Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Scheme of introduced loxP sites in Orc2 locus. B. Representative picture of genotyping of offspring coming from Orc2 f/+ crossed with Orc2 f/+ . C. The ratio of observed to expected animals coming from Orc2 f/+ crossed with Orc2 f/+ . D. Schematic of the ORC2 protein and the DeltaORC2 protein produced after deletion of exons 6 and 7. A110 is mutated to V110 and then the protein goes out of frame. E. Validation of Orc2 deletion 3 days after Adeno cre transduction. F. Western blot of ORC2 protein 5 days after Adeno cre transduction. 10 or indicated ul of lysate loaded/lane as written on the top G. MTT assay of WT and Orc2 f/f MEFs without and with Adeno cre transduction. H. Western blot of ORC2 protein 5 and 15 days after Adeno cre transduction.

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Produced, Biomarker Discovery, Transduction, Western Blot, MTT Assay

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Scheme of Alb +/- - Orc2 f/f crossed with Alb +/- - Orc2 f/f . B. The ratio of observed to expected animals coming from A. C. Western blot of liver tissue from Orc2 f/f and Alb-Orc2 f/f animals. Red stars point to lanes with comparable amounts of total loaded protein. Note that the liver has hematopoietic and other cells in addition to hepatocytes, which is why a trace amount of ORC2 will always be detected. D. Average body weight of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. E. Average liver weight of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. F. Average liver to body weight ratio of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. G. Representative H&E staining of liver tissue from Orc2 f/f ROSA26 stop-EYFP (WT) and Alb-Orc2 f/f ROSA26 stop-EYFP (KO) animals. H. Quantification of hepatocyte nuclear size in Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop- EYFP animals. I. Quantification of hepatocyte nuclear size in Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop- EYFP female mice. J. Quantification of hepatocytes nuclear size in Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop- EYFP male mice. *p < 0.05, **p < 0.01, two-tailed Student’s t test.

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Western Blot, Staining, Two Tailed Test

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Experimental design B. Genotyping and western blotting of hepatocytes C. Representative picture of EdU, EYFP and DAPI staining on the Orc2 WT and KO primary hepatocytes. D. The percentage of EdU positive nuclei from Orc2 WT or Orc2 KO primary hepatocytes. *p < 0.05, two-tailed Student’s t test.

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Western Blot, Staining, Two Tailed Test

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Schematic of the experiment. B. Body weight of the Orc2 f/f ROSA26stop-EYFP mice without (-/-) or with Alb-Cre (-/+) before partial hepatectomy. C. Liver weight of the mice in B after liver regeneration. D. Regenerated Liver to pre-hepatectomy body weight ratio of the mice in B. E. H&E stain of Orc2 f/f ROSA26stop-EYFP livers with intact Orc2 ( Alb-cre -/- , N=3) or Orc2 knockout ( Alb-cre+/- , N=7). Scale bar: 25 μm. F. Quantitation of nuclear counts per field (76,000 um2). Six images were taken for each liver. 0 hr (pre-resection). 36 hr (post-regeneration). G. EdU incorporation of indicated livers. EYFP marks cells where Cre has been expressed. Scale bar: 25μm. H. Percent EdU+ nuclei counted in 1882 and 825 nuclei in the Cre- and Cre+ livers, respectively. I. Nuclear size of indicated livers. 0 hr (pre-resection). 36 hr (post-regeneration). Mean and S.D from about 40-70 nuclei, *p < 0.05, ****p < 0.0001, unpaired two-tailed Student’s t test is used

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Staining, Knock-Out, Quantitation Assay, Two Tailed Test

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Experimental design. B-D. Quantification of nuclei ploidy in the livers of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. E. Representative result of flow cytometry analysis for Alb-Orc2 f/f ROSA26 stop-EYFP animals. The light blue and yellow profiles are from the EYFP negative and positive cells, respectively. F-H. Quantification of nuclei ploidy for EYFP low (negative) and high (positive) primary hepatocytes. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test.

