oligos Thermo Fisher Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Millipore tpx2 sirna oligos pool
    Increase of sub-G1 and reduction of G1 to S phase cells via <t>TPX2</t> silencing. Notes: ( A ) PPC1 cells were synchronized by double thymidine and nocodazol (Thy–Thy–Noc) block or double thymidine (Thy–Thy) block and then released for the indicated time period. The phase of cell fracture during cell cycle progression was monitored through protein expression evolution. Cyclin B1 indicated G2/M phase progression, and cyclin A indicated S to G2/M phase progression. TPX2 protein levels were measured using a Western blot assay. ( B ) Scrambled <t>siRNA</t> (20 nM, si-CTL) or the siRNA <t>oligos</t> pool against TPX2 (20 nM, si-TPX2) was transfected into PPC1 cells for 72 h, followed by cell harvesting. The knockdown cells were fixed and stained with DAPI to examine the proportions of the cell cycle by using an image-flow cytometry assay. ( C ) Representative data for cell cycle proportions were analyzed and quantified using Nucleoview NC-3000 software. The results are expressed as mean ± SD from three individual experiments (Student’s t -test, P
    Tpx2 Sirna Oligos Pool, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tpx2 sirna oligos pool/product/Millipore
    Average 95 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    tpx2 sirna oligos pool - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    90
    Thermo Fisher dna oligonucleotides
    Extension from PPT62 at a nick followed by the M-MuLV <t>RNA.</t> 5′ end-labeled PPT62 without a downstream oligonucleotide (none) (lanes 1, 4, 7, 10, 13, and 16 to 19) or with downstream MLVnick (lanes 2, 5, 8, 11, 14, and 20 to 23) or MLVnickD (lanes 3, 6, 9, 12, 15, and 24 to 27) was annealed to template 2. Extensions were carried out with T7 <t>DNA</t> polymerase (T7; lanes 4 to 6), T4 DNA polymerase (T4; lanes 7 to 9), RTΔH (lanes 10 to 12), wild-type reverse transcriptase (wt RT; lanes 13 to 15) or H − RT (lanes 17 to 19, 21 to 23, and 25 to 27) for the indicated times. Substrates incubated without enzyme are shown in lanes 1 to 3, 16, 20, and 24. The products were analyzed in a 20% sequencing gel and visualized using a PhosphorImager. A schematic of the nicked substrate II tested is shown at top, and the positions of unextended PPT62 and the full-length extension product are indicated on the right.
    Dna Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1062 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna oligonucleotides/product/Thermo Fisher
    Average 90 stars, based on 1062 article reviews
    Price from $9.99 to $1999.99
    dna oligonucleotides - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    82
    Thermo Fisher oligo dt oligonucleotides
    Extension from PPT62 at a nick followed by the M-MuLV <t>RNA.</t> 5′ end-labeled PPT62 without a downstream oligonucleotide (none) (lanes 1, 4, 7, 10, 13, and 16 to 19) or with downstream MLVnick (lanes 2, 5, 8, 11, 14, and 20 to 23) or MLVnickD (lanes 3, 6, 9, 12, 15, and 24 to 27) was annealed to template 2. Extensions were carried out with T7 <t>DNA</t> polymerase (T7; lanes 4 to 6), T4 DNA polymerase (T4; lanes 7 to 9), RTΔH (lanes 10 to 12), wild-type reverse transcriptase (wt RT; lanes 13 to 15) or H − RT (lanes 17 to 19, 21 to 23, and 25 to 27) for the indicated times. Substrates incubated without enzyme are shown in lanes 1 to 3, 16, 20, and 24. The products were analyzed in a 20% sequencing gel and visualized using a PhosphorImager. A schematic of the nicked substrate II tested is shown at top, and the positions of unextended PPT62 and the full-length extension product are indicated on the right.
    Oligo Dt Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo dt oligonucleotides/product/Thermo Fisher
    Average 82 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    oligo dt oligonucleotides - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    77
    Thermo Fisher reagents rnai oligonucleotides oligo
    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool <t>oligonucleotides,</t> seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP <t>RNAi</t> oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P
    Reagents Rnai Oligonucleotides Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reagents rnai oligonucleotides oligo/product/Thermo Fisher
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    reagents rnai oligonucleotides oligo - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    76
    Thermo Fisher oligonucleotide duplexes oligonucleotides
    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool <t>oligonucleotides,</t> seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP <t>RNAi</t> oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P
    Oligonucleotide Duplexes Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 76/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide duplexes oligonucleotides/product/Thermo Fisher
    Average 76 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    oligonucleotide duplexes oligonucleotides - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    99
    Thermo Fisher phosphorylated oligos
    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool <t>oligonucleotides,</t> seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP <t>RNAi</t> oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P
    Phosphorylated Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphorylated oligos/product/Thermo Fisher
    Average 99 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    phosphorylated oligos - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher rte1 oligos
    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool <t>oligonucleotides,</t> seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP <t>RNAi</t> oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P
    Rte1 Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rte1 oligos/product/Thermo Fisher
    Average 86 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    rte1 oligos - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher antisense oligonucleotides
    GOF/LOF screen for p53 network genes regulated by miR-125b. (A) Loss-of-function (LOF) screens were performed in human primary lung fibroblasts (hLF) or mouse 3T3 fibroblasts by transfecting an <t>antisense</t> RNA against both miR-125a and miR-125b (miR-125a/b-AS), or by microinjecting morpholinos (MO) against pre- mir-125b hairpin precursors (all 3 isoforms) into zebrafish embryos. Gain-of-function (GOF) screens were performed in human SH-SY5Y and mouse N2A neuroblastoma by transfecting the miR-125b duplex into cells in culture, or by coinjecting the miR-125b duplex with the morpholinos against pre- mir-125b into zebrafish embryos. Fold changes in gene expression were measured by qRT-PCR twenty-four hours after transfection or injection, relative to the mock and negative control miRNA or morpholino, and shown as log 2 (fold change) using a heat-map. (B) Human: 13 genes were significantly derepressed by a loss of miR-125b, while 20 genes were significantly repressed by a gain of miR-125b, making a total of 22 genes that passed the screen (P
    Antisense Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 804 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense oligonucleotides/product/Thermo Fisher
    Average 99 stars, based on 804 article reviews
    Price from $9.99 to $1999.99
    antisense oligonucleotides - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    79
    Thermo Fisher sigadd34 oligonucleotides
    GOF/LOF screen for p53 network genes regulated by miR-125b. (A) Loss-of-function (LOF) screens were performed in human primary lung fibroblasts (hLF) or mouse 3T3 fibroblasts by transfecting an <t>antisense</t> RNA against both miR-125a and miR-125b (miR-125a/b-AS), or by microinjecting morpholinos (MO) against pre- mir-125b hairpin precursors (all 3 isoforms) into zebrafish embryos. Gain-of-function (GOF) screens were performed in human SH-SY5Y and mouse N2A neuroblastoma by transfecting the miR-125b duplex into cells in culture, or by coinjecting the miR-125b duplex with the morpholinos against pre- mir-125b into zebrafish embryos. Fold changes in gene expression were measured by qRT-PCR twenty-four hours after transfection or injection, relative to the mock and negative control miRNA or morpholino, and shown as log 2 (fold change) using a heat-map. (B) Human: 13 genes were significantly derepressed by a loss of miR-125b, while 20 genes were significantly repressed by a gain of miR-125b, making a total of 22 genes that passed the screen (P
    Sigadd34 Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sigadd34 oligonucleotides/product/Thermo Fisher
    Average 79 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    sigadd34 oligonucleotides - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    97
    Thermo Fisher dsrna oligonucleotides
