pcas Search Results


94
Addgene inc 2015 addgene plasmid
2015 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pm34433019-165-224-225?v=Addgene+inc
Average 94 stars, based on 1 article reviews
2015 addgene plasmid - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

95
OriGene tgccagtcagaagaacgacc
Tgccagtcagaagaacgacc, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/bio_rxiv__2025__08__28__672891-224-23-35?v=OriGene
Average 95 stars, based on 1 article reviews
tgccagtcagaagaacgacc - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

90
OriGene crispr cas starter kit
Specific commercial products and services available to the researchers to implement CRISPR technology.
Crispr Cas Starter Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pmc05116475-65-2-0?v=OriGene
Average 90 stars, based on 1 article reviews
crispr cas starter kit - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

95
OriGene pcas9 guide
Specific commercial products and services available to the researchers to implement CRISPR technology.
Pcas9 Guide, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pmc10170197-360-12-13?v=OriGene
Average 95 stars, based on 1 article reviews
pcas9 guide - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
OriGene crispri
Specific commercial products and services available to the researchers to implement CRISPR technology.
Crispri, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pm39889695-793-9-14?v=OriGene
Average 93 stars, based on 1 article reviews
crispri - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

95
OriGene com products gene expression crispr cas9
Specific commercial products and services available to the researchers to implement CRISPR technology.
Com Products Gene Expression Crispr Cas9, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pmc07019046__mmc2-202-16-15?v=OriGene
Average 95 stars, based on 1 article reviews
com products gene expression crispr cas9 - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

92
OriGene pcas guide crispra
Specific commercial products and services available to the researchers to implement CRISPR technology.
Pcas Guide Crispra, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pmc11338903-54-38-46?v=OriGene
Average 92 stars, based on 1 article reviews
pcas guide crispra - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

94
OriGene control grna
Specific commercial products and services available to the researchers to implement CRISPR technology.
Control Grna, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pmc12827282-323-5-7?v=OriGene
Average 94 stars, based on 1 article reviews
control grna - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
Addgene inc pcas vector
Specific commercial products and services available to the researchers to implement CRISPR technology.
Pcas Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pm40595524-287-6-8?v=Addgene+inc
Average 94 stars, based on 1 article reviews
pcas vector - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
OriGene fgf18 crispri plasmid
( A ) CellChat analysis of scRNAseq integration data of E13.5-E15.5 soft palatal tissue showing significant interactions between perimysial fibroblasts and myogenic cells. ( B ) Dot plot of expression patterns of perimysial fibroblast-derived signals in individual cellular clusters of integration scRNAseq from E13.5-E15.5 soft palatal tissue. Note that highlighted signals, Lama4 , <t>Fgf18</t> , and Dlk1, are more enriched in the perimysial fibroblasts. ( C ) UMAP plot of palatal mesenchymal cell clusters from integrated scRNAseq analysis of control and Osr2 Cre ;Tgfbr1 fl/fl soft palates at E14.5. ( D–F ) Feature plot view of Fgf18 ( D ), Lama4 ( E ), or Dlk1 ( F ) expression in perimysial cells from the integrated control and Osr2 Cre ;Tgfbr1 fl/fl palatal mesenchymal cell clusters at E14.5. ( G ) Schematic drawing of orientation and level of the sections (left panel) and coronal section of the LVP region (right panel) at E14.5. Boxed area in G indicates the region shown in H-I. The magenta and salmon colors represent the LVP myogenic cells and the other pharyngeal muscles, respectively. HB, hyoid bone; LVP, levator veli palatini; MPC, middle pharyngeal constrictor; PS, palatal shelves. ( H–I ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) ( H ) or Lama4 (green) ( I ) in the coronal section of the LVP region at E14.5. White arrows in H and I point to a positive signal. ( J–U ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) in the coronal section of the LVP region at E13.5 ( J–M ), E14.5 ( N–Q ), and E16.5 ( R–U ) in control and Osr2 Cre ;Tgfbr1 fl/fl mice. Boxed areas in J, L, N, P, R, and T are enlarged in K, M, O, Q, S, and U, respectively. Arrows in K, O, and S point to positive signal; arrowheads in M, Q, and U indicate lack of signal. Left panel schematics depict the orientation and level of the sections. ( V–W ) Quantification of the percentage of Fgf18 expressing area out of the entire the palatal shelf region for control and Osr2 Cre ;Tgfbr1 fl/fl mice at E13.5 ( V ) and E14.5 ( W ). *, p≤0.05; ***, p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. N=3 for all experiments. Tgbfr1 fl/fl or Tgbfr1 fl/+ littermates were used as controls for Osr2 Cre ;Tgfbr1 fl/fl mice. The scale bar in H indicates 100 μm in H and I; the scale bar in J indicates 250 μm in J, L, N, P, R, and T; the scale bar in K indicates 50 μm for the rest of the figures. Figure 5—source data 1. Source data for . Figure 5—source data 2. Source data for .
Fgf18 Crispri Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pmc09771365-296-18-13?v=OriGene
Average 94 stars, based on 1 article reviews
fgf18 crispri plasmid - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
OriGene crispr cas9 genome wide knockout kit
( A ) CellChat analysis of scRNAseq integration data of E13.5-E15.5 soft palatal tissue showing significant interactions between perimysial fibroblasts and myogenic cells. ( B ) Dot plot of expression patterns of perimysial fibroblast-derived signals in individual cellular clusters of integration scRNAseq from E13.5-E15.5 soft palatal tissue. Note that highlighted signals, Lama4 , <t>Fgf18</t> , and Dlk1, are more enriched in the perimysial fibroblasts. ( C ) UMAP plot of palatal mesenchymal cell clusters from integrated scRNAseq analysis of control and Osr2 Cre ;Tgfbr1 fl/fl soft palates at E14.5. ( D–F ) Feature plot view of Fgf18 ( D ), Lama4 ( E ), or Dlk1 ( F ) expression in perimysial cells from the integrated control and Osr2 Cre ;Tgfbr1 fl/fl palatal mesenchymal cell clusters at E14.5. ( G ) Schematic drawing of orientation and level of the sections (left panel) and coronal section of the LVP region (right panel) at E14.5. Boxed area in G indicates the region shown in H-I. The magenta and salmon colors represent the LVP myogenic cells and the other pharyngeal muscles, respectively. HB, hyoid bone; LVP, levator veli palatini; MPC, middle pharyngeal constrictor; PS, palatal shelves. ( H–I ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) ( H ) or Lama4 (green) ( I ) in the coronal section of the LVP region at E14.5. White arrows in H and I point to a positive signal. ( J–U ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) in the coronal section of the LVP region at E13.5 ( J–M ), E14.5 ( N–Q ), and E16.5 ( R–U ) in control and Osr2 Cre ;Tgfbr1 fl/fl mice. Boxed areas in J, L, N, P, R, and T are enlarged in K, M, O, Q, S, and U, respectively. Arrows in K, O, and S point to positive signal; arrowheads in M, Q, and U indicate lack of signal. Left panel schematics depict the orientation and level of the sections. ( V–W ) Quantification of the percentage of Fgf18 expressing area out of the entire the palatal shelf region for control and Osr2 Cre ;Tgfbr1 fl/fl mice at E13.5 ( V ) and E14.5 ( W ). *, p≤0.05; ***, p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. N=3 for all experiments. Tgbfr1 fl/fl or Tgbfr1 fl/+ littermates were used as controls for Osr2 Cre ;Tgfbr1 fl/fl mice. The scale bar in H indicates 100 μm in H and I; the scale bar in J indicates 250 μm in J, L, N, P, R, and T; the scale bar in K indicates 50 μm for the rest of the figures. Figure 5—source data 1. Source data for . Figure 5—source data 2. Source data for .
Crispr Cas9 Genome Wide Knockout Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/bio_rxiv__2023__08__29__555364-229-9-8?v=OriGene
Average 93 stars, based on 1 article reviews
crispr cas9 genome wide knockout kit - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