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Flow Cytometry, Two Tailed Test

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A-B. Breeding schemes to obtain conditional double flox animals. C. The ratio of observed to expected animals coming from B. Orc1 = all animals with Orc1 f/f ROSA26stop-EYFP , Orc2 = all animals with Orc2f/f ROSA26stop-EYFP , Orc1 Orc2 = all animals with Orc1 f/f Orc2 f/f ROSA26stop-EYFP genotype. This was before introduction of Alb-Cre . D. Representative H&E staining of liver tissue from male Orc1 f/f Orc2 f/f ROSA26stop-EYFP (WT) and Alb-Cre , Orc1 f/f Orc2 f/f ROSA26stop-EYFP (dKO) animals. E. Quantification of hepatocyte nuclear size in the WT and DKO animals. F. Average body, liver weight and their ratio for WT and DKO animals. G. Quantification of nuclei ploidy for EYFP low (negative) and high (positive) primary hepatocytes. H-J. Body weight pre-resection, liver weight post-regeneration and regenerated liver to body weight ratio in mice with indicated genotypes. 4 males of Orc1f/f Orc2f/f ROSA26stop-EYFP mice with Alb-Cre (-/-) were used as control group and 6 males of Orc1f/f Orc2f/f ROSA26stop-EYFP mice with Alb-Cre (+/-) were used as experimental group. No significant difference between the two groups using two tailed Student t-test. K: H&E stain of Orc1 f/f Orc2 f/f ROSA26stop-EYFP mice livers with intact Orc1, Orc2 ( Alb-cre -/- , N=4) or Orc1,Orc2 DKO ( Alb-cre +/- , N=6). Scale bar: 50 μm. L. Quantitation of hepatocyte nuclear size post regeneration. 0 hr (pre-resection). 36 hr (post-regeneration). Five-six images were taken for each liver. About 120-200 nuclei are counted. M: Quantitation of hepatocyte nuclear density post regeneration. 0 hr (pre-resection). 36 hr (post-regeneration). Five-six images were taken for each liver. N. Micrographs of EdU, DAPI and EYFP imaging of livers with indicated genotypes post regeneration. Scale bar: 20 μm. O. Quantitation of EdU positive nuclei post regeneration. Five-six images were taken for each liver. *p < 0.05, ****p < 0.0001, unpaired two-tailed Student’s t test were used

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Staining, Control, Two Tailed Test, Quantitation Assay, Imaging

Journal: Advanced Science

Article Title: Topoisomerase I Inhibition in ETV4‐overexpressed Non‐Small Cell Lung Cancer Promotes Replication and Transcription Mediated R‐Loop Accumulation and DNA Damage

