treatment (1000 U/ml) for 24 hr. Graph represents percentage of cells containing EGFP-HTT Q74 -positive aggregates ± SEM. *p < 0.05, **p < 0.01 ***p < 0.001 (Student’s t-test). ( D ) Neuronally differentiated N2A cells with non-targeting control-1 (NTC1) or Ifnb CRISPR/Cas9 knockout co-expressing EGFP-HTT Q74 . Graph represents percentage of cells containing EGFP-HTT Q74 -positive aggregates (n = 3) ± SEM. *p<0.01, **p<0.001 (Student’s t-test).

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB of TBC1D15, LC3 and α-tubulin in HeLa cells expressing empty or TBC1D15 overexpression vector, treated with recombinant human IFN-β (1000 U/ml) for 6 hr, bafilomycin (400 mM) for 4 hr, or a combination of both. ( B ) Quantification of mean fluorescence intensities of LC3-II bands from ( A ) (n = 4) ± SEM. *p < 0.05, **p < 0.01 ***p < 0.001 (Student’s t-test). ( C ) HeLa cells co-expressing EGFP-HTT Q74 with either empty or TBC1D15 overexpression vector with or without recombinant human IFN-β treatment (1000 U/ml) for 24 hr. Graph represents percentage of cells containing EGFP-HTT Q74 -positive aggregates ± SEM. *p < 0.05, **p < 0.01 ***p < 0.001 (Student’s t-test). ( D ) Neuronally differentiated N2A cells with non-targeting control-1 (NTC1) or Ifnb CRISPR/Cas9 knockout co-expressing EGFP-HTT Q74 . Graph represents percentage of cells containing EGFP-HTT Q74 -positive aggregates (n = 3) ± SEM. *p<0.01, **p<0.001 (Student’s t-test).

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Expressing, Over Expression, Plasmid Preparation, Recombinant, Fluorescence, Control, CRISPR, Knock-Out

( A ) WB and quantification of LC3-II from HeLa cells transfected with scrambled siRNA or siRNA against Rab7 (Rab7Δ) +/- bafilomycin (4 hr, 400 nM). Data are mean fluorescence intensities of bands ± SEM normalised to α-tubulin (n = 3). *p<0.05, ***p<0.001 (two-way ANOVA). ( B ) WB and quantification of LC3-II normalised to α-tubulin from HeLa cells co-expressing pcDNA3.1 and EGFP, or TBC1D15 with either EGFP, pIRESneo-myc--Rab7 wt , EGFP-Rab7 Q67L , or EGFP-Rab7 T22N for 24 hr before treatment with bafilomycin (4 hr, 400 nM). Data are mean fluorescence intensities of bands ± SEM normalised to α-tubulin (n = 6). *p<0.05, **p<0.01, ***p<0.001 (two-way ANOVA). ( C ) Immunofluorescence (IF) images of HeLa cells co-expressing TBC1D15 with pIRESneo-myc-Rab7 wt , EGFP-Rab7 Q67L or EGFP-Rab7 T22N stained with antibodies against LC3 and TBC1D15. Scale bars, 10 μm. ( D ) WB showing immunoprecipitation (IP) of GTP-bound (active) Rab7 from HeLa expressing pcDNA3.1 or TBC1D15. Data are mean fluorescence intensities of GTP-bound Rab7 (IP) normalized to the endogenous level of Rab7 (cell lysate) ± SEM (n = 3). **p<0.01 (Student’s t-test). (E)IF of HeLa cells expressing empty vector or TBC1D15 stained with antibodies against GTP-bound Rab7, TBC1D15 and DAPI. Scale bar, 10 μm.

