|
Addgene inc
2015 addgene plasmid 2015 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pm34433019-165-224-225?v=Addgene+inc Average 94 stars, based on 1 article reviews
2015 addgene plasmid - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
tgccagtcagaagaacgacc Tgccagtcagaagaacgacc, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/bio_rxiv__2025__08__28__672891-224-23-35?v=OriGene Average 95 stars, based on 1 article reviews
tgccagtcagaagaacgacc - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
OriGene
crispr cas starter kit ![]() Crispr Cas Starter Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pmc05116475-65-2-0?v=OriGene Average 90 stars, based on 1 article reviews
crispr cas starter kit - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
pcas9 guide ![]() Pcas9 Guide, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pmc10170197-360-12-13?v=OriGene Average 95 stars, based on 1 article reviews
pcas9 guide - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
OriGene
crispri ![]() Crispri, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pm39889695-793-9-14?v=OriGene Average 93 stars, based on 1 article reviews
crispri - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
OriGene
com products gene expression crispr cas9 ![]() Com Products Gene Expression Crispr Cas9, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pmc07019046__mmc2-202-16-15?v=OriGene Average 95 stars, based on 1 article reviews
com products gene expression crispr cas9 - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
OriGene
pcas guide crispra ![]() Pcas Guide Crispra, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pmc11338903-54-38-46?v=OriGene Average 92 stars, based on 1 article reviews
pcas guide crispra - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
OriGene
control grna ![]() Control Grna, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pmc12827282-323-5-7?v=OriGene Average 94 stars, based on 1 article reviews
control grna - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Addgene inc
pcas vector ![]() Pcas Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pm40595524-287-6-8?v=Addgene+inc Average 94 stars, based on 1 article reviews
pcas vector - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
fgf18 crispri plasmid ![]() Fgf18 Crispri Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pmc09771365-296-18-13?v=OriGene Average 94 stars, based on 1 article reviews
fgf18 crispri plasmid - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
crispr cas9 genome wide knockout kit ![]() Crispr Cas9 Genome Wide Knockout Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/bio_rxiv__2023__08__29__555364-229-9-8?v=OriGene Average 93 stars, based on 1 article reviews
crispr cas9 genome wide knockout kit - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Addgene inc
cas9 90276 pcas gpyrg2 ![]() Cas9 90276 Pcas Gpyrg2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pcas/pmc11301975__40694_2024_180_MOESM1_ESM-1-13-2?v=Addgene+inc Average 92 stars, based on 1 article reviews
cas9 90276 pcas gpyrg2 - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in Plant Science
Article Title: CRISPR-Cas9: Tool for Qualitative and Quantitative Plant Genome Editing
doi: 10.3389/fpls.2016.01740
Figure Lengend Snippet: Specific commercial products and services available to the researchers to implement CRISPR technology.
Article Snippet:
Techniques: CRISPR, Genome Wide, Clone Assay, Cloning, Stable Transfection, Selection, Transfection, Plasmid Preparation, Mutagenesis, Expressing, Negative Control, Positive Control, Construct, Knock-In, Multiplex Assay, Amplification, Sequencing
Journal: eLife
Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development
doi: 10.7554/eLife.80405
Figure Lengend Snippet: ( A ) CellChat analysis of scRNAseq integration data of E13.5-E15.5 soft palatal tissue showing significant interactions between perimysial fibroblasts and myogenic cells. ( B ) Dot plot of expression patterns of perimysial fibroblast-derived signals in individual cellular clusters of integration scRNAseq from E13.5-E15.5 soft palatal tissue. Note that highlighted signals, Lama4 , Fgf18 , and Dlk1, are more enriched in the perimysial fibroblasts. ( C ) UMAP plot of palatal mesenchymal cell clusters from integrated scRNAseq analysis of control and Osr2 Cre ;Tgfbr1 fl/fl soft palates at E14.5. ( D–F ) Feature plot view of Fgf18 ( D ), Lama4 ( E ), or Dlk1 ( F ) expression in perimysial cells from the integrated control and Osr2 Cre ;Tgfbr1 fl/fl palatal mesenchymal cell clusters at E14.5. ( G ) Schematic drawing of orientation and level of the sections (left panel) and coronal section of the LVP region (right panel) at E14.5. Boxed area in G indicates the region shown in H-I. The magenta and salmon colors represent the LVP myogenic cells and