doi: 10.1002/advs.202409307

Figure Lengend Snippet: ETV4 transcriptionally controls key genes involved in DNA replication of NSCLC cells. A) Functional analysis showing the top KEGG pathways that are significantly associated with down‐regulated genes in H1299, H1703, and H358T si‐ETV4 groups normalized to negative control (NC) siRNA groups by Human Microarray ( GSE137445 ). B) Clustering analysis showing the gene signature is enriched in the DNA replication pathway. C) IGV tracks showing the enrichment of ETV4 at the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 from ChIP‐seq signals of A549‐shETV4 cells transfected with Flag‐ETV4 plasmids. D) ChIP‐PCR analysis for endogenous or exogenous ETV4 binding to the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 genes in H1299 cells using anti‐ETV4 antibody or H358‐ETV4 cells using anti‐Flag antibody. E) Schematic depicting the core motif of ETV4 binding with its target genes, the wild‐type luciferase reporter constructs, and the mutations in the putative ETV4‐binding sites (mut‐1 or mut‐2 type) of MCMs/ORC1 promoter region. F–J) The wild‐type luciferase reporter plasmids of MCMs (ORC1) were co‐transfected along with ETV4, ETV4‐DBD deletion plasmid, or the empty vector into HEK293T cells. The constructed luc‐MCMs (ORC1)‐mut‐1 or ‐mut‐2 type plasmids were co‐transfected along with ETV4 plasmid or the empty vector into HEK293T cells. Relative luciferase activity was normalized against Renilla luciferase activity, respectively (mean ± SD; n = 4; ordinary one‐way ANOVA with Tukey's multiple comparisons test). **** p < 0.0001; ### p < 0.001, #### p < 0.0001. K) RT‐qPCR analysis of MCM2, ‐4, ‐5, ‐10, and ORC1 mRNA expression in H1299 cells transfected with ETV4 or NC siRNA, Transcript levels were normalized to ACTB gene expression (mean ± SD, n = 3; two‐tailed unpaired t ‐test). ** p < 0.01; *** p < 0.001; **** p < 0.0001. L) Immunoblots showing MCM2, ‐4, ‐5, ‐10, and ORC1 protein levels in NC and ETV4‐knockdown H1299 cells. M,N) Immunoblots showing the Chromatin‐bound proteins (Chrom.) and unbound proteins (Sol.) levels of MCM2, ‐4, ‐5, ‐10, and ORC1 protein in control and sh‐ETV4 A549 cells, or control and ETV4‐overexpression H358 cells.

Article Snippet: Blots were blocked with 5% nonfat milk in Tris‐Buffered Saline and Tween 20 (TBST), and incubated with antibodies specific for ETV4 (10684‐1‐AP, Proteintech), MCM2 (3619, CST), MCM3 (15597‐1‐AP, Proteintech), MCM4 (13043‐1‐AP, Proteintech), MCM5 (11703‐1‐AP, Proteintech), MCM6 (13347‐2‐AP, Proteintech), MCM7 (11225‐1‐AP, Proteintech), MCM10 (12251‐1‐AP, Proteintech), ORC1 (NBP100‐121, Novus), ORC2 (12739‐1‐AP, Proteintech), ORC3 (sc‐374231, Santa Cruz), ORC4 (13026‐1‐AP, Proteintech), ORC5 (11542‐1‐AP, Proteintech), ORC6 (17784‐1‐AP, Proteintech), Histone‐H3 (17168‐1‐AP, Proteintech), PCNA (13110, CST), phospho‐MCM2 S40 (ab133243, Abcam), CDC45 (15678‐1‐AP, Proteintech), SUPT16H (28598‐1‐AP, Proteintech), SSRP1 (15696‐1‐AP, Proteintech), γ‐H2AX (ET‐1602, HUABio), Flag (14793, CST), His (66005‐1‐Ig, Proteintech), HA (sc‐7392, Santa Cruz), GST (66001‐2‐lg, Proteintech), GAPDH (60004‐1‐Ig, Proteintech) and β‐actin (66009‐1‐Ig, Proteintech) was used as a loading control for Western blot.

Techniques: Functional Assay, Negative Control, Microarray, ChIP-sequencing, Transfection, Binding Assay, Luciferase, Construct, Plasmid Preparation, Activity Assay, Quantitative RT-PCR, Expressing, Gene Expression, Two Tailed Test, Western Blot, Knockdown, Control, Over Expression