92
Addgene inc cas9 90276 pcas gpyrg2
( A ) CellChat analysis of scRNAseq integration data of E13.5-E15.5 soft palatal tissue showing significant interactions between perimysial fibroblasts and myogenic cells. ( B ) Dot plot of expression patterns of perimysial fibroblast-derived signals in individual cellular clusters of integration scRNAseq from E13.5-E15.5 soft palatal tissue. Note that highlighted signals, Lama4 , <t>Fgf18</t> , and Dlk1, are more enriched in the perimysial fibroblasts. ( C ) UMAP plot of palatal mesenchymal cell clusters from integrated scRNAseq analysis of control and Osr2 Cre ;Tgfbr1 fl/fl soft palates at E14.5. ( D–F ) Feature plot view of Fgf18 ( D ), Lama4 ( E ), or Dlk1 ( F ) expression in perimysial cells from the integrated control and Osr2 Cre ;Tgfbr1 fl/fl palatal mesenchymal cell clusters at E14.5. ( G ) Schematic drawing of orientation and level of the sections (left panel) and coronal section of the LVP region (right panel) at E14.5. Boxed area in G indicates the region shown in H-I. The magenta and salmon colors represent the LVP myogenic cells and the other pharyngeal muscles, respectively. HB, hyoid bone; LVP, levator veli palatini; MPC, middle pharyngeal constrictor; PS, palatal shelves. ( H–I ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) ( H ) or Lama4 (green) ( I ) in the coronal section of the LVP region at E14.5. White arrows in H and I point to a positive signal. ( J–U ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) in the coronal section of the LVP region at E13.5 ( J–M ), E14.5 ( N–Q ), and E16.5 ( R–U ) in control and Osr2 Cre ;Tgfbr1 fl/fl mice. Boxed areas in J, L, N, P, R, and T are enlarged in K, M, O, Q, S, and U, respectively. Arrows in K, O, and S point to positive signal; arrowheads in M, Q, and U indicate lack of signal. Left panel schematics depict the orientation and level of the sections. ( V–W ) Quantification of the percentage of Fgf18 expressing area out of the entire the palatal shelf region for control and Osr2 Cre ;Tgfbr1 fl/fl mice at E13.5 ( V ) and E14.5 ( W ). *, p≤0.05; ***, p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. N=3 for all experiments. Tgbfr1 fl/fl or Tgbfr1 fl/+ littermates were used as controls for Osr2 Cre ;Tgfbr1 fl/fl mice. The scale bar in H indicates 100 μm in H and I; the scale bar in J indicates 250 μm in J, L, N, P, R, and T; the scale bar in K indicates 50 μm for the rest of the figures. Figure 5—source data 1. Source data for . Figure 5—source data 2. Source data for .
Cas9 90276 Pcas Gpyrg2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcas/pmc11301975__40694_2024_180_MOESM1_ESM-1-13-2?v=Addgene+inc
Average 92 stars, based on 1 article reviews
cas9 90276 pcas gpyrg2 - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