Journal: eLife

Article Title: Interferon-β-induced miR-1 alleviates toxic protein accumulation by controlling autophagy

doi: 10.7554/eLife.49930

Figure Lengend Snippet: ( A ) WB and quantification of LC3-II from HeLa cells transfected with scrambled siRNA or siRNA against Rab7 (Rab7Δ) +/- bafilomycin (4 hr, 400 nM). Data are mean fluorescence intensities of bands ± SEM normalised to α-tubulin (n = 3). *p<0.05, ***p<0.001 (two-way ANOVA). ( B ) WB and quantification of LC3-II normalised to α-tubulin from HeLa cells co-expressing pcDNA3.1 and EGFP, or TBC1D15 with either EGFP, pIRESneo-myc--Rab7 wt , EGFP-Rab7 Q67L , or EGFP-Rab7 T22N for 24 hr before treatment with bafilomycin (4 hr, 400 nM). Data are mean fluorescence intensities of bands ± SEM normalised to α-tubulin (n = 6). *p<0.05, **p<0.01, ***p<0.001 (two-way ANOVA). ( C ) Immunofluorescence (IF) images of HeLa cells co-expressing TBC1D15 with pIRESneo-myc-Rab7 wt , EGFP-Rab7 Q67L or EGFP-Rab7 T22N stained with antibodies against LC3 and TBC1D15. Scale bars, 10 μm. ( D ) WB showing immunoprecipitation (IP) of GTP-bound (active) Rab7 from HeLa expressing pcDNA3.1 or TBC1D15. Data are mean fluorescence intensities of GTP-bound Rab7 (IP) normalized to the endogenous level of Rab7 (cell lysate) ± SEM (n = 3). **p<0.01 (Student’s t-test). (E)IF of HeLa cells expressing empty vector or TBC1D15 stained with antibodies against GTP-bound Rab7, TBC1D15 and DAPI. Scale bar, 10 μm.

Article Snippet: The following plasmids were used: miRIDIAN microRNA Human hsa-miR-1–3 p – mimics (Dharmacon; cat. no. C-300585-05-0005, C-300586-05-0005); Lentivector hsa-miR-1–3 p inhibitor and control in pLenti-III-miR-Off vector from abmgood (cat. no. mh30019 and m007); mRFP-GFP-LC3 was a kind gift from Tamotsu Yoshimori; pEF6-myc-TBC1D15 a kind gift from Aimee Edinger (Addgene plasmid# 79148; http://n2t.net/addgene :79148; RRID: Addgene 79148); pEGFP-C1 (Clontech); EGFP-HTT Q74 (vector backbone pEGFP-C1; HTT exon 1) ( ); pCAG-GFPd2 a gift from Connie Cepko lab (Addgene plasmid #14760), pCAG-GFPd2-3′UTR-TBC1D15, pCAG-GFPd2-3′UTR-TBC1D15 mutant , pIRESneomyc-Rab7 wt , pEGFP-C1-Rab7 Q67L , pEGFP-C1-Rab7 T22N .

Techniques: Transfection, Fluorescence, Expressing, Immunofluorescence, Staining, Immunoprecipitation, Plasmid Preparation

Fig. 3. PLGF increases ZEB2 levels in OVC cells. We trans fected the OVCAR3 cells with either a PLGF overexpressing plasmid (PLGF), or a small short hairpin interfering RNA for PLGF (shPLGF). The OVCAR3 cells were transfec ted with a scrambled sequence as a control (scr). (A-B) The PLGF levels by mRNA (A) and by Western blot (B). (C-D) The ZEB2 levels by mRNA (C) and by Western blot (D). * p < 0.05, N = 5.

Journal: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology

Article Title: Placental Growth Factor Promotes Ovarian Cancer Cell Invasion via ZEB2.

doi: 10.1159/000438635

Figure Lengend Snippet: Fig. 3. PLGF increases ZEB2 levels in OVC cells. We trans fected the OVCAR3 cells with either a PLGF overexpressing plasmid (PLGF), or a small short hairpin interfering RNA for PLGF (shPLGF). The OVCAR3 cells were transfec ted with a scrambled sequence as a control (scr). (A-B) The PLGF levels by mRNA (A) and by Western blot (B). (C-D) The ZEB2 levels by mRNA (C) and by Western blot (D). * p < 0.05, N = 5.

Article Snippet: The plasmids that express PLGF, or ZEB2, or short hairpin interfering RNA for PLGF (shPLGF), or shZEB2, or control scrambled sequence (scr), were all purchased from Origene (Beijing, China).