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) FLAG-mouse ORC2 or ORC1 were transfected into C33A cells with either BPV-1 E2 or E2R (aa 162–410). 24 hr later, E2 immunoprecipitations (II-1 antibody) were blotted with E2 B201 or M2 antibodies. (B) ORC2 interacts with the BPV-1 E2 transactivation domain (TAD, aa 1–216). FLAG-mouse ORC2 was transfected into C33A cells with BPV-1 E2, TAD or E2R. 24 hr later, groups without full length E2 were treated with 10 μM MG132 for 6 hr to maintain input protein levels of ORC2. B201 antibody immune complexes were blotted with B201 and M2 antibodies. The TAD domain of E2 is the same size as light chain IgG as indicated by * in the Fig 1B. (C) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E2. HA antibody immunoprecipitates were blotted with HA-7 and M2 antibodies. (D) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E1 and FLAG-HPV-31 E2. HA antibody immunoprecipitations were blotted with ORC2 and FLAG antibodies. ORC2 was not detected in the inputs but was detected in the pull down. HA-ORC2 protein is approximately 70 kDa and FLAG-31E1 protein is approximately 75 kDa. (E) Human ORC2 protein was incubated with 6-His-BPV E2:1–216 and MBP-6-His-HPV-16 E6. Nickel complexes were blotted with E2 (B201), E6, and ORC2 antibodies.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Transfection, Incubation

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) In-situ proximity ligation assay (PLA) between FLAG-HPV-31 E2 and HA-hORC2. Fluorescent spots indicate interaction based DNA amplification occurring in the nucleus (stained blue). The no transfection group was used as a negative control with these antibodies. (B) PLA between FLAG-HPV-31 E2 and HA-HPV-31 E1. (C) PLA between FLAG-HPV-31 E2 and endogenous ORC2. Secondary antibodies only were used as a negative control.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: In Situ, Proximity Ligation Assay, DNA Amplification, Staining, Transfection, Negative Control

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) Baculovirus expressing human ORC2 protein was added to 0.5% NP-40 lysis buffer containing protein A and protein G agarose bead slurry, and either mouse anti-EE or an equal mix of mouse anti-ORC2 (MBL) and rat anti-ORC2 (Cell Signaling) antibodies. IPs were loaded on a SDS page gel and ORC2 was detected with the mouse anti-ORC2 antibody (MBL) by immunoblotting. (B) HPV-BP and (C) CIN612-9E cells were synchronized with 2.5 mM double thymidine. Inset diagram shows flow cytometry based cell cycle analysis. ChIP was performed using mouse anti-ORC2 antibodies (MBL). Real-time PCR was completed with primers to the HPV-16 or HPV-31 LCR, a known mammalian origin of replication (GM-CSF), and Exon 9, a non-specific DNA region used as a negative binding control. EE (non-specific IgG) did not bind to these regions of DNA in these experiments and is not shown here.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Expressing, Lysis, SDS Page, Western Blot, Flow Cytometry, Cell Cycle Assay, Real-time Polymerase Chain Reaction, Binding Assay, Control

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) C33A were transfected with the FLAG-HPV-31 E2 expression vector. 24 hours later cells were lysed (0.5% NP-40). The lysate from cells untransfected and cells transfected with FLAG-HPV-31 E2 were added to lysis buffer containing protein A and protein G bead slurry and rabbit anti-HPV-31 E2 serum. IPs were immunoblotted with M2 antibodies. (B) CIN612-9E cells were synchronized with 2.5 mM double thymidine. ChIP experiments were performed using mouse anti-EE, an equal mix of rat and mouse anti-ORC2 (Cell Signaling/MBL) or rabbit anti-HPV-31 E2 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in and around the HPV-31 LCR. The locations of the primers are shown below the horizontal axis with the ori labeled. E2 binding sites are located between the LCR2 and LCR4 primer sets. Ct values are normalized to input and EE was set to equal 1. Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to EE. (C) C33A cells were transfected with FLAG-HPV-31 E1 expression vector and lysates were immunoprecipiated with mouse anti-EE, rabbit anti-16 E1, and rat anti-16 E1 antibodies and then immunoblotted with M2 antibodies. (D) W12 cells were synchronized with 2.5 mM double thymidine. ChIP experiments were performed using mouse anti-EE, equal mix of rat and mouse anti-ORC2 antibodies (Cell Signaling/MBL), or rat anti-HPV-16 E1 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in and around the HPV-16 LCR. The locations of the primers are shown below the horizontal axis with the ori labeled. E2 binding sites are located between the LCR3 and E6 primer sets. Ct values are normalized to input and EE was set to equal 1. Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to EE.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Transfection, Expressing, Plasmid Preparation, Lysis, Real-time Polymerase Chain Reaction, Labeling, Binding Assay