Image Search Results


Specific commercial products and services available to the researchers to implement CRISPR technology.

Journal: Frontiers in Plant Science

Article Title: CRISPR-Cas9: Tool for Qualitative and Quantitative Plant Genome Editing

doi: 10.3389/fpls.2016.01740

Figure Lengend Snippet: Specific commercial products and services available to the researchers to implement CRISPR technology.

Article Snippet: ORiGene , CRISPR/Cas starter kit (HA tagging human HSP60 at C-terminus). , pCas-Guide-Nickase (D10A), pT7-Cas9-Nickase (D10A) , pCas-Guide Cloning Kit, , pCas-Guide-scramble (also available as negative control).

Techniques: CRISPR, Genome Wide, Clone Assay, Cloning, Stable Transfection, Selection, Transfection, Plasmid Preparation, Mutagenesis, Expressing, Negative Control, Positive Control, Construct, Knock-In, Multiplex Assay, Amplification, Sequencing

( A ) CellChat analysis of scRNAseq integration data of E13.5-E15.5 soft palatal tissue showing significant interactions between perimysial fibroblasts and myogenic cells. ( B ) Dot plot of expression patterns of perimysial fibroblast-derived signals in individual cellular clusters of integration scRNAseq from E13.5-E15.5 soft palatal tissue. Note that highlighted signals, Lama4 , Fgf18 , and Dlk1, are more enriched in the perimysial fibroblasts. ( C ) UMAP plot of palatal mesenchymal cell clusters from integrated scRNAseq analysis of control and Osr2 Cre ;Tgfbr1 fl/fl soft palates at E14.5. ( D–F ) Feature plot view of Fgf18 ( D ), Lama4 ( E ), or Dlk1 ( F ) expression in perimysial cells from the integrated control and Osr2 Cre ;Tgfbr1 fl/fl palatal mesenchymal cell clusters at E14.5. ( G ) Schematic drawing of orientation and level of the sections (left panel) and coronal section of the LVP region (right panel) at E14.5. Boxed area in G indicates the region shown in H-I. The magenta and salmon colors represent the LVP myogenic cells and the other pharyngeal muscles, respectively. HB, hyoid bone; LVP, levator veli palatini; MPC, middle pharyngeal constrictor; PS, palatal shelves. ( H–I ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) ( H ) or Lama4 (green) ( I ) in the coronal section of the LVP region at E14.5. White arrows in H and I point to a positive signal. ( J–U ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) in the coronal section of the LVP region at E13.5 ( J–M ), E14.5 ( N–Q ), and E16.5 ( R–U ) in control and Osr2 Cre ;Tgfbr1 fl/fl mice. Boxed areas in J, L, N, P, R, and T are enlarged in K, M, O, Q, S, and U, respectively. Arrows in K, O, and S point to positive signal; arrowheads in M, Q, and U indicate lack of signal. Left panel schematics depict the orientation and level of the sections. ( V–W ) Quantification of the percentage of Fgf18 expressing area out of the entire the palatal shelf region for control and Osr2 Cre ;Tgfbr1 fl/fl mice at E13.5 ( V ) and E14.5 ( W ). *, p≤0.05; ***, p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. N=3 for all experiments. Tgbfr1 fl/fl or Tgbfr1 fl/+ littermates were used as controls for Osr2 Cre ;Tgfbr1 fl/fl mice. The scale bar in H indicates 100 μm in H and I; the scale bar in J indicates 250 μm in J, L, N, P, R, and T; the scale bar in K indicates 50 μm for the rest of the figures. Figure 5—source data 1. Source data for . Figure 5—source data 2. Source data for .