    GOF/LOF screen for p53 network genes regulated by miR-125b. (A) Loss-of-function (LOF) screens were performed in human primary lung fibroblasts (hLF) or mouse 3T3 fibroblasts by transfecting an <t>antisense</t> RNA against both miR-125a and miR-125b (miR-125a/b-AS), or by microinjecting morpholinos (MO) against pre- mir-125b hairpin precursors (all 3 isoforms) into zebrafish embryos. Gain-of-function (GOF) screens were performed in human SH-SY5Y and mouse N2A neuroblastoma by transfecting the miR-125b duplex into cells in culture, or by coinjecting the miR-125b duplex with the morpholinos against pre- mir-125b into zebrafish embryos. Fold changes in gene expression were measured by qRT-PCR twenty-four hours after transfection or injection, relative to the mock and negative control miRNA or morpholino, and shown as log 2 (fold change) using a heat-map. (B) Human: 13 genes were significantly derepressed by a loss of miR-125b, while 20 genes were significantly repressed by a gain of miR-125b, making a total of 22 genes that passed the screen (P
    Dsrna Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dsrna oligonucleotides/product/Thermo Fisher
    Average 97 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    dsrna oligonucleotides - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    80
    Thermo Fisher siulk oligonucleotides
    GOF/LOF screen for p53 network genes regulated by miR-125b. (A) Loss-of-function (LOF) screens were performed in human primary lung fibroblasts (hLF) or mouse 3T3 fibroblasts by transfecting an <t>antisense</t> RNA against both miR-125a and miR-125b (miR-125a/b-AS), or by microinjecting morpholinos (MO) against pre- mir-125b hairpin precursors (all 3 isoforms) into zebrafish embryos. Gain-of-function (GOF) screens were performed in human SH-SY5Y and mouse N2A neuroblastoma by transfecting the miR-125b duplex into cells in culture, or by coinjecting the miR-125b duplex with the morpholinos against pre- mir-125b into zebrafish embryos. Fold changes in gene expression were measured by qRT-PCR twenty-four hours after transfection or injection, relative to the mock and negative control miRNA or morpholino, and shown as log 2 (fold change) using a heat-map. (B) Human: 13 genes were significantly derepressed by a loss of miR-125b, while 20 genes were significantly repressed by a gain of miR-125b, making a total of 22 genes that passed the screen (P
    Siulk Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/siulk oligonucleotides/product/Thermo Fisher
    Average 80 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    siulk oligonucleotides - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    99
    Thermo Fisher control oligos
    GOF/LOF screen for p53 network genes regulated by miR-125b. (A) Loss-of-function (LOF) screens were performed in human primary lung fibroblasts (hLF) or mouse 3T3 fibroblasts by transfecting an <t>antisense</t> RNA against both miR-125a and miR-125b (miR-125a/b-AS), or by microinjecting morpholinos (MO) against pre- mir-125b hairpin precursors (all 3 isoforms) into zebrafish embryos. Gain-of-function (GOF) screens were performed in human SH-SY5Y and mouse N2A neuroblastoma by transfecting the miR-125b duplex into cells in culture, or by coinjecting the miR-125b duplex with the morpholinos against pre- mir-125b into zebrafish embryos. Fold changes in gene expression were measured by qRT-PCR twenty-four hours after transfection or injection, relative to the mock and negative control miRNA or morpholino, and shown as log 2 (fold change) using a heat-map. (B) Human: 13 genes were significantly derepressed by a loss of miR-125b, while 20 genes were significantly repressed by a gain of miR-125b, making a total of 22 genes that passed the screen (P
    Control Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 125 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control oligos/product/Thermo Fisher
    Average 99 stars, based on 125 article reviews
    Price from $9.99 to $1999.99
    control oligos - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    77
    Thermo Fisher predesigned oligonucleotides
    GOF/LOF screen for p53 network genes regulated by miR-125b. (A) Loss-of-function (LOF) screens were performed in human primary lung fibroblasts (hLF) or mouse 3T3 fibroblasts by transfecting an <t>antisense</t> RNA against both miR-125a and miR-125b (miR-125a/b-AS), or by microinjecting morpholinos (MO) against pre- mir-125b hairpin precursors (all 3 isoforms) into zebrafish embryos. Gain-of-function (GOF) screens were performed in human SH-SY5Y and mouse N2A neuroblastoma by transfecting the miR-125b duplex into cells in culture, or by coinjecting the miR-125b duplex with the morpholinos against pre- mir-125b into zebrafish embryos. Fold changes in gene expression were measured by qRT-PCR twenty-four hours after transfection or injection, relative to the mock and negative control miRNA or morpholino, and shown as log 2 (fold change) using a heat-map. (B) Human: 13 genes were significantly derepressed by a loss of miR-125b, while 20 genes were significantly repressed by a gain of miR-125b, making a total of 22 genes that passed the screen (P
    Predesigned Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/predesigned oligonucleotides/product/Thermo Fisher
    Average 77 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    predesigned oligonucleotides - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    77
    Thermo Fisher gcp2 oligonucleotides
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Gcp2 Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gcp2 oligonucleotides/product/Thermo Fisher
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    gcp2 oligonucleotides - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    99
    Thermo Fisher hexamer oligos
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Hexamer Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hexamer oligos/product/Thermo Fisher
    Average 99 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    hexamer oligos - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher readymade oligos
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Readymade Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/readymade oligos/product/Thermo Fisher
    Average 94 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    readymade oligos - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    77
    Thermo Fisher sitsc2 oligonucleotides
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Sitsc2 Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sitsc2 oligonucleotides/product/Thermo Fisher
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sitsc2 oligonucleotides - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    97
    Thermo Fisher primer oligonucleotides
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Primer Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 114 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer oligonucleotides/product/Thermo Fisher
    Average 97 stars, based on 114 article reviews
    Price from $9.99 to $1999.99
    primer oligonucleotides - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    93
    Thermo Fisher hexameric oligonucleotides
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Hexameric Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hexameric oligonucleotides/product/Thermo Fisher
    Average 93 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    hexameric oligonucleotides - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    77
    Thermo Fisher scramble oligos
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Scramble Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scramble oligos/product/Thermo Fisher
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    scramble oligos - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    77
    Thermo Fisher ribo oligonucleotides
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Ribo Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribo oligonucleotides/product/Thermo Fisher
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ribo oligonucleotides - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    79
    Thermo Fisher individual oligos
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Individual Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/individual oligos/product/Thermo Fisher
    Average 79 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    individual oligos - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    79
    Thermo Fisher oligonucleotides probes
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Oligonucleotides Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides probes/product/Thermo Fisher
    Average 79 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    oligonucleotides probes - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    77
    Thermo Fisher invader oligonucleotides
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Invader Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/invader oligonucleotides/product/Thermo Fisher
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    invader oligonucleotides - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    86
    Thermo Fisher hairpin oligonucleotides
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Hairpin Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hairpin oligonucleotides/product/Thermo Fisher
    Average 86 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    hairpin oligonucleotides - by Bioz Stars, 2020-02
    86/100 stars
      Buy from Supplier