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) Replication luciferase assays were completed with pFLORI31 and ORC2 depletion. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. ORC2 shRNA decreased ORC2 protein expression in C33A cells. (B) ORC2 shRNA decreased EBNA-1 based replication using the pREP4 plasmid (EBNA-1 based replication) in C33A cells. (C) ORC2 shRNA decreased ORC2 protein expression in HPV-BP and SiHa cells. (D) ORC2 knockdown increased HPV replication in cells containing HPV-16 episomes (HPV-BP) but not in cells with integrated HPV-16 (SiHa). HPV-BP and SiHa cells were transfected with 5.5 μg of shRNA hairpins. 7d later, cells were harvested and HPV-16 copy number (HPV-16 LCR) as normalized to GM-CSF ori #2. This experiment was performed three times with a representative image presented here.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Luciferase, shRNA, Expressing, Plasmid Preparation, Knockdown, Transfection

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) ORC2 siRNA duplexes decreased ORC2 protein levels at a concentration of 15 or 5 nM after 48 h. (B) CIN612-9E cells were transfected with RLuc and pFLORI31. 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (C) CIN612-9E cells were transfected with 15 nM ORC2 and differentiated in 10% FBS DMEM + 2 mM CaCl 2 for 48h. Involucrin and β-actin levels were analyzed. (D) CIN612-9E cells were transfected with RLuc and pFLORI31. Five hours later, the transfection was removed and cells were placed in either E-medium or 10% FBS DMEM + 2 mM CaCl 2 . 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (E) CIN612-9E cells were transfected with 15 nM control or ORC2 siRNAs, RLuc and pFLORI31. Five hours later, the transfection was removed and cells were placed in 10% FBS DMEM + 2 mM CaCl 2 . 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (F) CIN612-9E cells were transfected with 15 nM control or ORC2 siRNAs and placed in 10% FBS DMEM + 2 mM CaCl 2 for 72 h. DNA was isolated and HPV-31 DNA content was measured by RT-PCR and normalized to β-actin levels. The ORC2 siRNA group was normalized to the control siRNA group (control siRNA = 1). Values are expressed mean +/-. * p-value ≤ 0.05.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Concentration Assay, Transfection, Luciferase, Activity Assay, Control, Isolation, Reverse Transcription Polymerase Chain Reaction

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: CIN612-9E cells were transfected with 30 nM of control or ORC2 siRNAs for 48 h. ChIP experiments were performed using (A) rabbit anti-HPV-31 E2 antibodies or (B) rat E1 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in HPV-31 LCR previously found to be enriched for E2 binding. E2 binding sites are located between the LCR2 and LCR4 primer sets. Ct values are normalized to input and values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to control siRNA.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Transfection, Control, Real-time Polymerase Chain Reaction, Binding Assay

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) Lysates (1% NP-40) for i31E2 cells ± Dox and control/HPV-16E2 U2OS cell lines were blotted with FLAG-M2 (HPV-31 E2), TGV261 (HPV-16 E2), ORC2 (MBL) and β-actin antibodies. (B,C) TRE-x U2OS cells containing pcDNA4/TO-FLAG 31E2 (i31E2, ± 48h Dox treatment) and Control and 16E2 U2OS cells were treated overnight with 2.5 mM thymidine, released the next day for 6h, followed by 2.5 mM thymidine treatment overnight. ChIP was performed with an equal mix of mouse/rat-ORC2 antibodies (MBL/Cell Signaling) on the GM-CSF ori (B) or the lamin B2 (LB) ori (C). ChIP experiments were performed at least three times. The Ct values for ORC2 binding were first normalized to input for each cell line. ORC2 levels for the E2 expressing cell lines were normalized to the control cell lines (no E2). Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to control cell line.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Control, Binding Assay, Expressing

