p38 mapk Search Results


86
Sangon Biotech tctagcagagcacggatgtgtttg3
Tctagcagagcacggatgtgtttg3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tctagcagagcacggatgtgtttg3/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
tctagcagagcacggatgtgtttg3 - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc mouse monoclonal anti human p p38 mapk
Figure 5. Molecular analysis of the iPA-mediated effects on NK cells functions: evidence for an exclusive modulation of MAPK. (A) Puri- fied NK cells were treated with IL-2 alone or in combination with the indicated concentrations of iPA for 18 h (overnight). Representative blots (left) and quantitative/densitometric analysis (arbitrary units; right) of results from four different experiments are shown. All of the protein levels were calculated by normalizing the levels of p-ERK1/2, total ERK1/2 proteins, <t>p-p38,</t> total p38 protein, p-STAT5, and total STAT5 protein with the levels of -actin, which serves as internal load- ing control. The relative levels of specific p-ERK, p-p38, and p-STAT5 were then calculated by normalizing the levels of phosphorylated forms with the levels of their cognate proteins. All four experiments were performed in duplicate with similar results (ANOVA; *P0.05; **P0.01). (B) Representative WB (upper) and quantitative/densito- metric analysis (arbitrary units; lower) of results from three different experiments conducted on purified NK cells, stimulated with IL-2 alone or in combination with the indicated concentrations of iPA at different time-points from 30 min to 3 h are shown. All three experi- ments were performed with similar results (ANOVA; *P0.05; **P0.01).
Mouse Monoclonal Anti Human P P38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse monoclonal anti human p p38 mapk/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
mouse monoclonal anti human p p38 mapk - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc p38 mapk
Figure 3. A and B, Ang II increases <t>p38</t> <t>MAPK</t> and MK2 phosphorylation levels. VSMCs were stimulated with vehicle (Veh) or Ang II for 10 minutes. Representative Western blots of phosphorylated and total <t>p38</t> <t>MAPK</t> (A) and MK2 (B) and corresponding bar graphs are represented. C, VSMCs were transfected with a nontargeting control FITC-siRNA (siFITC) for 24 hours. Representative siFITC and 4,6- diamidino-2-phenylindole (DAPI) images are presented. D, MK2 siRNA transfection blunts Ang II–induced MK2 expression. VSMCs were transfected with siMK2 or negative control siRNA targeting luciferase (siLuc) and treated with Veh or Ang II for 24 hours. Repre- sentative Western blots of MK2 and bar graphs representing MK2 expression in different conditions are depicted. Results are meansSEM; n4 to 5; *P0.05 vs Veh for A and B and vs siLucVeh for D, and †P0.01 vs siLucAng II for D.
P38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p38 mapk/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
p38 mapk - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