    94
    Thermo Fisher mutagenic oligonucleotides
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Mutagenic Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mutagenic oligonucleotides/product/Thermo Fisher
    Average 94 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    mutagenic oligonucleotides - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    79
    Thermo Fisher degenerate oligonucleotides
    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of <t>GCP2</t> (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.
    Degenerate Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/degenerate oligonucleotides/product/Thermo Fisher
    Average 79 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    degenerate oligonucleotides - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    91
    Thermo Fisher barcode oligonucleotides
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Barcode Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/barcode oligonucleotides/product/Thermo Fisher
    Average 91 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    barcode oligonucleotides - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    76
    Thermo Fisher oligonucleotides gfp oligonucleotides
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Oligonucleotides Gfp Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 76/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides gfp oligonucleotides/product/Thermo Fisher
    Average 76 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    oligonucleotides gfp oligonucleotides - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    79
    Thermo Fisher antisense gccgcggacgacctgatgttccgt oligonucleotides
    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each <t>barcode</t> in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.
    Antisense Gccgcggacgacctgatgttccgt Oligonucleotides, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense gccgcggacgacctgatgttccgt oligonucleotides/product/Thermo Fisher
    Average 79 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    antisense gccgcggacgacctgatgttccgt oligonucleotides - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    Image Search Results


    Increase of sub-G1 and reduction of G1 to S phase cells via TPX2 silencing. Notes: ( A ) PPC1 cells were synchronized by double thymidine and nocodazol (Thy–Thy–Noc) block or double thymidine (Thy–Thy) block and then released for the indicated time period. The phase of cell fracture during cell cycle progression was monitored through protein expression evolution. Cyclin B1 indicated G2/M phase progression, and cyclin A indicated S to G2/M phase progression. TPX2 protein levels were measured using a Western blot assay. ( B ) Scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) was transfected into PPC1 cells for 72 h, followed by cell harvesting. The knockdown cells were fixed and stained with DAPI to examine the proportions of the cell cycle by using an image-flow cytometry assay. ( C ) Representative data for cell cycle proportions were analyzed and quantified using Nucleoview NC-3000 software. The results are expressed as mean ± SD from three individual experiments (Student’s t -test, P

