|
Sangon Biotech
tctagcagagcacggatgtgtttg3 Tctagcagagcacggatgtgtttg3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tctagcagagcacggatgtgtttg3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
tctagcagagcacggatgtgtttg3 - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
total p38 ![]() Total P38, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/total p38/product/Cell Signaling Technology Inc Average 99 stars, based on 1 article reviews
total p38 - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
phospho p38 mapk thr180 tyr182 ![]() Phospho P38 Mapk Thr180 Tyr182, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phospho p38 mapk thr180 tyr182/product/Cell Signaling Technology Inc Average 97 stars, based on 1 article reviews
phospho p38 mapk thr180 tyr182 - by Bioz Stars,
2026-06
97/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
p38 mapk ![]() P38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/p38 mapk/product/Cell Signaling Technology Inc Average 96 stars, based on 1 article reviews
p38 mapk - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
rabbit anti human phosphorylated p38 mapk ![]() Rabbit Anti Human Phosphorylated P38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti human phosphorylated p38 mapk/product/Cell Signaling Technology Inc Average 96 stars, based on 1 article reviews
rabbit anti human phosphorylated p38 mapk - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
p38 mapk sirna ![]() P38 Mapk Sirna, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/p38 mapk sirna/product/Cell Signaling Technology Inc Average 93 stars, based on 1 article reviews
p38 mapk sirna - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
mouse monoclonal anti human p p38 mapk ![]() Mouse Monoclonal Anti Human P P38 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse monoclonal anti human p p38 mapk/product/Cell Signaling Technology Inc Average 96 stars, based on 1 article reviews
mouse monoclonal anti human p p38 mapk - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
phosphoplus p38 mapk antibody duet ![]() Phosphoplus P38 Mapk Antibody Duet, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phosphoplus p38 mapk antibody duet/product/Cell Signaling Technology Inc Average 93 stars, based on 1 article reviews
phosphoplus p38 mapk antibody duet - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
ab 2099709 p p38 t180 y182 ![]() Ab 2099709 P P38 T180 Y182, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ab 2099709 p p38 t180 y182/product/Cell Signaling Technology Inc Average 96 stars, based on 1 article reviews
ab 2099709 p p38 t180 y182 - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Proteintech
p38 66234 1 ig mouse ![]() P38 66234 1 Ig Mouse, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/p38 66234 1 ig mouse/product/Proteintech Average 96 stars, based on 1 article reviews
p38 66234 1 ig mouse - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
dictyoptera ![]() Dictyoptera, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dictyoptera/product/Cell Signaling Technology Inc Average 93 stars, based on 1 article reviews
dictyoptera - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti mouse p p38 ![]() Anti Mouse P P38, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti mouse p p38/product/Cell Signaling Technology Inc Average 94 stars, based on 1 article reviews
anti mouse p p38 - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLoS Pathogens
Article Title: Type I Interferon Induction Is Detrimental during Infection with the Whipple's Disease Bacterium, Tropheryma whipplei
doi: 10.1371/journal.ppat.1000722
Figure Lengend Snippet: (A) BMDM were stimulated with LPS (100 ng/ml) or T. whipplei (MOI 50∶1) for the indicated time points, and lysates were analyzed by immunoblotting. IκBα blots were stripped and reprobed for ERK as loading control. One representative experiment is shown ( n = 3). (B) BMDM were stimulated for 1 h with LPS (100 ng/ml) or T. whipplei (MOI 50∶1 or 200∶1). RelA nuclear translocation was determined by immunofluorescence using p65-specific antibodies. (C) BMDM were stimulated with LPS (100 ng/ml) or T. whipplei (MOI 50∶1) for the indicated time points, and lysates were analyzed by immunoblotting. Phospho-p38, phospho-ERK and Phospho-JNK blots were stripped and reprobed for p38 and ERK as loading controls. One representative experiment is shown ( n = 3).
Article Snippet: The membranes were blocked in PBS with 0.05% Tween 20 (PBST) supplemented with 3% powdered milk and then incubated with primary Abs against phospho-p38,
Techniques: Western Blot, Translocation Assay, Immunofluorescence
Journal: PLoS Pathogens
Article Title: Type I Interferon Induction Is Detrimental during Infection with the Whipple's Disease Bacterium, Tropheryma whipplei
doi: 10.1371/journal.ppat.1000722
Figure Lengend Snippet: (A) RAW cells were transiently transfected with IRF3-EGFP before stimulation with T. whipplei (MOI 50∶1) for 4 h. Nuclei were stained with DAPI. (B) RAW cells were transiently transfected with IRF3-specific siRNA (si-IRF3), control scramble siRNA (si-SCR) or left untransfected (control) 24 h before stimulation with T. whipplei (MOI 50∶1). IFN-β expression was monitored after 6 h using qRT-PCR. Results are expressed as the ratio of expression levels in infected cells vs. uninfected cells relative to β actin). (C) BMDM from wild-type and MyD88/TRIF −/− mice were stimulated with T. whipplei (MOI 50∶1) for 6 h and IFN-β expression was monitored using qRT-PCR. Results are expressed as the ratio of expression levels in infected cells vs. uninfected cells relative to β actin). (D) BMDM from wild-type and IFNAR1 −/− mice were stimulated for indicated time points with T. whipplei (MOI 50∶1), and lysates were analyzed by immunoblotting. Phospho-STAT1 blots were stripped and reprobed for p38 as loading control. One representative experiment is shown ( n = 3). (E) BMDM from wild-type and IFNAR1 −/− mice were stimulated with T. whipplei (MOI 50∶1) for 6 h and host responses were monitored using qRT-PCR on indicated genes. Results are expressed as the ratio of expression levels in infected cells vs. uninfected cells relative to β actin). (F) BMDM were stimulated with live and heat-killed T. whipplei (MOI 50∶1) for 6 h and host responses were monitored by qRT-PCR on indicated genes. Results are expressed as the ratio of expression levels in infected cells vs uninfected cells relative to beta actin.
Article Snippet: The membranes were blocked in PBS with 0.05% Tween 20 (PBST) supplemented with 3% powdered milk and then incubated with primary Abs against phospho-p38,
Techniques: Transfection, Staining, Expressing, Quantitative RT-PCR, Infection, Western Blot
Journal: PLoS Pathogens
Article Title: Type I Interferon Induction Is Detrimental during Infection with the Whipple's Disease Bacterium, Tropheryma whipplei
doi: 10.1371/journal.ppat.1000722
Figure Lengend Snippet: (A) BMDM from wild-type and IFNAR1 −/− mice were stimulated with T. whipplei (MOI 50∶1) for indicated time points, and lysates were analyzed by immunoblotting. Phospho-p38, phospho-ERK and phospho-JNK blots were stripped and reprobed for tubulin as loading controls. One representative experiment is shown ( n = 3). (B) Densitometry values of the phospho-p38, phospho-ERK and phospho-JNK autoradiographs were normalized to tubulin.
Article Snippet: The membranes were blocked in PBS with 0.05% Tween 20 (PBST) supplemented with 3% powdered milk and then incubated with primary Abs against phospho-p38,
Techniques: Western Blot
Journal: Clinical & Translational Immunology
Article Title: Immune activation and response dynamics of human iPSC ‐derived macrophages in tuberculosis infection models
doi: 10.1002/cti2.70071
Figure Lengend Snippet: BCG infection leads to increased expression of autophagy‐ and apoptosis‐related proteins in iMacs. Representative sample of Western blot analyses and respective densitometric analysis investigating expression of (a) Beclin‐1, (b) LC3B, (c) p38 phosphorylation, (d) c‐Jun N‐terminal kinase (JNK) phosphorylation and (e) Bax expression in iMacs and MDMs following BCG infection with an MOI of 10:1 at various time points. Data (a) – (e) are presented as mean ± SD of at least three independent experiments, presented as fold change relative to non‐infected cells as control. Statistical significance was determined using Mann–Whitney U test (* indicates P < 0.0332).