Journal: eLife

Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development

doi: 10.7554/eLife.80405

Figure Lengend Snippet: ( A ) CellChat analysis of scRNAseq integration data of E13.5-E15.5 soft palatal tissue showing significant interactions between perimysial fibroblasts and myogenic cells. ( B ) Dot plot of expression patterns of perimysial fibroblast-derived signals in individual cellular clusters of integration scRNAseq from E13.5-E15.5 soft palatal tissue. Note that highlighted signals, Lama4 , Fgf18 , and Dlk1, are more enriched in the perimysial fibroblasts. ( C ) UMAP plot of palatal mesenchymal cell clusters from integrated scRNAseq analysis of control and Osr2 Cre ;Tgfbr1 fl/fl soft palates at E14.5. ( D–F ) Feature plot view of Fgf18 ( D ), Lama4 ( E ), or Dlk1 ( F ) expression in perimysial cells from the integrated control and Osr2 Cre ;Tgfbr1 fl/fl palatal mesenchymal cell clusters at E14.5. ( G ) Schematic drawing of orientation and level of the sections (left panel) and coronal section of the LVP region (right panel) at E14.5. Boxed area in G indicates the region shown in H-I. The magenta and salmon colors represent the LVP myogenic cells and the other pharyngeal muscles, respectively. HB, hyoid bone; LVP, levator veli palatini; MPC, middle pharyngeal constrictor; PS, palatal shelves. ( H–I ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) ( H ) or Lama4 (green) ( I ) in the coronal section of the LVP region at E14.5. White arrows in H and I point to a positive signal. ( J–U ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) in the coronal section of the LVP region at E13.5 ( J–M ), E14.5 ( N–Q ), and E16.5 ( R–U ) in control and Osr2 Cre ;Tgfbr1 fl/fl mice. Boxed areas in J, L, N, P, R, and T are enlarged in K, M, O, Q, S, and U, respectively. Arrows in K, O, and S point to positive signal; arrowheads in M, Q, and U indicate lack of signal. Left panel schematics depict the orientation and level of the sections. ( V–W ) Quantification of the percentage of Fgf18 expressing area out of the entire the palatal shelf region for control and Osr2 Cre ;Tgfbr1 fl/fl mice at E13.5 ( V ) and E14.5 ( W ). *, p≤0.05; ***, p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. N=3 for all experiments. Tgbfr1 fl/fl or Tgbfr1 fl/+ littermates were used as controls for Osr2 Cre ;Tgfbr1 fl/fl mice. The scale bar in H indicates 100 μm in H and I; the scale bar in J indicates 250 μm in J, L, N, P, R, and T; the scale bar in K indicates 50 μm for the rest of the figures. Figure 5—source data 1. Source data for . Figure 5—source data 2. Source data for .

Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by Origene Technologies to generate a Fgf18 CRISPRi Plasmid. pCas-Guide-Puro-CRISPRi-Scramble plasmid (GE100084, Origene Technologies) was used as control.

Techniques: Expressing, Derivative Assay, Control, Muscles, RNAscope, In Situ Hybridization, Two Tailed Test

( A ) UCSC binding prediction of SMAD2 binding motif to the promoter of Fgf18 gene. The boxed area indicates the binding site with the highest score. ( B ) Cut and Run analysis shows significantly more enriched Smad2/3 binding to the promoter region of the Fgf18 gene close to the predicted binding site than that of IgG in the soft palatal tissue of the control mice at E14.5. *, p-value ≤0.05. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( C ) qPCR analysis of Fgf18 expression in E14.5 soft palatal mesenchymal cell culture after treatment with 5 ng/ml TGF-β1 or BSA compared after 4 or 18 hr. Note the increase of Fgf18 at 4 hr is higher than at 18 hr. *, p≤0.05; ***; p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( D ) qPCR analysis of Fgf18 expression of E14.5 soft palatal mesenchymal cell culture transfected with Fgf18 or Control CRISPRi plasmid followed by treatment with 5 ng/ml TGF-β1 or BSA for 4 hr. ‘+’ or ‘-’ under the plots indicates the presence or absence of the indicated treatment. **, p≤0.01; ***, p≤0.001. Statistical significance was assessed by ANOVA. Data is presented as mean ± SEM. ( E ) Dotplot of perimysial fibroblast regulon expression pattern in individual cellular clusters of integrated scRNAseq from E13.5-E15.5 soft palatal tissue. Highlighted regulons are more enriched in the perimysial fibroblasts. ( F ) Schematic drawing of coronal section of the LVP region at E14.5. Boxed area in E indicates the region shown in G-N. The magenta and salmon colors represent the LVP myogenic cells and the other pharyngeal muscles, respectively. HB, hyoid bone; LVP, levator veli palatini; MPC, middle pharyngeal constrictor; PS, palatal shelves. ( G ) Immunofluorescence of MyoD (red) and pSMAD2 (green) in the coronal section of the LVP region at E14.5. ( H–N ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) ( H ), Creb5 (green) ( I ), Tbx15 (green) ( J ), Hic1 (green) ( K ), Meox1 (green) ( L ), Etv5 (green) ( M ), or Bach2 (green) ( N ) in coronal sections of the LVP region at E14.5. Arrows indicate positive signals. ( O–P ) qPCR analysis of Creb5 ( O ) and Fgf18 expression ( P ) after Creb5 siRNA treatment on E14.5 soft palatal mesenchymal cell culture compared with the control siRNA. ***, p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( Q ) qPCR analysis of Fgf18 expression following Creb5 siRNA treatment combined with 5 ng/ml TGF-β1 or BSA on E14.5 soft palatal mesenchymal cell culture, compared with the control siRNA. ‘+’ or ‘-’ under the plots indicates the presence or absence of the indicated treatment. *, p≤0.05; **, p≤0.01; ***, p≤0.001. Statistical significance was assessed by ANOVA. Data is presented as mean ± SEM. N=3 for all experiments. Tgbfr1 fl/fl or Tgbfr1 fl/+ littermates were used as controls for Osr2 Cre ;Tgfbr1 fl/fl mice. Scale bar in G indicates 100 μm in G-N. Figure 6—source data 1. Source data for . Figure 6—source data 2. Source data for . Figure 6—source data 3. Source data for . Figure 6—source data 4. Source data for . Figure 6—source data 5. Source data for . Figure 6—source data 6. Source data for .