    Journal: OncoTargets and therapy

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer

    doi: 10.2147/OTT.S136491

    Figure Lengend Snippet: Increase of sub-G1 and reduction of G1 to S phase cells via TPX2 silencing. Notes: ( A ) PPC1 cells were synchronized by double thymidine and nocodazol (Thy–Thy–Noc) block or double thymidine (Thy–Thy) block and then released for the indicated time period. The phase of cell fracture during cell cycle progression was monitored through protein expression evolution. Cyclin B1 indicated G2/M phase progression, and cyclin A indicated S to G2/M phase progression. TPX2 protein levels were measured using a Western blot assay. ( B ) Scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) was transfected into PPC1 cells for 72 h, followed by cell harvesting. The knockdown cells were fixed and stained with DAPI to examine the proportions of the cell cycle by using an image-flow cytometry assay. ( C ) Representative data for cell cycle proportions were analyzed and quantified using Nucleoview NC-3000 software. The results are expressed as mean ± SD from three individual experiments (Student’s t -test, P

    Article Snippet: Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols.

    Techniques: Blocking Assay, Expressing, Western Blot, CTL Assay, Transfection, Cell Harvesting, Staining, Flow Cytometry, Cytometry, Software

    TPX2 depletion changes the cell fitness in LNCap prostate cancer cell line. Notes: Scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) was transfected into LNCap human prostate cancer cells for 96 h. ( A ) RT-PCR was used to detect the mRNA levels of TPX2 in LNCap cells. siRNA-transfected cells were harvested and lysed for immunoblotting to determine the protein levels of TPX2. β-actin was used as a loading control. Protein expression was quantified by densitometric analysis. ( B ) Cell viability was measured using the CellTiter-Glo Luminescent Cell Viability Assay, and the luminescence units indicating cell growth were measured and plotted as the growth curve. ( * The cell growth was inhibition in si-TPX2 treated cells compared with si-CTL treated cells). ( C ) Representative data and ( D ) quantitative results of siRNA-transfected cells that were seeded in ultralow attachment 96-well microplates for spheroid formation assays by using ImageJ software. ( E ) LNCap spheroids presented irregular morphology; hence, viable cells were measured using the CellTiter-Glo Luminescent Cell Viability Assay, and the luminescence units indicating cell growth were measured and plotted as the bar plot. ( F ) Scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) was transfected into LNCap cells for 72 h, followed by cell harvesting. The knockdown cells were fixed and stained with DAPI to examine the proportions of the cell cycle by using an image-flow cytometry assay. ( G ) Representative data for cell cycle proportions were analyzed and quantified using Nucleoview NC-3000 software. ( H ) Western blot analysis of the levels of TPX2, CDK1, cyclin B1, CDK2, cyclin A, and cyclin E proteins in TPX2-targeted cells. β-actin was used as a loading control. ( I ) Representative images of TPX2 and Phalloidin (a high-affinity F-actin probe conjugated to the red-orange fluorescent dye, tetramethylrhodamine) immunofluorescence in TPX2-depleted LNCap cells. TPX2 expression was decreased in si-TPX2 treated cells, and morphologic examination of the cell nucleus (DAPI stain) revealed that transfection with the TPX2 RNAi oligo pool resulted in increased multinucleated cells. Scale bar =25 mm; magnification 400×. ( J ) Histograms of multinucleation in LNCap cells. All representative graphs are from two independent experiments. Values are presented as mean ± SD (Student’s t -test, P