99
Cell Signaling Technology Inc p38
Fig. 5. BI-1 regulates MAPKs during differentiation. (A) Total cell lysates from mES cells grown in the continuous presence of LIF or in the absence of LIF for the indicated time periods in days were analyzed by western blot with the antibodies as indicated: <t>phospho-p38,</t> <t>total-p38,</t> phospho-ERK, total-ERK, phospho-JNK, total-JNK, BCL-2, BAX, and CASPASE-3. (B) Inhibition of MEK/ERK phosphorylation in BI-1 mES cells was performed by adding the MEK inhibitor, PD98059 (10 μM). Phosphorylated ERK, total ERK, phosphorylated p38, and p38 were detected by western blot- ting. (C) At 4 days after LIF withdrawal, the sub-G1 contents of PD98059 or SB202190 (20 μM)-treated mES cells were analyzed by flow cytometry. Data are presented as mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values. (D) At 4 days after LIF withdrawal, gene expression levels of neuronal markers, Nestin and Tuj-1, were measured by quantitative real-time PCR in mES cells treated with or without kinase inhibitors (10 μM PD98059 or 20 μM SB202190). Data are represented as the mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values.
P38, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p38/product/Cell Signaling Technology Inc
Average 99 stars, based on 1 article reviews
p38 - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc rabbit anti human phosphorylated p38 mapk
Fig. 5. BI-1 regulates MAPKs during differentiation. (A) Total cell lysates from mES cells grown in the continuous presence of LIF or in the absence of LIF for the indicated time periods in days were analyzed by western blot with the antibodies as indicated: <t>phospho-p38,</t> <t>total-p38,</t> phospho-ERK, total-ERK, phospho-JNK, total-JNK, BCL-2, BAX, and CASPASE-3. (B) Inhibition of MEK/ERK phosphorylation in BI-1 mES cells was performed by adding the MEK inhibitor, PD98059 (10 μM). Phosphorylated ERK, total ERK, phosphorylated p38, and p38 were detected by western blot- ting. (C) At 4 days after LIF withdrawal, the sub-G1 contents of PD98059 or SB202190 (20 μM)-treated mES cells were analyzed by flow cytometry. Data are presented as mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values. (D) At 4 days after LIF withdrawal, gene expression levels of neuronal markers, Nestin and Tuj-1, were measured by quantitative real-time PCR in mES cells treated with or without kinase inhibitors (10 μM PD98059 or 20 μM SB202190). Data are represented as the mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values.
Rabbit Anti Human Phosphorylated P38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti human phosphorylated p38 mapk/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
rabbit anti human phosphorylated p38 mapk - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc p38 mapk sirna
Fig. 5. BI-1 regulates MAPKs during differentiation. (A) Total cell lysates from mES cells grown in the continuous presence of LIF or in the absence of LIF for the indicated time periods in days were analyzed by western blot with the antibodies as indicated: <t>phospho-p38,</t> <t>total-p38,</t> phospho-ERK, total-ERK, phospho-JNK, total-JNK, BCL-2, BAX, and CASPASE-3. (B) Inhibition of MEK/ERK phosphorylation in BI-1 mES cells was performed by adding the MEK inhibitor, PD98059 (10 μM). Phosphorylated ERK, total ERK, phosphorylated p38, and p38 were detected by western blot- ting. (C) At 4 days after LIF withdrawal, the sub-G1 contents of PD98059 or SB202190 (20 μM)-treated mES cells were analyzed by flow cytometry. Data are presented as mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values. (D) At 4 days after LIF withdrawal, gene expression levels of neuronal markers, Nestin and Tuj-1, were measured by quantitative real-time PCR in mES cells treated with or without kinase inhibitors (10 μM PD98059 or 20 μM SB202190). Data are represented as the mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values.
P38 Mapk Sirna, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p38 mapk sirna/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
p38 mapk sirna - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

97
Cell Signaling Technology Inc phospho p38 mapk thr180 tyr182
BCG infection leads to increased expression of autophagy‐ and apoptosis‐related proteins in iMacs. Representative sample of Western blot analyses and respective densitometric analysis investigating expression of (a) Beclin‐1, (b) LC3B, (c) <t>p38</t> phosphorylation, (d) c‐Jun N‐terminal kinase (JNK) phosphorylation and (e) Bax expression in iMacs and MDMs following BCG infection with an MOI of 10:1 at various time points. Data (a) – (e) are presented as mean ± SD of at least three independent experiments, presented as fold change relative to non‐infected cells as control. Statistical significance was determined using Mann–Whitney U test (* indicates P < 0.0332).
Phospho P38 Mapk Thr180 Tyr182, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phospho p38 mapk thr180 tyr182/product/Cell Signaling Technology Inc
Average 97 stars, based on 1 article reviews
phospho p38 mapk thr180 tyr182 - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc phosphoplus p38 mapk antibody duet
BCG infection leads to increased expression of autophagy‐ and apoptosis‐related proteins in iMacs. Representative sample of Western blot analyses and respective densitometric analysis investigating expression of (a) Beclin‐1, (b) LC3B, (c) <t>p38</t> phosphorylation, (d) c‐Jun N‐terminal kinase (JNK) phosphorylation and (e) Bax expression in iMacs and MDMs following BCG infection with an MOI of 10:1 at various time points. Data (a) – (e) are presented as mean ± SD of at least three independent experiments, presented as fold change relative to non‐infected cells as control. Statistical significance was determined using Mann–Whitney U test (* indicates P < 0.0332).
Phosphoplus P38 Mapk Antibody Duet, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phosphoplus p38 mapk antibody duet/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
phosphoplus p38 mapk antibody duet - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc ab 2099709 p p38 t180 y182
BCG infection leads to increased expression of autophagy‐ and apoptosis‐related proteins in iMacs. Representative sample of Western blot analyses and respective densitometric analysis investigating expression of (a) Beclin‐1, (b) LC3B, (c) <t>p38</t> phosphorylation, (d) c‐Jun N‐terminal kinase (JNK) phosphorylation and (e) Bax expression in iMacs and MDMs following BCG infection with an MOI of 10:1 at various time points. Data (a) – (e) are presented as mean ± SD of at least three independent experiments, presented as fold change relative to non‐infected cells as control. Statistical significance was determined using Mann–Whitney U test (* indicates P < 0.0332).
Ab 2099709 P P38 T180 Y182, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ab 2099709 p p38 t180 y182/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
ab 2099709 p p38 t180 y182 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