Techniques: Plasmid Preparation, Sequencing, Control, Western Blot

Generation of XRCC 1 knockout PCa cell lines and their functional validation. ( A and B ) Immunoblot showing the expression of XRCC1 protein in C4-2B (A) and 22RV1 (B) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-2. Actin was used as a loading control. ( C and D ) Cell growth inhibition assay of the same cells as in panels (A) and (B) with increasing concentrations of MMS. The cells were incubated in the drug-containing media for 1 h, after which the fresh drug-free media was added, and the cells were allowed to grow for 6 days. The data represent the average % survival relative to control cells ± SEM of three biologically independent samples.

Journal: NAR Cancer

Article Title: PARP inhibitor response is enhanced in prostate cancer when XRCC1 expression is reduced

doi: 10.1093/narcan/zcaf015

Figure Lengend Snippet: Generation of XRCC 1 knockout PCa cell lines and their functional validation. ( A and B ) Immunoblot showing the expression of XRCC1 protein in C4-2B (A) and 22RV1 (B) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-2. Actin was used as a loading control. ( C and D ) Cell growth inhibition assay of the same cells as in panels (A) and (B) with increasing concentrations of MMS. The cells were incubated in the drug-containing media for 1 h, after which the fresh drug-free media was added, and the cells were allowed to grow for 6 days. The data represent the average % survival relative to control cells ± SEM of three biologically independent samples.

Article Snippet: The PCa cell lines 22RV1, C4-2B, LNCaP, PC3, MDA-PCA-2B, and the human embryonic kidney cell line HEK293T were obtained from American Type Cell Culture (ATCC).

Techniques: Knock-Out, Functional Assay, Biomarker Discovery, Western Blot, Expressing, Plasmid Preparation, Control, Growth Inhibition Assay, Incubation

XRCC1 depletion enhanced the sensitivity of PCa cells to PARPi. ( A and B ) Cell growth inhibition assay for C4-2B (A) and 22RV1 (B) vector control cells, XRCC1- KO-C1, and XRCC1- KO-C2 with increasing concentrations of PARPi: olaparib (upper), rucaparib (middle), and talazoparib (lower). The cells were incubated in the drug-containing media for 6 days. ( C and D ) Immunoblot showing the expression of XRCC1 protein in C4-2B (C) and 22RV1 (D) vector control, XRCC1- KO C-1, XRCC1- KO C-1 + XRCC1 , XRCC1- KO C-2, and XRCC1- KO C-2 + XRCC1 cells. Actin was used as a loading control. ( E and F ) The survival percentage of the same cells was calculated after treatment with 0.25 μM (for C4-2B) and 2.5 μM (for 22RV1) olaparib (upper), 0.5 μM rucaparib (middle), and 0.5 nM talazoparib (lower) for 6 days. The data represents the average % survival relative to the control ± SEM of three biologically independent samples. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

Journal: NAR Cancer

Article Title: PARP inhibitor response is enhanced in prostate cancer when XRCC1 expression is reduced

doi: 10.1093/narcan/zcaf015

Figure Lengend Snippet: XRCC1 depletion enhanced the sensitivity of PCa cells to PARPi. ( A and B ) Cell growth inhibition assay for C4-2B (A) and 22RV1 (B) vector control cells, XRCC1- KO-C1, and XRCC1- KO-C2 with increasing concentrations of PARPi: olaparib (upper), rucaparib (middle), and talazoparib (lower). The cells were incubated in the drug-containing media for 6 days. ( C and D ) Immunoblot showing the expression of XRCC1 protein in C4-2B (C) and 22RV1 (D) vector control, XRCC1- KO C-1, XRCC1- KO C-1 + XRCC1 , XRCC1- KO C-2, and XRCC1- KO C-2 + XRCC1 cells. Actin was used as a loading control. ( E and F ) The survival percentage of the same cells was calculated after treatment with 0.25 μM (for C4-2B) and 2.5 μM (for 22RV1) olaparib (upper), 0.5 μM rucaparib (middle), and 0.5 nM talazoparib (lower) for 6 days. The data represents the average % survival relative to the control ± SEM of three biologically independent samples. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

Article Snippet: The PCa cell lines 22RV1, C4-2B, LNCaP, PC3, MDA-PCA-2B, and the human embryonic kidney cell line HEK293T were obtained from American Type Cell Culture (ATCC).