    Journal: OncoTargets and therapy

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer

    doi: 10.2147/OTT.S136491

    Figure Lengend Snippet: TPX2 depletion changes the cell fitness in LNCap prostate cancer cell line. Notes: Scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) was transfected into LNCap human prostate cancer cells for 96 h. ( A ) RT-PCR was used to detect the mRNA levels of TPX2 in LNCap cells. siRNA-transfected cells were harvested and lysed for immunoblotting to determine the protein levels of TPX2. β-actin was used as a loading control. Protein expression was quantified by densitometric analysis. ( B ) Cell viability was measured using the CellTiter-Glo Luminescent Cell Viability Assay, and the luminescence units indicating cell growth were measured and plotted as the growth curve. ( * The cell growth was inhibition in si-TPX2 treated cells compared with si-CTL treated cells). ( C ) Representative data and ( D ) quantitative results of siRNA-transfected cells that were seeded in ultralow attachment 96-well microplates for spheroid formation assays by using ImageJ software. ( E ) LNCap spheroids presented irregular morphology; hence, viable cells were measured using the CellTiter-Glo Luminescent Cell Viability Assay, and the luminescence units indicating cell growth were measured and plotted as the bar plot. ( F ) Scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) was transfected into LNCap cells for 72 h, followed by cell harvesting. The knockdown cells were fixed and stained with DAPI to examine the proportions of the cell cycle by using an image-flow cytometry assay. ( G ) Representative data for cell cycle proportions were analyzed and quantified using Nucleoview NC-3000 software. ( H ) Western blot analysis of the levels of TPX2, CDK1, cyclin B1, CDK2, cyclin A, and cyclin E proteins in TPX2-targeted cells. β-actin was used as a loading control. ( I ) Representative images of TPX2 and Phalloidin (a high-affinity F-actin probe conjugated to the red-orange fluorescent dye, tetramethylrhodamine) immunofluorescence in TPX2-depleted LNCap cells. TPX2 expression was decreased in si-TPX2 treated cells, and morphologic examination of the cell nucleus (DAPI stain) revealed that transfection with the TPX2 RNAi oligo pool resulted in increased multinucleated cells. Scale bar =25 mm; magnification 400×. ( J ) Histograms of multinucleation in LNCap cells. All representative graphs are from two independent experiments. Values are presented as mean ± SD (Student’s t -test, P

    Article Snippet: Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols.

    Techniques: CTL Assay, Transfection, Reverse Transcription Polymerase Chain Reaction, Expressing, Cell Viability Assay, Inhibition, Software, Cell Harvesting, Staining, Flow Cytometry, Cytometry, Western Blot, Immunofluorescence

    PPC1 cell apoptosis caused by TPX2 silencing. Notes: Annexin V expression analysis was used for apoptosis cell detection. ( A ) Representative images of scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) that was transfected into PPC1 cells for 72 h, followed by cell staining with annexin V (green) and Hoechst 33342 (nucleus; blue) for the immunofluorescence assay. Notably, annexin V was increased in the si-TPX2–treated cells. Scale bar =50 mm; magnification 200×. ( B ) Quantitative results of annexin V-positive staining cell. Values are presented as mean ± SD (Student’s t -test, P

    Journal: OncoTargets and therapy

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer

    doi: 10.2147/OTT.S136491

    Figure Lengend Snippet: PPC1 cell apoptosis caused by TPX2 silencing. Notes: Annexin V expression analysis was used for apoptosis cell detection. ( A ) Representative images of scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) that was transfected into PPC1 cells for 72 h, followed by cell staining with annexin V (green) and Hoechst 33342 (nucleus; blue) for the immunofluorescence assay. Notably, annexin V was increased in the si-TPX2–treated cells. Scale bar =50 mm; magnification 200×. ( B ) Quantitative results of annexin V-positive staining cell. Values are presented as mean ± SD (Student’s t -test, P

    Article Snippet: Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols.

    Techniques: Expressing, CTL Assay, Transfection, Staining, Immunofluorescence

    Depletion of TPX2, as reflected by changes in cell cycle regulation. Notes: ( A ) Graphical representation of a heat map showing fourfold gene expression changes in TPX2-depleted PPC1 cells. ( B ) Scatter plot analysis of gene expression changes; specifically, 1 gene was upregulated (red circle) and 15 genes were downregulated (green circles). ( C ) Fold change of normalized expression between scrambled siRNA and the siRNA oligo pool-transfected PPC1 cells that were analyzed using pathway-focused validated qPCR arrays; notably, downregulation of genes is associated with cell cycle progression and proliferation in conjunction with the upregulation of growth inhibitory genes. Abbreviations: qPCR, quantitative polymerase chain reaction; si-CTL, small interference-negative control.