96
Proteintech p38 66234 1 ig mouse
BCG infection leads to increased expression of autophagy‐ and apoptosis‐related proteins in iMacs. Representative sample of Western blot analyses and respective densitometric analysis investigating expression of (a) Beclin‐1, (b) LC3B, (c) <t>p38</t> phosphorylation, (d) c‐Jun N‐terminal kinase (JNK) phosphorylation and (e) Bax expression in iMacs and MDMs following BCG infection with an MOI of 10:1 at various time points. Data (a) – (e) are presented as mean ± SD of at least three independent experiments, presented as fold change relative to non‐infected cells as control. Statistical significance was determined using Mann–Whitney U test (* indicates P < 0.0332).
P38 66234 1 Ig Mouse, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p38 66234 1 ig mouse/product/Proteintech
Average 96 stars, based on 1 article reviews
p38 66234 1 ig mouse - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc dictyoptera
BCG infection leads to increased expression of autophagy‐ and apoptosis‐related proteins in iMacs. Representative sample of Western blot analyses and respective densitometric analysis investigating expression of (a) Beclin‐1, (b) LC3B, (c) <t>p38</t> phosphorylation, (d) c‐Jun N‐terminal kinase (JNK) phosphorylation and (e) Bax expression in iMacs and MDMs following BCG infection with an MOI of 10:1 at various time points. Data (a) – (e) are presented as mean ± SD of at least three independent experiments, presented as fold change relative to non‐infected cells as control. Statistical significance was determined using Mann–Whitney U test (* indicates P < 0.0332).
Dictyoptera, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dictyoptera/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
dictyoptera - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc anti mouse p p38
BCG infection leads to increased expression of autophagy‐ and apoptosis‐related proteins in iMacs. Representative sample of Western blot analyses and respective densitometric analysis investigating expression of (a) Beclin‐1, (b) LC3B, (c) <t>p38</t> phosphorylation, (d) c‐Jun N‐terminal kinase (JNK) phosphorylation and (e) Bax expression in iMacs and MDMs following BCG infection with an MOI of 10:1 at various time points. Data (a) – (e) are presented as mean ± SD of at least three independent experiments, presented as fold change relative to non‐infected cells as control. Statistical significance was determined using Mann–Whitney U test (* indicates P < 0.0332).
Anti Mouse P P38, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti mouse p p38/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
anti mouse p p38 - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

Image Search Results


Figure 5. Molecular analysis of the iPA-mediated effects on NK cells functions: evidence for an exclusive modulation of MAPK. (A) Puri- fied NK cells were treated with IL-2 alone or in combination with the indicated concentrations of iPA for 18 h (overnight). Representative blots (left) and quantitative/densitometric analysis (arbitrary units; right) of results from four different experiments are shown. All of the protein levels were calculated by normalizing the levels of p-ERK1/2, total ERK1/2 proteins, p-p38, total p38 protein, p-STAT5, and total STAT5 protein with the levels of -actin, which serves as internal load- ing control. The relative levels of specific p-ERK, p-p38, and p-STAT5 were then calculated by normalizing the levels of phosphorylated forms with the levels of their cognate proteins. All four experiments were performed in duplicate with similar results (ANOVA; *P0.05; **P0.01). (B) Representative WB (upper) and quantitative/densito- metric analysis (arbitrary units; lower) of results from three different experiments conducted on purified NK cells, stimulated with IL-2 alone or in combination with the indicated concentrations of iPA at different time-points from 30 min to 3 h are shown. All three experi- ments were performed with similar results (ANOVA; *P0.05; **P0.01).

Journal: Journal of leukocyte biology

Article Title: N6-isopentenyladenosine, an endogenous isoprenoid end product, directly affects cytotoxic and regulatory functions of human NK cells through FDPS modulation.

doi: 10.1189/jlb.0413190

Figure Lengend Snippet: Figure 5. Molecular analysis of the iPA-mediated effects on NK cells functions: evidence for an exclusive modulation of MAPK. (A) Puri- fied NK cells were treated with IL-2 alone or in combination with the indicated concentrations of iPA for 18 h (overnight). Representative blots (left) and quantitative/densitometric analysis (arbitrary units; right) of results from four different experiments are shown. All of the protein levels were calculated by normalizing the levels of p-ERK1/2, total ERK1/2 proteins, p-p38, total p38 protein, p-STAT5, and total STAT5 protein with the levels of -actin, which serves as internal load- ing control. The relative levels of specific p-ERK, p-p38, and p-STAT5 were then calculated by normalizing the levels of phosphorylated forms with the levels of their cognate proteins. All four experiments were performed in duplicate with similar results (ANOVA; *P0.05; **P0.01). (B) Representative WB (upper) and quantitative/densito- metric analysis (arbitrary units; lower) of results from three different experiments conducted on purified NK cells, stimulated with IL-2 alone or in combination with the indicated concentrations of iPA at different time-points from 30 min to 3 h are shown. All three experi- ments were performed with similar results (ANOVA; *P0.05; **P0.01).