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) FLAG-mouse ORC2 or ORC1 were transfected into C33A cells with either BPV-1 E2 or E2R (aa 162–410). 24 hr later, E2 immunoprecipitations (II-1 antibody) were blotted with E2 B201 or M2 antibodies. (B) ORC2 interacts with the BPV-1 E2 transactivation domain (TAD, aa 1–216). FLAG-mouse ORC2 was transfected into C33A cells with BPV-1 E2, TAD or E2R. 24 hr later, groups without full length E2 were treated with 10 μM MG132 for 6 hr to maintain input protein levels of ORC2. B201 antibody immune complexes were blotted with B201 and M2 antibodies. The TAD domain of E2 is the same size as light chain IgG as indicated by * in the Fig 1B. (C) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E2. HA antibody immunoprecipitates were blotted with HA-7 and M2 antibodies. (D) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E1 and FLAG-HPV-31 E2. HA antibody immunoprecipitations were blotted with ORC2 and FLAG antibodies. ORC2 was not detected in the inputs but was detected in the pull down. HA-ORC2 protein is approximately 70 kDa and FLAG-31E1 protein is approximately 75 kDa. (E) Human ORC2 protein was incubated with 6-His-BPV E2:1–216 and MBP-6-His-HPV-16 E6. Nickel complexes were blotted with E2 (B201), E6, and ORC2 antibodies.

Article Snippet: The following antibodies were used: Mouse anti-FLAG (M2; Sigma), mouse anti-HA (HA-7; Sigma 3F10; Roche, 12CA5), mouse anti-human ORC2 (MBL), rat anti-human ORC2 (Cell Signaling), mouse anti-HPV-16 E6 (Arbor Vita), mouse anti-EE and anti-β-actin (Sigma).

Techniques: Transfection, Incubation

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) In-situ proximity ligation assay (PLA) between FLAG-HPV-31 E2 and HA-hORC2. Fluorescent spots indicate interaction based DNA amplification occurring in the nucleus (stained blue). The no transfection group was used as a negative control with these antibodies. (B) PLA between FLAG-HPV-31 E2 and HA-HPV-31 E1. (C) PLA between FLAG-HPV-31 E2 and endogenous ORC2. Secondary antibodies only were used as a negative control.

Article Snippet: The following antibodies were used: Mouse anti-FLAG (M2; Sigma), mouse anti-HA (HA-7; Sigma 3F10; Roche, 12CA5), mouse anti-human ORC2 (MBL), rat anti-human ORC2 (Cell Signaling), mouse anti-HPV-16 E6 (Arbor Vita), mouse anti-EE and anti-β-actin (Sigma).

Techniques: In Situ, Proximity Ligation Assay, Amplification, Staining, Transfection, Negative Control

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) Baculovirus expressing human ORC2 protein was added to 0.5% NP-40 lysis buffer containing protein A and protein G agarose bead slurry, and either mouse anti-EE or an equal mix of mouse anti-ORC2 (MBL) and rat anti-ORC2 (Cell Signaling) antibodies. IPs were loaded on a SDS page gel and ORC2 was detected with the mouse anti-ORC2 antibody (MBL) by immunoblotting. (B) HPV-BP and (C) CIN612-9E cells were synchronized with 2.5 mM double thymidine. Inset diagram shows flow cytometry based cell cycle analysis. ChIP was performed using mouse anti-ORC2 antibodies (MBL). Real-time PCR was completed with primers to the HPV-16 or HPV-31 LCR, a known mammalian origin of replication (GM-CSF), and Exon 9, a non-specific DNA region used as a negative binding control. EE (non-specific IgG) did not bind to these regions of DNA in these experiments and is not shown here.