    Journal: OncoTargets and therapy

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer

    doi: 10.2147/OTT.S136491

    Figure Lengend Snippet: Depletion of TPX2, as reflected by changes in cell cycle regulation. Notes: ( A ) Graphical representation of a heat map showing fourfold gene expression changes in TPX2-depleted PPC1 cells. ( B ) Scatter plot analysis of gene expression changes; specifically, 1 gene was upregulated (red circle) and 15 genes were downregulated (green circles). ( C ) Fold change of normalized expression between scrambled siRNA and the siRNA oligo pool-transfected PPC1 cells that were analyzed using pathway-focused validated qPCR arrays; notably, downregulation of genes is associated with cell cycle progression and proliferation in conjunction with the upregulation of growth inhibitory genes. Abbreviations: qPCR, quantitative polymerase chain reaction; si-CTL, small interference-negative control.

    Article Snippet: Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols.

    Techniques: Expressing, Transfection, Real-time Polymerase Chain Reaction, CTL Assay, Negative Control

    Inhibition of cell growth and reduction of tumorigenesis in human prostate cancer cell lines via TPX2 silencing. Notes: Scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) was transfected into human prostate cancer cells (PPC1) for 72 h. ( A ) Cells were harvested and lysed for immunoblotting to determine the protein levels of TPX2. β-actin was used as a loading control. Protein expression was quantified by densitometric analysis. The ratios (TPX2/β-actin) of band intensities are shown. ( B ) Cell viability was measured using the CellTiter-Glo Luminescent Cell Viability Assay, and the luminescence units indicating cell growth were measured and plotted as the growth curve. ( * The cell growth was inhibition in si-TPX2 treated cells compared with si-CTL treated cells). ( C ) Representative data and quantitative results of siRNA-transfected cells that were seeded in six-well plates for the clonogenic assay. ( D ) Representative data and quantitative results of siRNA-transfected cells that were seeded in ultralow attachment 96-well microplates for spheroid formation assays. All representative graphs are from three independent experiments. Values are presented as mean ± SD (Student’s t -test, P

    Journal: OncoTargets and therapy

    Article Title: Targeted TPX2 increases chromosome missegregation and suppresses tumor cell growth in human prostate cancer

    doi: 10.2147/OTT.S136491

    Figure Lengend Snippet: Inhibition of cell growth and reduction of tumorigenesis in human prostate cancer cell lines via TPX2 silencing. Notes: Scrambled siRNA (20 nM, si-CTL) or the siRNA oligos pool against TPX2 (20 nM, si-TPX2) was transfected into human prostate cancer cells (PPC1) for 72 h. ( A ) Cells were harvested and lysed for immunoblotting to determine the protein levels of TPX2. β-actin was used as a loading control. Protein expression was quantified by densitometric analysis. The ratios (TPX2/β-actin) of band intensities are shown. ( B ) Cell viability was measured using the CellTiter-Glo Luminescent Cell Viability Assay, and the luminescence units indicating cell growth were measured and plotted as the growth curve. ( * The cell growth was inhibition in si-TPX2 treated cells compared with si-CTL treated cells). ( C ) Representative data and quantitative results of siRNA-transfected cells that were seeded in six-well plates for the clonogenic assay. ( D ) Representative data and quantitative results of siRNA-transfected cells that were seeded in ultralow attachment 96-well microplates for spheroid formation assays. All representative graphs are from three independent experiments. Values are presented as mean ± SD (Student’s t -test, P

    Article Snippet: Small interfering RNA (siRNA) and knockdown of gene expression The TPX2 siRNA oligos pool (1: 5′-GGACGAACCGGUAGUGAU-3′; 2: 5′-GCAUAAGGCAAAUCCAAUA-3′; 3: 5′-GUACCAUUGUUAAGCCUUU-3′; 4: 5′-GAAAUU CUACCCUCUAAGA-3′) was synthesized by Sigma-Aldrich Co. All transient transfections of the TPX2 siRNA oligos pool at a final concentration of 20 nM were accomplished with LipofectAMINE RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s protocols.

    Techniques: Inhibition, CTL Assay, Transfection, Expressing, Cell Viability Assay, Clonogenic Assay

    Extension from PPT62 at a nick followed by the M-MuLV RNA. 5′ end-labeled PPT62 without a downstream oligonucleotide (none) (lanes 1, 4, 7, 10, 13, and 16 to 19) or with downstream MLVnick (lanes 2, 5, 8, 11, 14, and 20 to 23) or MLVnickD (lanes 3, 6, 9, 12, 15, and 24 to 27) was annealed to template 2. Extensions were carried out with T7 DNA polymerase (T7; lanes 4 to 6), T4 DNA polymerase (T4; lanes 7 to 9), RTΔH (lanes 10 to 12), wild-type reverse transcriptase (wt RT; lanes 13 to 15) or H − RT (lanes 17 to 19, 21 to 23, and 25 to 27) for the indicated times. Substrates incubated without enzyme are shown in lanes 1 to 3, 16, 20, and 24. The products were analyzed in a 20% sequencing gel and visualized using a PhosphorImager. A schematic of the nicked substrate II tested is shown at top, and the positions of unextended PPT62 and the full-length extension product are indicated on the right.