Techniques: Growth Inhibition Assay, Plasmid Preparation, Control, Incubation, Western Blot, Expressing

IC 50 values of PARPi in the mCRPC cell lines with XRCC1 depletion

Journal: NAR Cancer

Article Title: PARP inhibitor response is enhanced in prostate cancer when XRCC1 expression is reduced

doi: 10.1093/narcan/zcaf015

Figure Lengend Snippet: IC 50 values of PARPi in the mCRPC cell lines with XRCC1 depletion

Article Snippet: The PCa cell lines 22RV1, C4-2B, LNCaP, PC3, MDA-PCA-2B, and the human embryonic kidney cell line HEK293T were obtained from American Type Cell Culture (ATCC).

Techniques: Plasmid Preparation

XRCC1 knockout increased PARPi-induced DNA damage and damage response signaling in PCa cells. ( A and B ) Representative microscopy images of γ-H2AX foci positive C4-2B (A) and 22RV1 (B) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-1 + XRCC1 following 48 h treatment with PARPi. 0.25 μM (for C4-2B) and 2.5 μM (for 22RV1) olaparib, 0.5 μM rucaparib, and 0.5 nM talazoparib was used to dose the cells. The nucleus was visualized by Hoechst 33 342. Scale bar: 50 μm. ( C and D ) Quantification of percent γH2AX foci positive cells in the same cells as in panels (A) and (B). ( E and F ) Immunoblots (upper) and quantification (lower) show the expression of phosphorylated and total level of DDR signaling proteins after 48 h treatment with 0.5 μM rucaparib only. Actin was used as a loading control. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

Journal: NAR Cancer

Article Title: PARP inhibitor response is enhanced in prostate cancer when XRCC1 expression is reduced

doi: 10.1093/narcan/zcaf015

Figure Lengend Snippet: XRCC1 knockout increased PARPi-induced DNA damage and damage response signaling in PCa cells. ( A and B ) Representative microscopy images of γ-H2AX foci positive C4-2B (A) and 22RV1 (B) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-1 + XRCC1 following 48 h treatment with PARPi. 0.25 μM (for C4-2B) and 2.5 μM (for 22RV1) olaparib, 0.5 μM rucaparib, and 0.5 nM talazoparib was used to dose the cells. The nucleus was visualized by Hoechst 33 342. Scale bar: 50 μm. ( C and D ) Quantification of percent γH2AX foci positive cells in the same cells as in panels (A) and (B). ( E and F ) Immunoblots (upper) and quantification (lower) show the expression of phosphorylated and total level of DDR signaling proteins after 48 h treatment with 0.5 μM rucaparib only. Actin was used as a loading control. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

Article Snippet: The PCa cell lines 22RV1, C4-2B, LNCaP, PC3, MDA-PCA-2B, and the human embryonic kidney cell line HEK293T were obtained from American Type Cell Culture (ATCC).

Techniques: Knock-Out, Microscopy, Plasmid Preparation, Control, Western Blot, Expressing

XRCC1 knockout increased PARPi-induced chromatin-associated PARP1 in PCa cells. ( A and B ) Immunoblots (left) and quantification (right) show the expression of PARP1 in soluble and chromatin fractions of C4-2B (A) and 22RV1 (B) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-1 + XRCC1 following 24 h treatment with rucaparib only. α-Tubulin and H3 were used as a loading control for soluble and chromatin fractions, respectively. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: ** P < 0.01 and *** P < 0.001.