Journal: eLife

Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development

doi: 10.7554/eLife.80405

Figure Lengend Snippet: ( A ) UCSC binding prediction of SMAD2 binding motif to the promoter of Fgf18 gene. The boxed area indicates the binding site with the highest score. ( B ) Cut and Run analysis shows significantly more enriched Smad2/3 binding to the promoter region of the Fgf18 gene close to the predicted binding site than that of IgG in the soft palatal tissue of the control mice at E14.5. *, p-value ≤0.05. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( C ) qPCR analysis of Fgf18 expression in E14.5 soft palatal mesenchymal cell culture after treatment with 5 ng/ml TGF-β1 or BSA compared after 4 or 18 hr. Note the increase of Fgf18 at 4 hr is higher than at 18 hr. *, p≤0.05; ***; p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( D ) qPCR analysis of Fgf18 expression of E14.5 soft palatal mesenchymal cell culture transfected with Fgf18 or Control CRISPRi plasmid followed by treatment with 5 ng/ml TGF-β1 or BSA for 4 hr. ‘+’ or ‘-’ under the plots indicates the presence or absence of the indicated treatment. **, p≤0.01; ***, p≤0.001. Statistical significance was assessed by ANOVA. Data is presented as mean ± SEM. ( E ) Dotplot of perimysial fibroblast regulon expression pattern in individual cellular clusters of integrated scRNAseq from E13.5-E15.5 soft palatal tissue. Highlighted regulons are more enriched in the perimysial fibroblasts. ( F ) Schematic drawing of coronal section of the LVP region at E14.5. Boxed area in E indicates the region shown in G-N. The magenta and salmon colors represent the LVP myogenic cells and the other pharyngeal muscles, respectively. HB, hyoid bone; LVP, levator veli palatini; MPC, middle pharyngeal constrictor; PS, palatal shelves. ( G ) Immunofluorescence of MyoD (red) and pSMAD2 (green) in the coronal section of the LVP region at E14.5. ( H–N ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) ( H ), Creb5 (green) ( I ), Tbx15 (green) ( J ), Hic1 (green) ( K ), Meox1 (green) ( L ), Etv5 (green) ( M ), or Bach2 (green) ( N ) in coronal sections of the LVP region at E14.5. Arrows indicate positive signals. ( O–P ) qPCR analysis of Creb5 ( O ) and Fgf18 expression ( P ) after Creb5 siRNA treatment on E14.5 soft palatal mesenchymal cell culture compared with the control siRNA. ***, p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( Q ) qPCR analysis of Fgf18 expression following Creb5 siRNA treatment combined with 5 ng/ml TGF-β1 or BSA on E14.5 soft palatal mesenchymal cell culture, compared with the control siRNA. ‘+’ or ‘-’ under the plots indicates the presence or absence of the indicated treatment. *, p≤0.05; **, p≤0.01; ***, p≤0.001. Statistical significance was assessed by ANOVA. Data is presented as mean ± SEM. N=3 for all experiments. Tgbfr1 fl/fl or Tgbfr1 fl/+ littermates were used as controls for Osr2 Cre ;Tgfbr1 fl/fl mice. Scale bar in G indicates 100 μm in G-N. Figure 6—source data 1. Source data for . Figure 6—source data 2. Source data for . Figure 6—source data 3. Source data for . Figure 6—source data 4. Source data for . Figure 6—source data 5. Source data for . Figure 6—source data 6. Source data for .

Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by Origene Technologies to generate a Fgf18 CRISPRi Plasmid. pCas-Guide-Puro-CRISPRi-Scramble plasmid (GE100084, Origene Technologies) was used as control.

Techniques: Binding Assay, Control, Two Tailed Test, Expressing, Cell Culture, Transfection, Plasmid Preparation, Muscles, Immunofluorescence, RNAscope, In Situ Hybridization

( A–D ) Immunofluorescence of MyoD (red) in sagittal sections of control mouse head in the masseter region at E10.5 ( A ), E11.5 ( B ), E12.5 ( C ), and E13.5 ( D ). White arrows in A-D point to forming masseter. ( E and H ) Immunofluorescence of MyoD (red) and pSMAD2 (green) in sagittal sections of control mouse head in the masseter muscle region at E13.5. Boxed area in E is enlarged in H. The white arrow in H points to a positive signal. ( F–G and I–J ) RNAScope in situ hybridization for Myod1 (red) and Creb5 (green) ( F and I ) or Fgf18 (green) ( G and J ) in sagittal sections of control mouse heads at in the masseter region E13.5. Boxed areas in F and G are enlarged in H and I, respectively. White arrows in I and J point to positive signals. MA, masseter. N=3 for all experiments. Scale bars in A and E indicate 500 μm for A-D and E-F, respectively; scale bar in H indicates 100 μm in H-J.

Journal: eLife

Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development

doi: 10.7554/eLife.80405

Figure Lengend Snippet: ( A–D ) Immunofluorescence of MyoD (red) in sagittal sections of control mouse head in the masseter region at E10.5 ( A ), E11.5 ( B ), E12.5 ( C ), and E13.5 ( D ). White arrows in A-D point to forming masseter. ( E and H ) Immunofluorescence of MyoD (red) and pSMAD2 (green) in sagittal sections of control mouse head in the masseter muscle region at E13.5. Boxed area in E is enlarged in H. The white arrow in H points to a positive signal. ( F–G and I–J ) RNAScope in situ hybridization for Myod1 (red) and Creb5 (green) ( F and I ) or Fgf18 (green) ( G and J ) in sagittal sections of control mouse heads at in the masseter region E13.5. Boxed areas in F and G are enlarged in H and I, respectively. White arrows in I and J point to positive signals. MA, masseter. N=3 for all experiments. Scale bars in A and E indicate 500 μm for A-D and E-F, respectively; scale bar in H indicates 100 μm in H-J.

Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by Origene Technologies to generate a Fgf18 CRISPRi Plasmid. pCas-Guide-Puro-CRISPRi-Scramble plasmid (GE100084, Origene Technologies) was used as control.

Techniques: Immunofluorescence, Control, RNAscope, In Situ Hybridization

( A–L ) H&E staining in coronal sections of LVP region at P0.5 from control and Osr2 Cre ;Fgf18 fl/fl mice. Boxed areas in A-D and E-H are enlarged in E-H, and I-L, respectively. Black arrows point to the palatal shelf in A-D and the LVP in E-H. Green dotted line outlined the LVP in E-H. Black and white triangles point to perpendicular muscle fibers in I-L and parallel fibers in I-J. The white dotted line indicates the boundaries of perpendicular and parallel fibers in E, F, I, and J. Double-ended arrows indicate the thickness of perpendicular fibers in I and J. N=4. ( M–Q ) Immunofluorescence and quantification of MHC (red) staining on coronal section of the LVP region of control Osr2 Cre ;Fgf18 fl/fl mice at P0.5. MHC+ areas in the LVP region for quantification of cross-section areas are outlined by white dashed lines in M-P. The percentage of MHC-stained area out of the whole image area is used for quantification in Q. *, p≤0.05. N=3. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( R–V ) CT scanning and quantitative analysis of the muscle volume of control and Osr2 Cre ;Tgfbr1 fl/fl LVP at P0.5. A representative reconstructed control LVP from CT scanning is indicated in yellow ( R and S ) and an Osr2 Cre ;Tgfbr1 fl/fl reconstructed LVP is indicated in teal ( T and U ). **, p≤0.01. N=4. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( W ) A 300 μm coronal slice of the LVP region at E14 from Osr2 Cre ;Fgf18 fl/fl mouse for slice culture following bead implantation. Arrows point to BSA- or FGF18-treated bead. ( X–Y ) Immunofluorescence of MyoD (red) in the coronal section of LVP region from Osr2 Cre ;Fgf18 fl/fl mouse cultured for 3 days with BSA bead ( X ) and FGF18 bead ( Y ). White circles indicate the location of the BSA beads in X and FGF18 beads in Y. N=3. Fgf18 fl/fl or Fgf18 fl/+ littermates were used as controls for Osr2 Cre ;Fgf18 fl/fl mice. Scale bars in A, E, I, M, R, S, and W indicate 500 μm in in A-D, 100 μm in E-H, 50 μm in I-L, 400 μm in M-P, 400 μm in R and T, 100 μm in S and U, and 100 μm in W-Y, respectively. Figure 7—source data 1. Source data for . Figure 7—source data 2. Source data for .