    Journal: Journal of Virology

    Article Title: Specific Cleavages by RNase H Facilitate Initiation of Plus-Strand RNA Synthesis by Moloney Murine Leukemia Virus

    doi: 10.1128/JVI.77.9.5275-5285.2003

    Figure Lengend Snippet: Extension from PPT62 at a nick followed by the M-MuLV RNA. 5′ end-labeled PPT62 without a downstream oligonucleotide (none) (lanes 1, 4, 7, 10, 13, and 16 to 19) or with downstream MLVnick (lanes 2, 5, 8, 11, 14, and 20 to 23) or MLVnickD (lanes 3, 6, 9, 12, 15, and 24 to 27) was annealed to template 2. Extensions were carried out with T7 DNA polymerase (T7; lanes 4 to 6), T4 DNA polymerase (T4; lanes 7 to 9), RTΔH (lanes 10 to 12), wild-type reverse transcriptase (wt RT; lanes 13 to 15) or H − RT (lanes 17 to 19, 21 to 23, and 25 to 27) for the indicated times. Substrates incubated without enzyme are shown in lanes 1 to 3, 16, 20, and 24. The products were analyzed in a 20% sequencing gel and visualized using a PhosphorImager. A schematic of the nicked substrate II tested is shown at top, and the positions of unextended PPT62 and the full-length extension product are indicated on the right.

    Article Snippet: RNA oligonucleotides were obtained from Oligos Etc., DNA oligonucleotides were purchased from Invitrogen, and all oligonucleotides were gel purified prior to use.

    Techniques: Labeling, Incubation, Sequencing

    Model hybrid substrates with RNAs and oligonucleotides used in extension and cleavage analyses. (A) General structures of model hybrid substrates I to IV. Template strands are shown as thin lines with their 5′ and 3′ ends indicated. Oligonucleotides or RNAs annealed to template strands are shown as arrows originating at the 3′ ends. When applicable, positions of RNAs or oligonucleotides are described as upstream or downstream relative to the PPT primer cleavage site (indicated by vertical dashed line), which is based upon the plus-strand origin found within the PPT of the M-MuLV genome. Substrate I contains a 62-nt plus-strand primer (PPT62) with a 3′ end at position −1. Substrate II contains a downstream DNA or RNA oligonucleotide abutting the 3′ end of PPT62 and creating a nick. In substrate III, the 5′-end position of the downstream oligonucleotide creates a gap of 2, 5, or 12 bases from the 3′ end of PPT62. Substrate IV contains a 79-nt MLV RNA, which is a continuous RNA without a gap or nick. (B) The names and sequences of RNAs and oligonucleotides annealed to the template strands are shown relative to the −1 and +1 positions that border the plus-strand origin. The downstream oligonucleotides derived from the M-MuLV sequence are termed MLV, while the downstream oligonucleotide derived from an unrelated sequence is referred to as HET (for heterologous). The PPT sequence for the 79-nt MLV RNA is underlined. Sequences not derived from the M-MuLV genome are boxed. With the exception of the deoxyribonucleotide MLVnickD, all sequences are ribonucleotides.

    Journal: Journal of Virology

    Article Title: Specific Cleavages by RNase H Facilitate Initiation of Plus-Strand RNA Synthesis by Moloney Murine Leukemia Virus

    doi: 10.1128/JVI.77.9.5275-5285.2003

    Figure Lengend Snippet: Model hybrid substrates with RNAs and oligonucleotides used in extension and cleavage analyses. (A) General structures of model hybrid substrates I to IV. Template strands are shown as thin lines with their 5′ and 3′ ends indicated. Oligonucleotides or RNAs annealed to template strands are shown as arrows originating at the 3′ ends. When applicable, positions of RNAs or oligonucleotides are described as upstream or downstream relative to the PPT primer cleavage site (indicated by vertical dashed line), which is based upon the plus-strand origin found within the PPT of the M-MuLV genome. Substrate I contains a 62-nt plus-strand primer (PPT62) with a 3′ end at position −1. Substrate II contains a downstream DNA or RNA oligonucleotide abutting the 3′ end of PPT62 and creating a nick. In substrate III, the 5′-end position of the downstream oligonucleotide creates a gap of 2, 5, or 12 bases from the 3′ end of PPT62. Substrate IV contains a 79-nt MLV RNA, which is a continuous RNA without a gap or nick. (B) The names and sequences of RNAs and oligonucleotides annealed to the template strands are shown relative to the −1 and +1 positions that border the plus-strand origin. The downstream oligonucleotides derived from the M-MuLV sequence are termed MLV, while the downstream oligonucleotide derived from an unrelated sequence is referred to as HET (for heterologous). The PPT sequence for the 79-nt MLV RNA is underlined. Sequences not derived from the M-MuLV genome are boxed. With the exception of the deoxyribonucleotide MLVnickD, all sequences are ribonucleotides.

    Article Snippet: RNA oligonucleotides were obtained from Oligos Etc., DNA oligonucleotides were purchased from Invitrogen, and all oligonucleotides were gel purified prior to use.

    Techniques: Derivative Assay, Sequencing

    Model for initiation of M-MuLV plus-strand RNA synthesis. In the diagram, plus-strand RNA is represented by thick gray lines, minus-strand DNA is represented by thin black arrows pointing to the left, nascent plus-strand DNA is represented by thick black arrows, and the PPT is boxed. RNase H cleavage sites are denoted by vertical arrows, and several specific sites are indicated. The model is described in the Discussion.