Journal: NAR Cancer

Article Title: PARP inhibitor response is enhanced in prostate cancer when XRCC1 expression is reduced

doi: 10.1093/narcan/zcaf015

Figure Lengend Snippet: XRCC1 knockout increased PARPi-induced chromatin-associated PARP1 in PCa cells. ( A and B ) Immunoblots (left) and quantification (right) show the expression of PARP1 in soluble and chromatin fractions of C4-2B (A) and 22RV1 (B) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-1 + XRCC1 following 24 h treatment with rucaparib only. α-Tubulin and H3 were used as a loading control for soluble and chromatin fractions, respectively. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: ** P < 0.01 and *** P < 0.001.

Article Snippet: The PCa cell lines 22RV1, C4-2B, LNCaP, PC3, MDA-PCA-2B, and the human embryonic kidney cell line HEK293T were obtained from American Type Cell Culture (ATCC).

Techniques: Knock-Out, Western Blot, Expressing, Plasmid Preparation, Control

XRCC1 depletion enhanced PARPi-induced cell cycle arrest. ( A and B ) Representative cell cycle profiles of C4-2B (A) and 22RV1 (B) vector control cells and XRCC1- KO C-1 following 48 h treatment with 0.5 μM rucaparib using PI DNA staining-based flow cytometry. ( C and D ) Percent distribution of cells in G1, S, and G2/M phase of the cell cycle. ( E and F ) Immunoblots (left) and quantification (right) show the expression of cell cycle arrest-related proteins in C4-2B (E) and 22RV1 (F) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-1 + XRCC1 after 48 h treatment with 0.5 μM rucaparib. Actin was used as a loading control. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: * P < 0.05, ** P < 0.01, and *** P < 0.001.

Journal: NAR Cancer

Article Title: PARP inhibitor response is enhanced in prostate cancer when XRCC1 expression is reduced

doi: 10.1093/narcan/zcaf015

Figure Lengend Snippet: XRCC1 depletion enhanced PARPi-induced cell cycle arrest. ( A and B ) Representative cell cycle profiles of C4-2B (A) and 22RV1 (B) vector control cells and XRCC1- KO C-1 following 48 h treatment with 0.5 μM rucaparib using PI DNA staining-based flow cytometry. ( C and D ) Percent distribution of cells in G1, S, and G2/M phase of the cell cycle. ( E and F ) Immunoblots (left) and quantification (right) show the expression of cell cycle arrest-related proteins in C4-2B (E) and 22RV1 (F) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-1 + XRCC1 after 48 h treatment with 0.5 μM rucaparib. Actin was used as a loading control. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: * P < 0.05, ** P < 0.01, and *** P < 0.001.

Article Snippet: The PCa cell lines 22RV1, C4-2B, LNCaP, PC3, MDA-PCA-2B, and the human embryonic kidney cell line HEK293T were obtained from American Type Cell Culture (ATCC).

Techniques: Plasmid Preparation, Control, Staining, Flow Cytometry, Western Blot, Expressing

XRCC1 depletion enhanced PARPi-induced apoptosis. ( A and B ) Representative apoptosis profiles of C4-2B (A) and 22RV1 (B) vector control cells and XRCC1- KO C-1 following 48 h treatment with 0.5 μM rucaparib using annexin V-PI dual staining-based flow cytometry. ( C and D ) The percent apoptotic population is indicated. ( E and F ) Immunoblots (left) and quantification (right) show the expression of cleaved and total PARP-1 in C4-2B (E) and 22RV1 (F) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-1 + XRCC1 after 48 h treatment with 0.5 μM rucaparib. Actin was used as a loading control. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

Journal: NAR Cancer

Article Title: PARP inhibitor response is enhanced in prostate cancer when XRCC1 expression is reduced

doi: 10.1093/narcan/zcaf015

Figure Lengend Snippet: XRCC1 depletion enhanced PARPi-induced apoptosis. ( A and B ) Representative apoptosis profiles of C4-2B (A) and 22RV1 (B) vector control cells and XRCC1- KO C-1 following 48 h treatment with 0.5 μM rucaparib using annexin V-PI dual staining-based flow cytometry. ( C and D ) The percent apoptotic population is indicated. ( E and F ) Immunoblots (left) and quantification (right) show the expression of cleaved and total PARP-1 in C4-2B (E) and 22RV1 (F) vector control cells, XRCC1- KO C-1, and XRCC1- KO C-1 + XRCC1 after 48 h treatment with 0.5 μM rucaparib. Actin was used as a loading control. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

Article Snippet: The PCa cell lines 22RV1, C4-2B, LNCaP, PC3, MDA-PCA-2B, and the human embryonic kidney cell line HEK293T were obtained from American Type Cell Culture (ATCC).