Article Snippet: The following antibodies were used: mouse monoclonal anti-human panRas was purchased from Sigma-Aldrich or Cytoskeleton; rabbit monoclonal anti-human p-STAT5 (Tyr 694), rabbit polyclonal anti-human STAT5, rabbit monoclonal anti-human p-p44/42 MAPK (p-ERK, Thr202/Tyr 204), rabbit monoclonal anti-human p44/42 MAPK, mouse monoclonal anti-human p-p38 MAPK (Thr180/Tyr182), and rabbit monoclonal anti-human p38 MAPK were purchased from Cell Signaling Technology; rabbit polyclonal anti-human -actin and rabbit polyoclonal anti-human FDPS were purchased from Abcam (Cambridge, UK).

Techniques: Control

Figure 3. A and B, Ang II increases p38 MAPK and MK2 phosphorylation levels. VSMCs were stimulated with vehicle (Veh) or Ang II for 10 minutes. Representative Western blots of phosphorylated and total p38 MAPK (A) and MK2 (B) and corresponding bar graphs are represented. C, VSMCs were transfected with a nontargeting control FITC-siRNA (siFITC) for 24 hours. Representative siFITC and 4,6- diamidino-2-phenylindole (DAPI) images are presented. D, MK2 siRNA transfection blunts Ang II–induced MK2 expression. VSMCs were transfected with siMK2 or negative control siRNA targeting luciferase (siLuc) and treated with Veh or Ang II for 24 hours. Repre- sentative Western blots of MK2 and bar graphs representing MK2 expression in different conditions are depicted. Results are meansSEM; n4 to 5; *P0.05 vs Veh for A and B and vs siLucVeh for D, and †P0.01 vs siLucAng II for D.

Journal: Hypertension

Article Title: Mitogen-Activated Protein Kinase–Activated Protein Kinase 2 in Angiotensin II–Induced Inflammation and Hypertension

doi: 10.1161/hypertensionaha.110.159889

Figure Lengend Snippet: Figure 3. A and B, Ang II increases p38 MAPK and MK2 phosphorylation levels. VSMCs were stimulated with vehicle (Veh) or Ang II for 10 minutes. Representative Western blots of phosphorylated and total p38 MAPK (A) and MK2 (B) and corresponding bar graphs are represented. C, VSMCs were transfected with a nontargeting control FITC-siRNA (siFITC) for 24 hours. Representative siFITC and 4,6- diamidino-2-phenylindole (DAPI) images are presented. D, MK2 siRNA transfection blunts Ang II–induced MK2 expression. VSMCs were transfected with siMK2 or negative control siRNA targeting luciferase (siLuc) and treated with Veh or Ang II for 24 hours. Repre- sentative Western blots of MK2 and bar graphs representing MK2 expression in different conditions are depicted. Results are meansSEM; n4 to 5; *P0.05 vs Veh for A and B and vs siLucVeh for D, and †P0.01 vs siLucAng II for D.

Article Snippet: Total or fractioned proteins (15 to 20 g) were extracted from VSMCs, separated by SDS-PAGE, transferred to nitrocellulose membranes, and incubated overnight at 4°C with antibodies (1:1000) against the following: MK2, p38 MAPK, and NF- B p65 subunit (from Cell Signaling Technology), and ICAM-1, VCAM-1, Ets-1, and p47phox (from Santa Cruz Biotechnology).

Techniques: Phospho-proteomics, Western Blot, Transfection, Control, Expressing, Negative Control, Luciferase

Fig. 5. BI-1 regulates MAPKs during differentiation. (A) Total cell lysates from mES cells grown in the continuous presence of LIF or in the absence of LIF for the indicated time periods in days were analyzed by western blot with the antibodies as indicated: phospho-p38, total-p38, phospho-ERK, total-ERK, phospho-JNK, total-JNK, BCL-2, BAX, and CASPASE-3. (B) Inhibition of MEK/ERK phosphorylation in BI-1 mES cells was performed by adding the MEK inhibitor, PD98059 (10 μM). Phosphorylated ERK, total ERK, phosphorylated p38, and p38 were detected by western blot- ting. (C) At 4 days after LIF withdrawal, the sub-G1 contents of PD98059 or SB202190 (20 μM)-treated mES cells were analyzed by flow cytometry. Data are presented as mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values. (D) At 4 days after LIF withdrawal, gene expression levels of neuronal markers, Nestin and Tuj-1, were measured by quantitative real-time PCR in mES cells treated with or without kinase inhibitors (10 μM PD98059 or 20 μM SB202190). Data are represented as the mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values.