Article Snippet: The following antibodies were used: Mouse anti-FLAG (M2; Sigma), mouse anti-HA (HA-7; Sigma 3F10; Roche, 12CA5), mouse anti-human ORC2 (MBL), rat anti-human ORC2 (Cell Signaling), mouse anti-HPV-16 E6 (Arbor Vita), mouse anti-EE and anti-β-actin (Sigma).

Techniques: Expressing, Lysis, SDS Page, Western Blot, Flow Cytometry, Cell Cycle Assay, Real-time Polymerase Chain Reaction, Binding Assay

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) C33A were transfected with the FLAG-HPV-31 E2 expression vector. 24 hours later cells were lysed (0.5% NP-40). The lysate from cells untransfected and cells transfected with FLAG-HPV-31 E2 were added to lysis buffer containing protein A and protein G bead slurry and rabbit anti-HPV-31 E2 serum. IPs were immunoblotted with M2 antibodies. (B) CIN612-9E cells were synchronized with 2.5 mM double thymidine. ChIP experiments were performed using mouse anti-EE, an equal mix of rat and mouse anti-ORC2 (Cell Signaling/MBL) or rabbit anti-HPV-31 E2 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in and around the HPV-31 LCR. The locations of the primers are shown below the horizontal axis with the ori labeled. E2 binding sites are located between the LCR2 and LCR4 primer sets. Ct values are normalized to input and EE was set to equal 1. Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to EE. (C) C33A cells were transfected with FLAG-HPV-31 E1 expression vector and lysates were immunoprecipiated with mouse anti-EE, rabbit anti-16 E1, and rat anti-16 E1 antibodies and then immunoblotted with M2 antibodies. (D) W12 cells were synchronized with 2.5 mM double thymidine. ChIP experiments were performed using mouse anti-EE, equal mix of rat and mouse anti-ORC2 antibodies (Cell Signaling/MBL), or rat anti-HPV-16 E1 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in and around the HPV-16 LCR. The locations of the primers are shown below the horizontal axis with the ori labeled. E2 binding sites are located between the LCR3 and E6 primer sets. Ct values are normalized to input and EE was set to equal 1. Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to EE.

Article Snippet: The following antibodies were used: Mouse anti-FLAG (M2; Sigma), mouse anti-HA (HA-7; Sigma 3F10; Roche, 12CA5), mouse anti-human ORC2 (MBL), rat anti-human ORC2 (Cell Signaling), mouse anti-HPV-16 E6 (Arbor Vita), mouse anti-EE and anti-β-actin (Sigma).

Techniques: Transfection, Expressing, Plasmid Preparation, Lysis, Real-time Polymerase Chain Reaction, Labeling, Binding Assay

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) Replication luciferase assays were completed with pFLORI31 and ORC2 depletion. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. ORC2 shRNA decreased ORC2 protein expression in C33A cells. (B) ORC2 shRNA decreased EBNA-1 based replication using the pREP4 plasmid (EBNA-1 based replication) in C33A cells. (C) ORC2 shRNA decreased ORC2 protein expression in HPV-BP and SiHa cells. (D) ORC2 knockdown increased HPV replication in cells containing HPV-16 episomes (HPV-BP) but not in cells with integrated HPV-16 (SiHa). HPV-BP and SiHa cells were transfected with 5.5 μg of shRNA hairpins. 7d later, cells were harvested and HPV-16 copy number (HPV-16 LCR) as normalized to GM-CSF ori #2. This experiment was performed three times with a representative image presented here.

Article Snippet: The following antibodies were used: Mouse anti-FLAG (M2; Sigma), mouse anti-HA (HA-7; Sigma 3F10; Roche, 12CA5), mouse anti-human ORC2 (MBL), rat anti-human ORC2 (Cell Signaling), mouse anti-HPV-16 E6 (Arbor Vita), mouse anti-EE and anti-β-actin (Sigma).

Techniques: Luciferase, shRNA, Expressing, Plasmid Preparation, Transfection

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) ORC2 siRNA duplexes decreased ORC2 protein levels at a concentration of 15 or 5 nM after 48 h. (B) CIN612-9E cells were transfected with RLuc and pFLORI31. 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (C) CIN612-9E cells were transfected with 15 nM ORC2 and differentiated in 10% FBS DMEM + 2 mM CaCl 2 for 48h. Involucrin and β-actin levels were analyzed. (D) CIN612-9E cells were transfected with RLuc and pFLORI31. Five hours later, the transfection was removed and cells were placed in either E-medium or 10% FBS DMEM + 2 mM CaCl 2 . 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (E) CIN612-9E cells were transfected with 15 nM control or ORC2 siRNAs, RLuc and pFLORI31. Five hours later, the transfection was removed and cells were placed in 10% FBS DMEM + 2 mM CaCl 2 . 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (F) CIN612-9E cells were transfected with 15 nM control or ORC2 siRNAs and placed in 10% FBS DMEM + 2 mM CaCl 2 for 72 h. DNA was isolated and HPV-31 DNA content was measured by RT-PCR and normalized to β-actin levels. The ORC2 siRNA group was normalized to the control siRNA group (control siRNA = 1). Values are expressed mean +/-. * p-value ≤ 0.05.

Article Snippet: The following antibodies were used: Mouse anti-FLAG (M2; Sigma), mouse anti-HA (HA-7; Sigma 3F10; Roche, 12CA5), mouse anti-human ORC2 (MBL), rat anti-human ORC2 (Cell Signaling), mouse anti-HPV-16 E6 (Arbor Vita), mouse anti-EE and anti-β-actin (Sigma).

Techniques: Concentration Assay, Transfection, Luciferase, Activity Assay, Isolation, Reverse Transcription Polymerase Chain Reaction

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: CIN612-9E cells were transfected with 30 nM of control or ORC2 siRNAs for 48 h. ChIP experiments were performed using (A) rabbit anti-HPV-31 E2 antibodies or (B) rat E1 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in HPV-31 LCR previously found to be enriched for E2 binding. E2 binding sites are located between the LCR2 and LCR4 primer sets. Ct values are normalized to input and values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to control siRNA.

Article Snippet: The following antibodies were used: Mouse anti-FLAG (M2; Sigma), mouse anti-HA (HA-7; Sigma 3F10; Roche, 12CA5), mouse anti-human ORC2 (MBL), rat anti-human ORC2 (Cell Signaling), mouse anti-HPV-16 E6 (Arbor Vita), mouse anti-EE and anti-β-actin (Sigma).

Techniques: Transfection, Real-time Polymerase Chain Reaction, Binding Assay

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) Lysates (1% NP-40) for i31E2 cells ± Dox and control/HPV-16E2 U2OS cell lines were blotted with FLAG-M2 (HPV-31 E2), TGV261 (HPV-16 E2), ORC2 (MBL) and β-actin antibodies. (B,C) TRE-x U2OS cells containing pcDNA4/TO-FLAG 31E2 (i31E2, ± 48h Dox treatment) and Control and 16E2 U2OS cells were treated overnight with 2.5 mM thymidine, released the next day for 6h, followed by 2.5 mM thymidine treatment overnight. ChIP was performed with an equal mix of mouse/rat-ORC2 antibodies (MBL/Cell Signaling) on the GM-CSF ori (B) or the lamin B2 (LB) ori (C). ChIP experiments were performed at least three times. The Ct values for ORC2 binding were first normalized to input for each cell line. ORC2 levels for the E2 expressing cell lines were normalized to the control cell lines (no E2). Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to control cell line.

Article Snippet: The following antibodies were used: Mouse anti-FLAG (M2; Sigma), mouse anti-HA (HA-7; Sigma 3F10; Roche, 12CA5), mouse anti-human ORC2 (MBL), rat anti-human ORC2 (Cell Signaling), mouse anti-HPV-16 E6 (Arbor Vita), mouse anti-EE and anti-β-actin (Sigma).

Techniques: Binding Assay, Expressing