Journal: eLife

Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development

doi: 10.7554/eLife.80405

Figure Lengend Snippet: ( A–L ) H&E staining in coronal sections of LVP region at P0.5 from control and Osr2 Cre ;Fgf18 fl/fl mice. Boxed areas in A-D and E-H are enlarged in E-H, and I-L, respectively. Black arrows point to the palatal shelf in A-D and the LVP in E-H. Green dotted line outlined the LVP in E-H. Black and white triangles point to perpendicular muscle fibers in I-L and parallel fibers in I-J. The white dotted line indicates the boundaries of perpendicular and parallel fibers in E, F, I, and J. Double-ended arrows indicate the thickness of perpendicular fibers in I and J. N=4. ( M–Q ) Immunofluorescence and quantification of MHC (red) staining on coronal section of the LVP region of control Osr2 Cre ;Fgf18 fl/fl mice at P0.5. MHC+ areas in the LVP region for quantification of cross-section areas are outlined by white dashed lines in M-P. The percentage of MHC-stained area out of the whole image area is used for quantification in Q. *, p≤0.05. N=3. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( R–V ) CT scanning and quantitative analysis of the muscle volume of control and Osr2 Cre ;Tgfbr1 fl/fl LVP at P0.5. A representative reconstructed control LVP from CT scanning is indicated in yellow ( R and S ) and an Osr2 Cre ;Tgfbr1 fl/fl reconstructed LVP is indicated in teal ( T and U ). **, p≤0.01. N=4. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( W ) A 300 μm coronal slice of the LVP region at E14 from Osr2 Cre ;Fgf18 fl/fl mouse for slice culture following bead implantation. Arrows point to BSA- or FGF18-treated bead. ( X–Y ) Immunofluorescence of MyoD (red) in the coronal section of LVP region from Osr2 Cre ;Fgf18 fl/fl mouse cultured for 3 days with BSA bead ( X ) and FGF18 bead ( Y ). White circles indicate the location of the BSA beads in X and FGF18 beads in Y. N=3. Fgf18 fl/fl or Fgf18 fl/+ littermates were used as controls for Osr2 Cre ;Fgf18 fl/fl mice. Scale bars in A, E, I, M, R, S, and W indicate 500 μm in in A-D, 100 μm in E-H, 50 μm in I-L, 400 μm in M-P, 400 μm in R and T, 100 μm in S and U, and 100 μm in W-Y, respectively. Figure 7—source data 1. Source data for . Figure 7—source data 2. Source data for .

Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by Origene Technologies to generate a Fgf18 CRISPRi Plasmid. pCas-Guide-Puro-CRISPRi-Scramble plasmid (GE100084, Origene Technologies) was used as control.

Techniques: Staining, Control, Immunofluorescence, Two Tailed Test, Cell Culture

( A–J ) Immunofluorescence and quantification of MyoD (red) in coronal section of LVP region at E14.5 ( A–E ) and E16.5 ( F–J ) from control and Osr2 Cre ;Fgf18 fl/fl mice. Boxed areas in A, C, F, and H are enlarged in B, D, G, and I, respectively. White arrows in B, D, and G point to the presence of MyoD+ cells. The white asterisk in I indicates a decrease of MyoD+ cells in E16.5 Osr2 Cre ;Fgf18 fl/fl mice. Note that the myogenic cell numbers in E14.5 are comparable between control and Osr2 Cre ;Fgf18 fl/fl mice at E14.5 ( E ) but are significantly decreased in the mutant at E16.5 ( J ). *, p≤0.05; ns, not significant. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. Yellow dotted line outlines the myogenic regions where the qualification analysis was performed. ( K–N ) BaseScope in situ hybridizations of Fgf18 Exon1C (red) in the coronal section of LVP region at E14.5 from control and Osr2 Cre ;Fgf18 fl/fl mice. Boxed areas in K and M are enlarged in L and N, respectively. The white arrow in L points to a positive signal, and the asterisk in N points to a reduced signal. Left panel schematics depict the orientation and level of the sections. N=3 for all experiments. Fgf18 fl/fl or Fgf18 fl/+ littermates were used as controls for Osr2 Cre ;Fgf18 fl/fl mice. Scale bar in A indicates 500 μm in A, C, F, H, K, and M; scale bar in B indicates 100 μm in B, D, G, I, L, and N. Figure 7—figure supplement 1—source data 1. Source data for . Figure 7—figure supplement 1—source data 2. Source data for .

Journal: eLife

Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development

doi: 10.7554/eLife.80405

Figure Lengend Snippet: ( A–J ) Immunofluorescence and quantification of MyoD (red) in coronal section of LVP region at E14.5 ( A–E ) and E16.5 ( F–J ) from control and Osr2 Cre ;Fgf18 fl/fl mice. Boxed areas in A, C, F, and H are enlarged in B, D, G, and I, respectively. White arrows in B, D, and G point to the presence of MyoD+ cells. The white asterisk in I indicates a decrease of MyoD+ cells in E16.5 Osr2 Cre ;Fgf18 fl/fl mice. Note that the myogenic cell numbers in E14.5 are comparable between control and Osr2 Cre ;Fgf18 fl/fl mice at E14.5 ( E ) but are significantly decreased in the mutant at E16.5 ( J ). *, p≤0.05; ns, not significant. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. Yellow dotted line outlines the myogenic regions where the qualification analysis was performed. ( K–N ) BaseScope in situ hybridizations of Fgf18 Exon1C (red) in the coronal section of LVP region at E14.5 from control and Osr2 Cre ;Fgf18 fl/fl mice. Boxed areas in K and M are enlarged in L and N, respectively. The white arrow in L points to a positive signal, and the asterisk in N points to a reduced signal. Left panel schematics depict the orientation and level of the sections. N=3 for all experiments. Fgf18 fl/fl or Fgf18 fl/+ littermates were used as controls for Osr2 Cre ;Fgf18 fl/fl mice. Scale bar in A indicates 500 μm in A, C, F, H, K, and M; scale bar in B indicates 100 μm in B, D, G, I, L, and N. Figure 7—figure supplement 1—source data 1. Source data for . Figure 7—figure supplement 1—source data 2. Source data for .

Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by Origene Technologies to generate a Fgf18 CRISPRi Plasmid. pCas-Guide-Puro-CRISPRi-Scramble plasmid (GE100084, Origene Technologies) was used as control.

Techniques: Immunofluorescence, Control, Mutagenesis, Two Tailed Test, In Situ

( A–F ) Immunofluorescence and RNAScope in situ hybridization for MyoD (red) and Caspase 3 ( A and D ), MyoD (red) and BrdU (green) ( B and E ), and Myf5 (red) and BrdU (green) (C and F) in coronal sections of LVP region at E14.5 from control and Osr2 Cre ;Fgf18 fl/fl mice. Insets are enlarged from the boxed areas. Yellow dotted line outlines the myogenic regions where the qualification analysis was performed. N=3. Fgf18 fl/fl or Fgf18 fl/+ littermates were used as controls for Osr2 Cre ;Fgf18 fl/fl mice. The schematic in the top right corner depicts the orientation and level of the section. ( G ) Quantification of the percentage of BrdU+/ My5 + double-positive cells out of the total Myf5 + cells in the LVP region from E14.5 control and Osr2 Cre ;Fgf18 fl/fl mice. **, p≤0.01. N=3. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( H–J ) Immunofluorescence and quantification of BrdU (red) staining on C12C12 myogenic ells following 1 day of treatment with BSA or 500 ng/ml FGF18. Proliferative rate is calculated by the percentage of BrdU+ cells out of the total number of cells. ***, p≤0.001. N=3. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( K ) Quantification of total number of C12C12 myogenic cells after culture for 3 days with BSA or 500 ng/ml FGF18. ***, p≤0.001. N=6. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. Scale bar in A indicates 100 μm for A-F and 30 μm for the insets in A-F; scale bar in H indicates 200 μm for H-I. Figure 7—figure supplement 2—source data 1. Source data for . Figure 7—figure supplement 2—source data 2. Source data for . Figure 7—figure supplement 2—source data 3. Source data for .

Journal: eLife

Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development

doi: 10.7554/eLife.80405

Figure Lengend Snippet: ( A–F ) Immunofluorescence and RNAScope in situ hybridization for MyoD (red) and Caspase 3 ( A and D ), MyoD (red) and BrdU (green) ( B and E ), and Myf5 (red) and BrdU (green) (C and F) in coronal sections of LVP region at E14.5 from control and Osr2 Cre ;Fgf18 fl/fl mice. Insets are enlarged from the boxed areas. Yellow dotted line outlines the myogenic regions where the qualification analysis was performed. N=3. Fgf18 fl/fl or Fgf18 fl/+ littermates were used as controls for Osr2 Cre ;Fgf18 fl/fl mice. The schematic in the top right corner depicts the orientation and level of the section. ( G ) Quantification of the percentage of BrdU+/ My5 + double-positive cells out of the total Myf5 + cells in the LVP region from E14.5 control and Osr2 Cre ;Fgf18 fl/fl mice. **, p≤0.01. N=3. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( H–J ) Immunofluorescence and quantification of BrdU (red) staining on C12C12 myogenic ells following 1 day of treatment with BSA or 500 ng/ml FGF18. Proliferative rate is calculated by the percentage of BrdU+ cells out of the total number of cells. ***, p≤0.001. N=3. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( K ) Quantification of total number of C12C12 myogenic cells after culture for 3 days with BSA or 500 ng/ml FGF18. ***, p≤0.001. N=6. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. Scale bar in A indicates 100 μm for A-F and 30 μm for the insets in A-F; scale bar in H indicates 200 μm for H-I. Figure 7—figure supplement 2—source data 1. Source data for . Figure 7—figure supplement 2—source data 2. Source data for . Figure 7—figure supplement 2—source data 3. Source data for .

Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by Origene Technologies to generate a Fgf18 CRISPRi Plasmid. pCas-Guide-Puro-CRISPRi-Scramble plasmid (GE100084, Origene Technologies) was used as control.

Techniques: Immunofluorescence, RNAscope, In Situ Hybridization, Control, Two Tailed Test, Staining

Journal: eLife

Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development

doi: 10.7554/eLife.80405

Figure Lengend Snippet:

Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by Origene Technologies to generate a Fgf18 CRISPRi Plasmid. pCas-Guide-Puro-CRISPRi-Scramble plasmid (GE100084, Origene Technologies) was used as control.

Techniques: Sequencing, RNAscope, Plasmid Preparation, Recombinant, Multiplex Assay, cDNA Synthesis, Software