Journal: Biochimica et biophysica acta

Article Title: Bax inhibitor-1 enhances survival and neuronal differentiation of embryonic stem cells via differential regulation of mitogen-activated protein kinases activities.

doi: 10.1016/j.bbamcr.2012.08.005

Figure Lengend Snippet: Fig. 5. BI-1 regulates MAPKs during differentiation. (A) Total cell lysates from mES cells grown in the continuous presence of LIF or in the absence of LIF for the indicated time periods in days were analyzed by western blot with the antibodies as indicated: phospho-p38, total-p38, phospho-ERK, total-ERK, phospho-JNK, total-JNK, BCL-2, BAX, and CASPASE-3. (B) Inhibition of MEK/ERK phosphorylation in BI-1 mES cells was performed by adding the MEK inhibitor, PD98059 (10 μM). Phosphorylated ERK, total ERK, phosphorylated p38, and p38 were detected by western blot- ting. (C) At 4 days after LIF withdrawal, the sub-G1 contents of PD98059 or SB202190 (20 μM)-treated mES cells were analyzed by flow cytometry. Data are presented as mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values. (D) At 4 days after LIF withdrawal, gene expression levels of neuronal markers, Nestin and Tuj-1, were measured by quantitative real-time PCR in mES cells treated with or without kinase inhibitors (10 μM PD98059 or 20 μM SB202190). Data are represented as the mean±S.E.M. from at least three independent experiments. *Pb0.01 compared with the corresponding control values.

Article Snippet: The membranes were blocked in 5% non-fat dry milk in Tris-buffered saline and immunostained with primary antibodies against HA, phospho-ERK1/2, β-ACTIN, phospho-p38 (Santa Cruz Biotechnology, CA, USA), total-JNK, phospho-JNK, total-ERK1/2, total-p38, and CASPASE-3 (Cell Signaling, Danvers, MA, USA).

Techniques: Western Blot, Inhibition, Phospho-proteomics, Cytometry, Control, Gene Expression, Real-time Polymerase Chain Reaction

BCG infection leads to increased expression of autophagy‐ and apoptosis‐related proteins in iMacs. Representative sample of Western blot analyses and respective densitometric analysis investigating expression of (a) Beclin‐1, (b) LC3B, (c) p38 phosphorylation, (d) c‐Jun N‐terminal kinase (JNK) phosphorylation and (e) Bax expression in iMacs and MDMs following BCG infection with an MOI of 10:1 at various time points. Data (a) – (e) are presented as mean ± SD of at least three independent experiments, presented as fold change relative to non‐infected cells as control. Statistical significance was determined using Mann–Whitney U test (* indicates P < 0.0332).

Journal: Clinical & Translational Immunology

Article Title: Immune activation and response dynamics of human iPSC ‐derived macrophages in tuberculosis infection models

doi: 10.1002/cti2.70071

Figure Lengend Snippet: BCG infection leads to increased expression of autophagy‐ and apoptosis‐related proteins in iMacs. Representative sample of Western blot analyses and respective densitometric analysis investigating expression of (a) Beclin‐1, (b) LC3B, (c) p38 phosphorylation, (d) c‐Jun N‐terminal kinase (JNK) phosphorylation and (e) Bax expression in iMacs and MDMs following BCG infection with an MOI of 10:1 at various time points. Data (a) – (e) are presented as mean ± SD of at least three independent experiments, presented as fold change relative to non‐infected cells as control. Statistical significance was determined using Mann–Whitney U test (* indicates P < 0.0332).

Article Snippet: : LC3B (Sigma Aldrich L7543, rabbit IgG), Beclin‐1 (Cell Signaling 3495, rabbit polyclonal), phospho‐p38 MAPK (Thr180/Tyr182) (Cell Signaling 9211, rabbit polyclonal), phospho‐SAPK/JNK (Thr183/Tyr185) (Cell Signaling 9251, rabbit polyclonal) and Bax (Cell Signaling 2772, rabbit polyclonal).

Techniques: Infection, Expressing, Western Blot, Phospho-proteomics, Control, MANN-WHITNEY