Techniques: Plasmid Preparation, Control, Staining, Flow Cytometry, Western Blot, Expressing

XRCC1 expression level dictates the response to PARPi in PCa cells. ( A ) Immunoblot shows the expression of XRCC1 protein in different PCa cell models, including MDA-PCA-2B, C4-2B, LNCaP, PC3, and 22RV1. Ponceau Stain was used as a loading control. ( B ) Cell growth inhibition assay for olaparib (upper), rucaparib (middle), and talazoparib (lower) in LNCaP, MDA-PCA-2B, C4-2B, PC3, and 22RV1. The cells were incubated in the drug-containing media for 6 days. ( C ) Immunoblot shows the expression of XRCC1 protein in C4-2B doxycycline-inducible XRCC1 CDS-overexpressing XRCC1- KO C-1 C4-2B cells following 24 h treatment with indicated dose of doxycycline. ( D ) The survival percentage of these cells was calculated after treatment with 10 μM rucaparib for 72 h. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: ** P < 0.01, *** P < 0.001, and **** P < 0.0001. ( E ) Model for how the expression of XRCC1 may be used as a stratification method for PARPi use in PCa. Created in BioRender (Gassman, N. (2025); https://BioRender.com/ne48py9 ).

Journal: NAR Cancer

Article Title: PARP inhibitor response is enhanced in prostate cancer when XRCC1 expression is reduced

doi: 10.1093/narcan/zcaf015

Figure Lengend Snippet: XRCC1 expression level dictates the response to PARPi in PCa cells. ( A ) Immunoblot shows the expression of XRCC1 protein in different PCa cell models, including MDA-PCA-2B, C4-2B, LNCaP, PC3, and 22RV1. Ponceau Stain was used as a loading control. ( B ) Cell growth inhibition assay for olaparib (upper), rucaparib (middle), and talazoparib (lower) in LNCaP, MDA-PCA-2B, C4-2B, PC3, and 22RV1. The cells were incubated in the drug-containing media for 6 days. ( C ) Immunoblot shows the expression of XRCC1 protein in C4-2B doxycycline-inducible XRCC1 CDS-overexpressing XRCC1- KO C-1 C4-2B cells following 24 h treatment with indicated dose of doxycycline. ( D ) The survival percentage of these cells was calculated after treatment with 10 μM rucaparib for 72 h. The level of statistical significance among the groups was computed using two-way ANOVA with Tukey’s multiple comparisons test. The level of statistical significance is indicated as follows: ** P < 0.01, *** P < 0.001, and **** P < 0.0001. ( E ) Model for how the expression of XRCC1 may be used as a stratification method for PARPi use in PCa. Created in BioRender (Gassman, N. (2025); https://BioRender.com/ne48py9 ).

Article Snippet: The PCa cell lines 22RV1, C4-2B, LNCaP, PC3, MDA-PCA-2B, and the human embryonic kidney cell line HEK293T were obtained from American Type Cell Culture (ATCC).

Techniques: Expressing, Western Blot, Staining, Control, Growth Inhibition Assay, Incubation

IC 50 values of PARPi in different PCa parental cell lines

Journal: NAR Cancer

Article Title: PARP inhibitor response is enhanced in prostate cancer when XRCC1 expression is reduced

doi: 10.1093/narcan/zcaf015

Figure Lengend Snippet: IC 50 values of PARPi in different PCa parental cell lines

Article Snippet: The PCa cell lines 22RV1, C4-2B, LNCaP, PC3, MDA-PCA-2B, and the human embryonic kidney cell line HEK293T were obtained from American Type Cell Culture (ATCC).

Techniques: