Journal: World Journal of Surgical Oncology

Article Title: P2RX4 promotes hepatocellular carcinoma progression via calcium-mediated PI3K/AKT activation and immune remodeling

doi: 10.1186/s12957-025-04023-6

Figure Lengend Snippet: P2RX4 Expression Levels and Their Clinical Relevance in HCC. A The TIMER database was used to examine P2RX4 expression across multiple tumor types. B Heatmap illustrating the relationship between P2RX4 expression and clinicopathological characteristics. C , D Differential analysis of P2RX4 expression levels in HCC tissues versus matched adjacent normal tissues. E – K Correlation analysis of P2RX4 expression with key clinical parameters, including patient age, gender, histological grade, and TNM staging

Article Snippet: The IHC protocol encompassed tissue microarray preparation, sectioning, antigen extraction, incubation with Anti-P2RX4(1:150, Proteintech, 13534-1-AP, China) at 4 °C, secondary antibody incubation, and chromogenic development.

Techniques: Expressing

Journal: World Journal of Surgical Oncology

Article Title: P2RX4 promotes hepatocellular carcinoma progression via calcium-mediated PI3K/AKT activation and immune remodeling

doi: 10.1186/s12957-025-04023-6

Figure Lengend Snippet: Prognostic Value of P2RX4 in Hepatocellular Carcinoma. A , B Survival differences (OS, DFS) stratified by P2RX4 expression shown via Kaplan–Meier curves. C ROC curves for evaluating the prognostic value of P2RX4 over time (1, 3, 5 years). D , E Forest plots presenting the results of univariable and multivariable Cox regression analyses. F Nomogram integrating P2RX4 expression and clinical variables to predict 1-, 3-, and 5-year survival probabilities. G Calibration curves illustrating the match between predicted and real survival rates. H ROC of nomogram demonstrating time-specific predictive performance. I DCA was performed to illustrate the net benefit of the nomogram across a range of thresholds

Article Snippet: The IHC protocol encompassed tissue microarray preparation, sectioning, antigen extraction, incubation with Anti-P2RX4(1:150, Proteintech, 13534-1-AP, China) at 4 °C, secondary antibody incubation, and chromogenic development.

Techniques: Expressing

Journal: World Journal of Surgical Oncology

Article Title: P2RX4 promotes hepatocellular carcinoma progression via calcium-mediated PI3K/AKT activation and immune remodeling

doi: 10.1186/s12957-025-04023-6

Figure Lengend Snippet: P2RX4 expression in HCC and adjacent tissues. A P2RX4 IHC staining in HCC tumor and matched adjacent tissues. B Differential expression of P2RX4 between tumor and adjacent tissues. C Paired comparison of P2RX4 expression in tumor and adjacent tissues

Article Snippet: The IHC protocol encompassed tissue microarray preparation, sectioning, antigen extraction, incubation with Anti-P2RX4(1:150, Proteintech, 13534-1-AP, China) at 4 °C, secondary antibody incubation, and chromogenic development.

Techniques: Expressing, Immunohistochemistry, Quantitative Proteomics, Comparison

Journal: World Journal of Surgical Oncology

Article Title: P2RX4 promotes hepatocellular carcinoma progression via calcium-mediated PI3K/AKT activation and immune remodeling

doi: 10.1186/s12957-025-04023-6

Figure Lengend Snippet: Biological functions of P2RX4 in HCC cells. A P2RX4 expression in various HCC Cell . B Efficiency of P2RX4 knockdown via shRNA. C CCK-8 assay showing changes in cell proliferation. D Quantification of clonogenic potential via colony formation assay. E Evaluation of invasive capacity using Transwell migration chambers

Article Snippet: The IHC protocol encompassed tissue microarray preparation, sectioning, antigen extraction, incubation with Anti-P2RX4(1:150, Proteintech, 13534-1-AP, China) at 4 °C, secondary antibody incubation, and chromogenic development.

Techniques: Expressing, Knockdown, shRNA, CCK-8 Assay, Colony Assay, Migration

Journal: World Journal of Surgical Oncology

Article Title: P2RX4 promotes hepatocellular carcinoma progression via calcium-mediated PI3K/AKT activation and immune remodeling

doi: 10.1186/s12957-025-04023-6

Figure Lengend Snippet: Transcriptomic and functional enrichment analysis of P2RX4 knockdown in Huh7 cells. A Heatmap displaying DEGs between sh-P2RX4 and sh-NC Huh7 cells. B Volcano plot highlighting significantly upregulated and downregulated DEGs. C KEGG pathway enrichment analysis showing involvement in tumor-related pathways, including PI3K-Akt signaling. D GO enrichment analysis categorized by BP, CC, and MF

Article Snippet: The IHC protocol encompassed tissue microarray preparation, sectioning, antigen extraction, incubation with Anti-P2RX4(1:150, Proteintech, 13534-1-AP, China) at 4 °C, secondary antibody incubation, and chromogenic development.

Techniques: Functional Assay, Knockdown

Journal: World Journal of Surgical Oncology

Article Title: P2RX4 promotes hepatocellular carcinoma progression via calcium-mediated PI3K/AKT activation and immune remodeling

doi: 10.1186/s12957-025-04023-6

Figure Lengend Snippet: P2RX4 knockdown reduces intracellular calcium levels and inhibits PI3K/AKT signaling in HCC cells. A - D Concentrations of intracellular Ca²⁺, K⁺, Na⁺, and Mg²⁺ in Huh7 cells were measured by ICP-OES after P2RX4 knockdown. E - H Concentrations of intracellular Ca²⁺, K⁺, Na⁺, and Mg²⁺ in Hep3B cells were similarly assessed. I - J Western blot analysis and quantitative evaluation of phosphorylated AKT (p-AKT), total AKT, phosphorylated PI3K (p-PI3K), and total PI3K levels in Huh7 and Hep3B cells following P2RX4 knockdown

Article Snippet: The IHC protocol encompassed tissue microarray preparation, sectioning, antigen extraction, incubation with Anti-P2RX4(1:150, Proteintech, 13534-1-AP, China) at 4 °C, secondary antibody incubation, and chromogenic development.

Techniques: Knockdown, Western Blot

Journal: World Journal of Surgical Oncology

Article Title: P2RX4 promotes hepatocellular carcinoma progression via calcium-mediated PI3K/AKT activation and immune remodeling

doi: 10.1186/s12957-025-04023-6

Figure Lengend Snippet: Association Between P2RX4 Expression and Tumor Immunity in HCC. A Correlation of P2RX4 with immune and ESTIMATE scores. B Association with tumor-infiltrating immune cells. C – E Correlations with M0 macrophages, regulatory T cells (Tregs), and monocytes. F , G Correlation with immune checkpoint genes. H TIDE score comparison. I Sankey diagram for immunotherapy response. J Correlation between P2RX4 and TIDE score

Article Snippet: The IHC protocol encompassed tissue microarray preparation, sectioning, antigen extraction, incubation with Anti-P2RX4(1:150, Proteintech, 13534-1-AP, China) at 4 °C, secondary antibody incubation, and chromogenic development.

Techniques: Expressing, Comparison

Journal: Frontiers in Oncology

Article Title: Augmentation of Extracellular ATP Synergizes With Chemotherapy in Triple Negative Breast Cancer

doi: 10.3389/fonc.2022.855032

Figure Lengend Snippet: Drug concentrations and functions. The table shows the drugs administered, their concentrations applied and their functions.

Article Snippet: The membranes were blocked with TBS-T (0.15 M NaCl, 0.02 M Tris-HCl, pH 7.4 and 0.1% Tween-20) containing non-fat milk at room temperature for an hour and incubated overnight at 4°C with a primary antibody: P2RX4 (1:500 dilution; Cell Signaling Technology, Cat# 70659, RRID : AB_2799789) and anti-P2RX7 (1:200 dilution; Cell Signaling Technology, Cat# 13809, RRID : AB_2798319), diluted in 5% BSA (GoldBio) or 5% non-fat milk.

Techniques: Concentration Assay

Journal: Frontiers in Oncology

Article Title: Augmentation of Extracellular ATP Synergizes With Chemotherapy in Triple Negative Breast Cancer

doi: 10.3389/fonc.2022.855032

Figure Lengend Snippet: Examining the influence of P2RX inhibitors in combination with E-NTPDase inhibitor on cell viability and eATP release in paclitaxel-treated cells. (A) Paclitaxel-treated breast cancer MDA-MB 468 cell lines were treated for six hours with P2RX7 inhibitor A438079 (20 µmol/L) or P2RX4 inhibitor 5-BDBD (20 µmol/L) in the presence or absence of PSB 069 (10 µmol/L), and cell viability was measured by applying PrestoBlue HS assay. Standard deviation was calculated from three independent experiments performed in triplicate. We used the same values for both graphs for vehicle addition and PSB 069. (B) eATP concentrations were measured in the supernatants of paclitaxel-treated MDA-MB 468 cells after six hours of treatment. Standard deviation was calculated from three independent experiments performed in triplicate. We used the to the same values for both graphs for vehicle addition and PSB 069. The student’s t-test was applied to the applicable assays to ascertain significance. * represents p < 0.05 and ** represents p < 0.01 for A438079 and PSB 069 or 5-BDBD and PSB 069 when compared to PSB 069 alone.

Article Snippet: The membranes were blocked with TBS-T (0.15 M NaCl, 0.02 M Tris-HCl, pH 7.4 and 0.1% Tween-20) containing non-fat milk at room temperature for an hour and incubated overnight at 4°C with a primary antibody: P2RX4 (1:500 dilution; Cell Signaling Technology, Cat# 70659, RRID : AB_2799789) and anti-P2RX7 (1:200 dilution; Cell Signaling Technology, Cat# 13809, RRID : AB_2798319), diluted in 5% BSA (GoldBio) or 5% non-fat milk.

Techniques: Standard Deviation

Journal: Frontiers in Oncology

Article Title: Augmentation of Extracellular ATP Synergizes With Chemotherapy in Triple Negative Breast Cancer

doi: 10.3389/fonc.2022.855032

Figure Lengend Snippet: Determining relative eATP content and cell viability in paclitaxel-treated cells in the presence of ivermectin or vehicle addition. (A) The graphs represent cell viability as measured using the Presto Blue HS assay +/- standard deviation from three independent experiments performed in triplicate in TNBC and MCF-10A cells after six hours of treatment with increasing concentrations of paclitaxel and the P2RX4 and P2RX7 activator ivermectin (10 µmol/L) or vehicle addition. (B) eATP content was measured in the supernatants of paclitaxel-treated TNBC and MCF-10A cell lines in the presence of the P2RX4 and P2RX7 activator ivermectin (10 µmol/L) or vehicle addition. The student’s t-test was applied to the applicable assays to ascertain significance. * represents p < 0.05 and ** represents p < 0.01 when comparing ivermectin to vehicle addition.

Article Snippet: The membranes were blocked with TBS-T (0.15 M NaCl, 0.02 M Tris-HCl, pH 7.4 and 0.1% Tween-20) containing non-fat milk at room temperature for an hour and incubated overnight at 4°C with a primary antibody: P2RX4 (1:500 dilution; Cell Signaling Technology, Cat# 70659, RRID : AB_2799789) and anti-P2RX7 (1:200 dilution; Cell Signaling Technology, Cat# 13809, RRID : AB_2798319), diluted in 5% BSA (GoldBio) or 5% non-fat milk.

Techniques: Standard Deviation

Journal: Frontiers in Oncology

Article Title: Augmentation of Extracellular ATP Synergizes With Chemotherapy in Triple Negative Breast Cancer

doi: 10.3389/fonc.2022.855032

Figure Lengend Snippet: Cell viability of ATP-treated cells in the presence of P2RX inhibitors. TNBC cell lines and MCF-10A cells were treated for 48 hours with increasing concentrations of ATP in the presence of the P2RX inhibitor Iso-PPADS (20 µmol/L), the P2RX7 inhibitor A438079 (20 µmol/L) or the P2RX4 inhibitor 5-BDBD (20 µmol/L) or vehicle addition, and cell viability was measured using the PrestoBlue HS assay. Error bars represent standard deviations calculated from three independent experiments performed in triplicate. One way ANOVA with Tukey’s HSD was applied to ascertain significance. * represents p < 0.05 and ** represents p < 0.01 when comparing vehicle addition to Iso-PPADS, A438079 or 5-BDBD.

Article Snippet: The membranes were blocked with TBS-T (0.15 M NaCl, 0.02 M Tris-HCl, pH 7.4 and 0.1% Tween-20) containing non-fat milk at room temperature for an hour and incubated overnight at 4°C with a primary antibody: P2RX4 (1:500 dilution; Cell Signaling Technology, Cat# 70659, RRID : AB_2799789) and anti-P2RX7 (1:200 dilution; Cell Signaling Technology, Cat# 13809, RRID : AB_2798319), diluted in 5% BSA (GoldBio) or 5% non-fat milk.

Techniques:

Journal: Frontiers in Oncology

Article Title: Augmentation of Extracellular ATP Synergizes With Chemotherapy in Triple Negative Breast Cancer

doi: 10.3389/fonc.2022.855032

Figure Lengend Snippet: mRNA and protein expression analysis of P2RX4 and P2RX7 for all cell lines. (A) qRT-PCR was performed on mRNA of TNBC cell lines and MCF-10A cells using specific primers for P2RX4 and P2RX7. * represents p < 0.05 and ** represents p < 0.01. TNBC cell lines, MCF-10A cells, and HEK 293T cells transfected with P2RX4 or P2RX7 as positive controls were probed for (B) P2RX4 and (C) P2RX7, and GADPH was used as a loading control for western blot analysis repeated twice. HEK 293T cells transfected with P2RX7 were loaded at increasing protein concentrations of 1.0 µg, 2.5 µg, and 5.0 µg combined with lysates of control vector-transfected cells to keep the total loaded protein the same in each lane. Densitometry analysis was performed using Image Studio on the 75 kDa P2RX7 band. The student’s t-test was applied to the applicable assays to ascertain significance. * represents p<0.05 and ** represents p < 0.01 relative to MCF-10A; + represents p < 0.05 and ++ represents p < 0.01 relative to HEK293-empty vector transfected. (D) The calculated difference in mean fluorescence intensity (MFI) values between TNBC cell lines, MCF-10A cells, and HEK 293T cells transfected with P2RX4 or P2RX7 as positive controls stained with P2RX4 or P2RX7 specific antibody and the isotype control for the different cell lines examined. * represents p < 0.05 and ** represents p < 0.01 relative to MFI difference in MCF-10A cells; + represents p < 0.05 and ++ represents p < 0.01 relative to MFI difference in HEK293-empty vector transfected. O/E represents overexpressed.

Article Snippet: The membranes were blocked with TBS-T (0.15 M NaCl, 0.02 M Tris-HCl, pH 7.4 and 0.1% Tween-20) containing non-fat milk at room temperature for an hour and incubated overnight at 4°C with a primary antibody: P2RX4 (1:500 dilution; Cell Signaling Technology, Cat# 70659, RRID : AB_2799789) and anti-P2RX7 (1:200 dilution; Cell Signaling Technology, Cat# 13809, RRID : AB_2798319), diluted in 5% BSA (GoldBio) or 5% non-fat milk.

Techniques: Expressing, Quantitative RT-PCR, Transfection, Control, Western Blot, Plasmid Preparation, Fluorescence, Staining

Journal: Frontiers in Oncology

Article Title: Augmentation of Extracellular ATP Synergizes With Chemotherapy in Triple Negative Breast Cancer

doi: 10.3389/fonc.2022.855032

Figure Lengend Snippet: Schematic displaying our proposed model for ATP release. Our proposed model suggests that ivermectin activates P2RX4 and P2RX7 leading to the release of ATP and the more ATP that accumulates extracellular can promote cell death especially in the presence of paclitaxel. In addition, the breakdown of ATP can be prevented in the presence of E-NTPDase inhibitors POM-1 or PSB 069. However, the release of ATP can be prevented in the presence of P2RX4 inhibitors 5-BDBD or Iso-PPADS or P2RX7 inhibitors A438079 or Iso-PPADS.

Article Snippet: The membranes were blocked with TBS-T (0.15 M NaCl, 0.02 M Tris-HCl, pH 7.4 and 0.1% Tween-20) containing non-fat milk at room temperature for an hour and incubated overnight at 4°C with a primary antibody: P2RX4 (1:500 dilution; Cell Signaling Technology, Cat# 70659, RRID : AB_2799789) and anti-P2RX7 (1:200 dilution; Cell Signaling Technology, Cat# 13809, RRID : AB_2798319), diluted in 5% BSA (GoldBio) or 5% non-fat milk.

Techniques:

Journal: CNS Neuroscience & Therapeutics

Article Title: Low‐Intensity Pulsed Ultrasound Alleviation of LPS‐Induced Depression‐Like Behavior via Microglial P2X4R Inhibition and BDNF/TrkB Pathway Activation

doi: 10.1002/cns.70786

Figure Lengend Snippet: LIPUS suppressing LPS‐induced neuroinflammation by modulating P2X4R expression in microglia: (A, B) Western blot analysis showing that LPS significantly increased P2X4R protein expression in the hippocampus, which is markedly inhibited by LIPUS treatment; (C, I) Immunofluorescence staining confirming elevated hippocampal P2X4R expression following LPS administration, which is reduced after LIPUS intervention; (D, E) Western blot analysis showing that LPS markedly upregulates the microglial marker IBA1, while LIPUS significantly suppresses the upregulation; (F, J) Immunofluorescence results validating the reduction in IBA1 expression following LIPUS treatment, indicating decreased microglial activation; (G, K) Dual immunofluorescence staining for P2X4R and IBA1 revealing strong colocalization in the LPS group, suggesting that P2X4R is primarily expressed in activated microglia and the LIPUS treatment markedly reduces colocalization, supporting that LIPUS mitigates neuroinflammation by inhibiting P2X4R activation in microglia; (H) PCR analysis showing that P2X4R expression is significantly elevated following LPS administration, which is reduced after LIPUS intervention. LPS, Lipopolysaccharide; LIPUS, Low‐intensity pulsed ultrasound. The p value was determined by ANOVA with Kruskal–Wallis test. * p < 0.05, ** p < 0.01, *** p < 0.001. Data are represented as mean ± SD.

Article Snippet: The membranes were blocked with 5% non‐fat milk at room temperature for 1 h and incubated overnight at 4°C with the following primary antibodies: TNF‐α (1:1000; AF7014; Affinity), IL‐6 (1:1000; DF6087; Affinity), IL‐1β (1:1000; AF4006; Affinity), Bax (1:1000; AF0120; Affinity), Bcl‐2 (1:1000; AF6139; Affinity), P2X4R (1:1000; 13,534–1‐AP; Proteintech), IBA1 (1:1000; DF6442; Affinity), BDNF (1:1000; DF6387; Affinity), phospho‐TrkB (p‐TrkB, 1:1000; AF3461; Affinity), TrkB (1:1000; AF6461; Affinity), phospho‐CaMKII (p‐CaMKII, 1:1000; AF3493; Affinity), CaMKII (1:1000; AF6493; Affinity), phospho‐CREB (p‐CREB, 1:1000; AF3189; Affinity), CREB (1:1000; AF6188; Affinity), and β‐actin (1:5000; AF7018; Affinity).

Techniques: Expressing, Western Blot, Immunofluorescence, Staining, Marker, Activation Assay

Journal: CNS Neuroscience & Therapeutics

Article Title: Low‐Intensity Pulsed Ultrasound Alleviation of LPS‐Induced Depression‐Like Behavior via Microglial P2X4R Inhibition and BDNF/TrkB Pathway Activation

doi: 10.1002/cns.70786

Figure Lengend Snippet: P2X4R agonist attenuating the LIPUS‐induced enhancement of BDNF/TrkB signaling and neuroprotection: (A–C) Western blot analysis showing that LIPUS significantly suppresses the LPS‐induced P2X4R expression, while co‐administration of the P2X4R agonist ivermectin (IVM) reverses the inhibitory effect; (B–D) Western blot analysis of IBA1 revealing that LIPUS markedly reduces LPS‐induced microglial activation, whereas IVM restores the IBA1 expression levels; (E, F) Dual immunofluorescence staining for P2X4R and IBA1 demonstrating that colocalization decreases in the LIPUS group but increases in the IVM group, indicating that IVM restores both the P2X4R expression and microglial activation; (G, J) Immunofluorescence staining showing that LIPUS significantly enhances BDNF expression in the hippocampus, whereas this effect is markedly reduced following IVM administration; (H, K) Western blot analysis revealing that LIPUS upregulates the BDNF protein levels, while the BDNF expression decreases in the IVM group; (I, L) Despite unchanged total TrkB levels in the three groups, LIPUS increases p‐TrkB with IVM suppressing. LPS, Lipopolysaccharide; LIPUS, Low‐intensity pulsed ultrasound; IVM, Ivermectin. The p value was determined by ANOVA with Bonferroni's post‐hoc test. * p < 0.05, ** p < 0.01, *** p < 0.001. Data are represented as mean ± SD.

Article Snippet: The membranes were blocked with 5% non‐fat milk at room temperature for 1 h and incubated overnight at 4°C with the following primary antibodies: TNF‐α (1:1000; AF7014; Affinity), IL‐6 (1:1000; DF6087; Affinity), IL‐1β (1:1000; AF4006; Affinity), Bax (1:1000; AF0120; Affinity), Bcl‐2 (1:1000; AF6139; Affinity), P2X4R (1:1000; 13,534–1‐AP; Proteintech), IBA1 (1:1000; DF6442; Affinity), BDNF (1:1000; DF6387; Affinity), phospho‐TrkB (p‐TrkB, 1:1000; AF3461; Affinity), TrkB (1:1000; AF6461; Affinity), phospho‐CaMKII (p‐CaMKII, 1:1000; AF3493; Affinity), CaMKII (1:1000; AF6493; Affinity), phospho‐CREB (p‐CREB, 1:1000; AF3189; Affinity), CREB (1:1000; AF6188; Affinity), and β‐actin (1:5000; AF7018; Affinity).

Techniques: Western Blot, Expressing, Activation Assay, Immunofluorescence, Staining

Journal: CNS Neuroscience & Therapeutics

Article Title: Low‐Intensity Pulsed Ultrasound Alleviation of LPS‐Induced Depression‐Like Behavior via Microglial P2X4R Inhibition and BDNF/TrkB Pathway Activation

doi: 10.1002/cns.70786

Figure Lengend Snippet: P2X4R regulates the BDNF/TrkB signaling pathway and apoptosis by modulating CaMKII/CREB phosphorylation in the hippocampus: (A, C) Western blot analysis revealing that LIPUS modulates CaMKII phosphorylation, as indicated by the p‐CaMKII/CaMKII ratio, while CaMKII phosphorylation is decreased in the IVM group; (B, D) Western blot analysis revealing that LIPUS modulates CREB phosphorylation, as indicated by the p‐CREB/CREB ratio, while CREB phosphorylation is decreased in the IVM group; (E, G) Western blot analysis revealing that KN‐93 administration (CaMKII antagonist) markedly reduces BDNF protein expression, as shown by the representative immunoblots and densitometric quantification; (F, H) Western blot analysis revealing that KN‐93 administration markedly decreases TrkB phosphorylation, as indicated by the p‐TrkB/TrkB ratio, together with the representative immunoblots and quantitative analysis; (I–L) Western blot results indicating that LIPUS downregulates the pro‐apoptotic protein Bax and upregulates the anti‐apoptotic protein Bcl‐2, demonstrating a neuroprotective effect. This trend is reversed by IVM, as shown by increased Bax and decreased Bcl‐2 expression; (M–P) Nissl staining showing that LIPUS improves the hippocampal neuronal structure and co‐treatment with IVM resulting in disorganized neuronal arrangement and morphological degeneration, resembling that of the LPS group. LPS, Lipopolysaccharide; LIPUS, Low‐intensity pulsed ultrasound; IVM, Ivermectin; KN‐93: CaMKII antagonist. The p value was determined by ANOVA with Bonferroni's post‐hoc test. * p < 0.05, ** p < 0.01, *** p < 0.001. Data are represented as mean ± SD.

Article Snippet: The membranes were blocked with 5% non‐fat milk at room temperature for 1 h and incubated overnight at 4°C with the following primary antibodies: TNF‐α (1:1000; AF7014; Affinity), IL‐6 (1:1000; DF6087; Affinity), IL‐1β (1:1000; AF4006; Affinity), Bax (1:1000; AF0120; Affinity), Bcl‐2 (1:1000; AF6139; Affinity), P2X4R (1:1000; 13,534–1‐AP; Proteintech), IBA1 (1:1000; DF6442; Affinity), BDNF (1:1000; DF6387; Affinity), phospho‐TrkB (p‐TrkB, 1:1000; AF3461; Affinity), TrkB (1:1000; AF6461; Affinity), phospho‐CaMKII (p‐CaMKII, 1:1000; AF3493; Affinity), CaMKII (1:1000; AF6493; Affinity), phospho‐CREB (p‐CREB, 1:1000; AF3189; Affinity), CREB (1:1000; AF6188; Affinity), and β‐actin (1:5000; AF7018; Affinity).

Techniques: Phospho-proteomics, Western Blot, Expressing, Staining

Journal: CNS Neuroscience & Therapeutics

Article Title: Low‐Intensity Pulsed Ultrasound Alleviation of LPS‐Induced Depression‐Like Behavior via Microglial P2X4R Inhibition and BDNF/TrkB Pathway Activation

doi: 10.1002/cns.70786

Figure Lengend Snippet: P2X4R agonist IVM attenuating the beneficial effects of LIPUS on depression‐like behavior and neuroinflammation: (A) LIPUS significantly improving the LPS‐induced body weight loss in mice and co‐administration of IVM reversing this improvement; (B–E) Behavioral assessment showing that LIPUS reduces the depression‐like behavior, as evidenced by decreased immobility time and increased time spent in the central zone. In contrast, the IVM group exhibits behavioral patterns similar to the LPS group, indicating that IVM weakens the antidepressant effects of LIPUS; (F–H, I, K, M) Western blot analysis revealing that LIPUS suppressing the expressions of IL‐1β, IL‐6, and TNF‐α with co‐treatment with IVM leading to a notable rebound in these pro‐inflammatory cytokines. (J, L, N) qPCR analysis further confirming that IVM attenuates the LIPUS‐mediated suppression of IL‐1β, IL‐6, and TNF‐α mRNA expression. LPS, Lipopolysaccharide; LIPUS, Low‐intensity pulsed ultrasound; IVM, Ivermectin. The p value was determined by ANOVA with Bonferroni's post‐hoc test. * p < 0.05, ** p < 0.01, *** p < 0.001. Data are represented as mean ± SD.

Article Snippet: The membranes were blocked with 5% non‐fat milk at room temperature for 1 h and incubated overnight at 4°C with the following primary antibodies: TNF‐α (1:1000; AF7014; Affinity), IL‐6 (1:1000; DF6087; Affinity), IL‐1β (1:1000; AF4006; Affinity), Bax (1:1000; AF0120; Affinity), Bcl‐2 (1:1000; AF6139; Affinity), P2X4R (1:1000; 13,534–1‐AP; Proteintech), IBA1 (1:1000; DF6442; Affinity), BDNF (1:1000; DF6387; Affinity), phospho‐TrkB (p‐TrkB, 1:1000; AF3461; Affinity), TrkB (1:1000; AF6461; Affinity), phospho‐CaMKII (p‐CaMKII, 1:1000; AF3493; Affinity), CaMKII (1:1000; AF6493; Affinity), phospho‐CREB (p‐CREB, 1:1000; AF3189; Affinity), CREB (1:1000; AF6188; Affinity), and β‐actin (1:5000; AF7018; Affinity).

Techniques: Western Blot, Expressing

Journal: Purinergic Signalling

Article Title: Depletion of P2X4 receptor alleviates prostate cancer bone metastasis through reduced cancer cell invasiveness and enhanced cell adhesion activities

doi: 10.1007/s11302-025-10096-5

Figure Lengend Snippet: Successful KO of P2X4R in PCa cells. Following CRISPR/Case 9 KO plasmids transfection and single cells sorting using FACS based on transient GFP + signals. a The disruption of P2RX4 at the RNA level of two KO clones (KO-1 and KO-2) was confirmed using RT-PCR. b A Fluo-4 Direct™ calcium influx detection assay was performed to examine functional changes of P2X4R in PC3 WT and KO cells stimulated with 50 μM ATP. c Significant reductions in peak calcium influx in both KO-1 and KO-2 cells confirmed impaired P2X4R in KO cells. Data are the mean ± SD, n = 3, one-way ANOVA with Bonferroni’s multiple comparisons test, * p < 0.05, **** p < 0.0001

Article Snippet: The P2RX4 KO CRISPR/Cas9 plasmid was purchased from Santa Cruz (sc-401779-KO-2) and is a pool of 3 different gRNA plasmids (gRNA1: CTCCGTTACGACCAAGGTCA targeting exon 3; gRNA2: TCACGTTGGTCATGACGAAG targeting exon 4; gRNA3: GTGCTTGTAGGAGTCTCAAC targeting exon 6 and spanning to the adjacent intron).

Techniques: CRISPR, Transfection, Disruption, Clone Assay, Reverse Transcription Polymerase Chain Reaction, Detection Assay, Functional Assay