Article Snippet: : LC3B (Sigma Aldrich L7543, rabbit IgG), Beclin‐1 (Cell Signaling 3495, rabbit polyclonal),
Techniques: Infection, Expressing, Western Blot, Phospho-proteomics, Control, MANN-WHITNEY
Journal: Hypertension
Article Title: Mitogen-Activated Protein Kinase–Activated Protein Kinase 2 in Angiotensin II–Induced Inflammation and Hypertension
doi: 10.1161/hypertensionaha.110.159889
Figure Lengend Snippet: Figure 3. A and B, Ang II increases p38 MAPK and MK2 phosphorylation levels. VSMCs were stimulated with vehicle (Veh) or Ang II for 10 minutes. Representative Western blots of phosphorylated and total p38 MAPK (A) and MK2 (B) and corresponding bar graphs are represented. C, VSMCs were transfected with a nontargeting control FITC-siRNA (siFITC) for 24 hours. Representative siFITC and 4,6- diamidino-2-phenylindole (DAPI) images are presented. D, MK2 siRNA transfection blunts Ang II–induced MK2 expression. VSMCs were transfected with siMK2 or negative control siRNA targeting luciferase (siLuc) and treated with Veh or Ang II for 24 hours. Repre- sentative Western blots of MK2 and bar graphs representing MK2 expression in different conditions are depicted. Results are meansSEM; n4 to 5; *P0.05 vs Veh for A and B and vs siLucVeh for D, and †P0.01 vs siLucAng II for D.
Article Snippet: Total or fractioned proteins (15 to 20 g) were extracted from VSMCs, separated by SDS-PAGE, transferred to nitrocellulose membranes, and incubated overnight at 4°C with antibodies (1:1000) against the following: MK2,
Techniques: Phospho-proteomics, Western Blot, Transfection, Control, Expressing, Negative Control, Luciferase
Journal: Journal of leukocyte biology
Article Title: N6-isopentenyladenosine, an endogenous isoprenoid end product, directly affects cytotoxic and regulatory functions of human NK cells through FDPS modulation.
doi: 10.1189/jlb.0413190
Figure Lengend Snippet: Figure 5. Molecular analysis of the iPA-mediated effects on NK cells functions: evidence for an exclusive modulation of MAPK. (A) Puri- fied NK cells were treated with IL-2 alone or in combination with the indicated concentrations of iPA for 18 h (overnight). Representative blots (left) and quantitative/densitometric analysis (arbitrary units; right) of results from four different experiments are shown. All of the protein levels were calculated by normalizing the levels of p-ERK1/2, total ERK1/2 proteins, p-p38, total p38 protein, p-STAT5, and total STAT5 protein with the levels of -actin, which serves as internal load- ing control. The relative levels of specific p-ERK, p-p38, and p-STAT5 were then calculated by normalizing the levels of phosphorylated forms with the levels of their cognate proteins. All four experiments were performed in duplicate with similar results (ANOVA; *P0.05; **P0.01). (B) Representative WB (upper) and quantitative/densito- metric analysis (arbitrary units; lower) of results from three different experiments conducted on purified NK cells, stimulated with IL-2 alone or in combination with the indicated concentrations of iPA at different time-points from 30 min to 3 h are shown. All three experi- ments were performed with similar results (ANOVA; *P0.05; **P0.01).
Article Snippet: The following antibodies were used: mouse monoclonal anti-human panRas was purchased from Sigma-Aldrich or Cytoskeleton; rabbit monoclonal anti-human p-STAT5 (Tyr 694), rabbit polyclonal anti-human STAT5, rabbit monoclonal anti-human p-p44/42 MAPK (p-ERK, Thr202/Tyr 204), rabbit monoclonal anti-human p44/42 MAPK,
Techniques: Control