the other pharyngeal muscles, respectively. HB, hyoid bone; LVP, levator veli palatini; MPC, middle pharyngeal constrictor; PS, palatal shelves. ( H–I ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) ( H ) or Lama4 (green) ( I ) in the coronal section of the LVP region at E14.5. White arrows in H and I point to a positive signal. ( J–U ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) in the coronal section of the LVP region at E13.5 ( J–M ), E14.5 ( N–Q ), and E16.5 ( R–U ) in control and Osr2 Cre ;Tgfbr1 fl/fl mice. Boxed areas in J, L, N, P, R, and T are enlarged in K, M, O, Q, S, and U, respectively. Arrows in K, O, and S point to positive signal; arrowheads in M, Q, and U indicate lack of signal. Left panel schematics depict the orientation and level of the sections. ( V–W ) Quantification of the percentage of Fgf18 expressing area out of the entire the palatal shelf region for control and Osr2 Cre ;Tgfbr1 fl/fl mice at E13.5 ( V ) and E14.5 ( W ). *, p≤0.05; ***, p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. N=3 for all experiments. Tgbfr1 fl/fl or Tgbfr1 fl/+ littermates were used as controls for Osr2 Cre ;Tgfbr1 fl/fl mice. The scale bar in H indicates 100 μm in H and I; the scale bar in J indicates 250 μm in J, L, N, P, R, and T; the scale bar in K indicates 50 μm for the rest of the figures. Figure 5—source data 1. Source data for . Figure 5—source data 2. Source data for .
Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by
Techniques: Expressing, Derivative Assay, Control, Muscles, RNAscope, In Situ Hybridization, Two Tailed Test
Journal: eLife
Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development
doi: 10.7554/eLife.80405
Figure Lengend Snippet: ( A ) UCSC binding prediction of SMAD2 binding motif to the promoter of Fgf18 gene. The boxed area indicates the binding site with the highest score. ( B ) Cut and Run analysis shows significantly more enriched Smad2/3 binding to the promoter region of the Fgf18 gene close to the predicted binding site than that of IgG in the soft palatal tissue of the control mice at E14.5. *, p-value ≤0.05. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( C ) qPCR analysis of Fgf18 expression in E14.5 soft palatal mesenchymal cell culture after treatment with 5 ng/ml TGF-β1 or BSA compared after 4 or 18 hr. Note the increase of Fgf18 at 4 hr is higher than at 18 hr. *, p≤0.05; ***; p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( D ) qPCR analysis of Fgf18 expression of E14.5 soft palatal mesenchymal cell culture transfected with Fgf18 or Control CRISPRi plasmid followed by treatment with 5 ng/ml TGF-β1 or BSA for 4 hr. ‘+’ or ‘-’ under the plots indicates the presence or absence of the indicated treatment. **, p≤0.01; ***, p≤0.001. Statistical significance was assessed by ANOVA. Data is presented as mean ± SEM. ( E ) Dotplot of perimysial fibroblast regulon expression pattern in individual cellular clusters of integrated scRNAseq from E13.5-E15.5 soft palatal tissue. Highlighted regulons are more enriched in the perimysial fibroblasts. ( F ) Schematic drawing of coronal section of the LVP region at E14.5. Boxed area in E indicates the region shown in G-N. The magenta and salmon colors represent the LVP myogenic cells and the other pharyngeal muscles, respectively. HB, hyoid bone; LVP, levator veli palatini; MPC, middle pharyngeal constrictor; PS, palatal shelves. ( G ) Immunofluorescence of MyoD (red) and pSMAD2 (green) in the coronal section of the LVP region at E14.5. ( H–N ) RNAScope in situ hybridization for Myod1 (red) and Fgf18 (green) ( H ), Creb5 (green) ( I ), Tbx15 (green) ( J ), Hic1 (green) ( K ), Meox1 (green) ( L ), Etv5 (green) ( M ), or Bach2 (green) ( N ) in coronal sections of the LVP region at E14.5. Arrows indicate positive signals. ( O–P ) qPCR analysis of Creb5 ( O ) and Fgf18 expression ( P ) after Creb5 siRNA treatment on E14.5 soft palatal mesenchymal cell culture compared with the control siRNA. ***, p≤0.001. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( Q ) qPCR analysis of Fgf18 expression following Creb5 siRNA treatment combined with 5 ng/ml TGF-β1 or BSA on E14.5 soft palatal mesenchymal cell culture, compared with the control siRNA. ‘+’ or ‘-’ under the plots indicates the presence or absence of the indicated treatment. *, p≤0.05; **, p≤0.01; ***, p≤0.001. Statistical significance was assessed by ANOVA. Data is presented as mean ± SEM. N=3 for all experiments. Tgbfr1 fl/fl or Tgbfr1 fl/+ littermates were used as controls for Osr2 Cre ;Tgfbr1 fl/fl mice. Scale bar in G indicates 100 μm in G-N. Figure 6—source data 1. Source data for . Figure 6—source data 2. Source data for . Figure 6—source data 3. Source data for . Figure 6—source data 4. Source data for . Figure 6—source data 5. Source data for . Figure 6—source data 6. Source data for .
Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by
Techniques: Binding Assay, Control, Two Tailed Test, Expressing, Cell Culture, Transfection, Plasmid Preparation, Muscles, Immunofluorescence, RNAscope, In Situ Hybridization
Journal: eLife
Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development
doi: 10.7554/eLife.80405
Figure Lengend Snippet: ( A–D ) Immunofluorescence of MyoD (red) in sagittal sections of control mouse head in the masseter region at E10.5 ( A ), E11.5 ( B ), E12.5 ( C ), and E13.5 ( D ). White arrows in A-D point to forming masseter. ( E and H ) Immunofluorescence of MyoD (red) and pSMAD2 (green) in sagittal sections of control mouse head in the masseter muscle region at E13.5. Boxed area in E is enlarged in H. The white arrow in H points to a positive signal. ( F–G and I–J ) RNAScope in situ hybridization for Myod1 (red) and Creb5 (green) ( F and I ) or Fgf18 (green) ( G and J ) in sagittal sections of control mouse heads at in the masseter region E13.5. Boxed areas in F and G are enlarged in H and I, respectively. White arrows in I and J point to positive signals. MA, masseter. N=3 for all experiments. Scale bars in A and E indicate 500 μm for A-D and E-F, respectively; scale bar in H indicates 100 μm in H-J.
Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by
Techniques: Immunofluorescence, Control, RNAscope, In Situ Hybridization
Journal: eLife
Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development
doi: 10.7554/eLife.80405
Figure Lengend Snippet: ( A–L ) H&E staining in coronal sections of LVP region at P0.5 from control and Osr2 Cre ;Fgf18 fl/fl mice. Boxed areas in A-D and E-H are enlarged in E-H, and I-L, respectively. Black arrows point to the palatal shelf in A-D and the LVP in E-H. Green dotted line outlined the LVP in E-H. Black and white triangles point to perpendicular muscle fibers in I-L and parallel fibers in I-J. The white dotted line indicates the boundaries of perpendicular and parallel fibers in E, F, I, and J. Double-ended arrows indicate the thickness of perpendicular fibers in I and J. N=4. ( M–Q ) Immunofluorescence and quantification of MHC (red) staining on coronal section of the LVP region of control Osr2 Cre ;Fgf18 fl/fl mice at P0.5. MHC+ areas in the LVP region for quantification of cross-section areas are outlined by white dashed lines in M-P. The percentage of MHC-stained area out of the whole image area is used for quantification in Q. *, p≤0.05. N=3. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( R–V ) CT scanning and quantitative analysis of the muscle volume of control and Osr2 Cre ;Tgfbr1 fl/fl LVP at P0.5. A representative reconstructed control LVP from CT scanning is indicated in yellow ( R and S ) and an Osr2 Cre ;Tgfbr1 fl/fl reconstructed LVP is indicated in teal ( T and U ). **, p≤0.01. N=4. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( W ) A 300 μm coronal slice of the LVP region at E14 from Osr2 Cre ;Fgf18 fl/fl mouse for slice culture following bead implantation. Arrows point to BSA- or FGF18-treated bead. ( X–Y ) Immunofluorescence of MyoD (red) in the coronal section of LVP region from Osr2 Cre ;Fgf18 fl/fl mouse cultured for 3 days with BSA bead ( X ) and FGF18 bead ( Y ). White circles indicate the location of the BSA beads in X and FGF18 beads in Y. N=3. Fgf18 fl/fl or Fgf18 fl/+ littermates were used as controls for Osr2 Cre ;Fgf18 fl/fl mice. Scale bars in A, E, I, M, R, S, and W indicate 500 μm in in A-D, 100 μm in E-H, 50 μm in I-L, 400 μm in M-P, 400 μm in R and T, 100 μm in S and U, and 100 μm in W-Y, respectively. Figure 7—source data 1. Source data for . Figure 7—source data 2. Source data for .
Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by
Techniques: Staining, Control, Immunofluorescence, Two Tailed Test, Cell Culture
Journal: eLife
Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development
doi: 10.7554/eLife.80405
Figure Lengend Snippet: ( A–J ) Immunofluorescence and quantification of MyoD (red) in coronal section of LVP region at E14.5 ( A–E ) and E16.5 ( F–J ) from control and Osr2 Cre ;Fgf18 fl/fl mice. Boxed areas in A, C, F, and H are enlarged in B, D, G, and I, respectively. White arrows in B, D, and G point to the presence of MyoD+ cells. The white asterisk in I indicates a decrease of MyoD+ cells in E16.5 Osr2 Cre ;Fgf18 fl/fl mice. Note that the myogenic cell numbers in E14.5 are comparable between control and Osr2 Cre ;Fgf18 fl/fl mice at E14.5 ( E ) but are significantly decreased in the mutant at E16.5 ( J ). *, p≤0.05; ns, not significant. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. Yellow dotted line outlines the myogenic regions where the qualification analysis was performed. ( K–N ) BaseScope in situ hybridizations of Fgf18 Exon1C (red) in the coronal section of LVP region at E14.5 from control and Osr2 Cre ;Fgf18 fl/fl mice. Boxed areas in K and M are enlarged in L and N, respectively. The white arrow in L points to a positive signal, and the asterisk in N points to a reduced signal. Left panel schematics depict the orientation and level of the sections. N=3 for all experiments. Fgf18 fl/fl or Fgf18 fl/+ littermates were used as controls for Osr2 Cre ;Fgf18 fl/fl mice. Scale bar in A indicates 500 μm in A, C, F, H, K, and M; scale bar in B indicates 100 μm in B, D, G, I, L, and N. Figure 7—figure supplement 1—source data 1. Source data for . Figure 7—figure supplement 1—source data 2. Source data for .
Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by
Techniques: Immunofluorescence, Control, Mutagenesis, Two Tailed Test, In Situ
Journal: eLife
Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development
doi: 10.7554/eLife.80405
Figure Lengend Snippet: ( A–F ) Immunofluorescence and RNAScope in situ hybridization for MyoD (red) and Caspase 3 ( A and D ), MyoD (red) and BrdU (green) ( B and E ), and Myf5 (red) and BrdU (green) (C and F) in coronal sections of LVP region at E14.5 from control and Osr2 Cre ;Fgf18 fl/fl mice. Insets are enlarged from the boxed areas. Yellow dotted line outlines the myogenic regions where the qualification analysis was performed. N=3. Fgf18 fl/fl or Fgf18 fl/+ littermates were used as controls for Osr2 Cre ;Fgf18 fl/fl mice. The schematic in the top right corner depicts the orientation and level of the section. ( G ) Quantification of the percentage of BrdU+/ My5 + double-positive cells out of the total Myf5 + cells in the LVP region from E14.5 control and Osr2 Cre ;Fgf18 fl/fl mice. **, p≤0.01. N=3. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( H–J ) Immunofluorescence and quantification of BrdU (red) staining on C12C12 myogenic ells following 1 day of treatment with BSA or 500 ng/ml FGF18. Proliferative rate is calculated by the percentage of BrdU+ cells out of the total number of cells. ***, p≤0.001. N=3. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. ( K ) Quantification of total number of C12C12 myogenic cells after culture for 3 days with BSA or 500 ng/ml FGF18. ***, p≤0.001. N=6. Statistical significance was assessed by unpaired t-test with two-tailed calculations. Data is presented as mean ± SEM. Scale bar in A indicates 100 μm for A-F and 30 μm for the insets in A-F; scale bar in H indicates 200 μm for H-I. Figure 7—figure supplement 2—source data 1. Source data for . Figure 7—figure supplement 2—source data 2. Source data for . Figure 7—figure supplement 2—source data 3. Source data for .
Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by
Techniques: Immunofluorescence, RNAscope, In Situ Hybridization, Control, Two Tailed Test, Staining
Journal: eLife
Article Title: TGF-β signaling and Creb5 cooperatively regulate Fgf18 to control pharyngeal muscle development
doi: 10.7554/eLife.80405
Figure Lengend Snippet:
Article Snippet: This gRNA sequence was then cloned to pCas-Guide-Puro-CRISPRi plasmid (GE100083, Origene Technologies) by
Techniques: Sequencing, RNAscope, Plasmid Preparation, Recombinant, Multiplex Assay, cDNA Synthesis, Software