    Journal: Journal of Virology

    Article Title: Specific Cleavages by RNase H Facilitate Initiation of Plus-Strand RNA Synthesis by Moloney Murine Leukemia Virus

    doi: 10.1128/JVI.77.9.5275-5285.2003

    Figure Lengend Snippet: Model for initiation of M-MuLV plus-strand RNA synthesis. In the diagram, plus-strand RNA is represented by thick gray lines, minus-strand DNA is represented by thin black arrows pointing to the left, nascent plus-strand DNA is represented by thick black arrows, and the PPT is boxed. RNase H cleavage sites are denoted by vertical arrows, and several specific sites are indicated. The model is described in the Discussion.

    Article Snippet: RNA oligonucleotides were obtained from Oligos Etc., DNA oligonucleotides were purchased from Invitrogen, and all oligonucleotides were gel purified prior to use.

    Techniques:

    RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool oligonucleotides, seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP RNAi oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P

    Journal: The Journal of Cell Biology

    Article Title: RCP-driven ?5?1 recycling suppresses Rac and promotes RhoA activity via the RacGAP1-IQGAP1 complex

    doi: 10.1083/jcb.201302041

    Figure Lengend Snippet: RacGAP1 is required for pseudopod extension and invasion. (A) A2780 cells were transfected with control or RacGAP1-specific SMARTpool oligonucleotides, seeded onto CDMs, and stimulated with cRGDfV as indicated. Images were captured every 10 min using a 20× objective lens. Representative images are shown. Bar, 50 µm. (B) Pseudopod length ( n > 400/condition) was measured for all moving cells within the 20th frame. (C) A2780 cells were transfected as in A and seeded into inverted invasion assays after 16 h in the presence or absence of FN and cRGDfV as indicated. The yellow line indicates the level of invasion under control conditions. (D) A2780 cells stably expressing GFP or FLAG-RacGAP1 WT were transfected with control or RacGAP RNAi oligo #6, treated as in C, and seeded into inverted invasion assays in the presence of cRGDfV and FN. (E) MDA-MB-231 cells were transfected as in A and seeded into inverted invasion assays in the presence of FN. (F) H1299 cells stably expressing mutant p53 (273H) or control vector (VEC) were transfected as in A and seeded into inverted invasion assays in the presence of FN. Data represent means ± SEM from at least three independent experiments. *, P

    Article Snippet: Plasmids and reagents RNAi oligonucleotides (oligo) were purchased from Thermo Fisher Scientific as follows: ON-TARGETplus nontargeting siRNA (single oligo or pool as appropriate); IQGAP1 #1 (5′-GAACGUGGCUUAUGAGUAC-3′); IQGAP1 #2 (J-004694-08); RacGAP1 (SMARTpool, oligo 6, 5′-GCGAAGUGCUCUGGAUGUU-3′; and oligo 8, 5′-GAAGUCACAUCUGCCUGUU-3′); Rac1 (SMARTpool or Rac1 #1, 5′-CGGCACCACUGUCCCAACA-3′); RhoA (SMARTpool or RhoA #1, 5′-AUGGAAAGCAGGUAGAGUU-3′); and RCP (J-015968-10). shRNA vectors for PKB/Akt isoforms were prepared using mU6Pro and the following sequences: Akt1 #1, 5′-GCTACTTCCTCCTCAAGAA-3′; Akt1 #2, 5′-CGAGTTTGAGTACCTGAAG-3′; Akt2 #1, 5′-CGTGGTGAATACATCAAGA-3′; and Akt2# 2, 5′-TCTGTCATCAAAGAAGGCT-3′.

    Techniques: Transfection, Stable Transfection, Expressing, Multiple Displacement Amplification, Mutagenesis, Plasmid Preparation

    Integrin trafficking suppresses Rac activity and activates RhoA through the RacGAP1–IQGAP1 complex. (A) A2780 cells were subjected to control or RacGAP1 oligo #6 RNAi and allowed to recover for 24 h. Cells were then transfected with Raichu-Rac or Raichu-RhoA as indicated and seeded onto CDM. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C ; n ≥ 15/condition). (B) A2780 cells were subjected to control or IQGAP1 oligo #1 RNAi and allowed to recover for 24 h. Cells were then transfected with Raichu-Rac or Raichu-RhoA as indicated and seeded onto the CDM. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C ; n ≥ 8/condition). (C) A2780 cells stably expressing RacGAP1 WT , RacGAP1 249A , or RacGAP1 249D were transfected with Raichu-Rac and seeded onto CDMs. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C) . Representative images are shown ( n ≥ 8/condition). (D) A2780 cells stably expressing RacGAP1 WT , RacGAP1 249A , or RacGAP1 249D were transfected with Raichu-RhoA and seeded onto CDMs. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C) . Representative images are shown ( n ≥ 4/condition). Zoomed insets correspond to areas indicated by dotted ROIs. Yellow lines represent the baseline activity as determined by an inactive mutant of the probe. Data represent means ± SEM from at least three independent experiments. *, P

    Journal: The Journal of Cell Biology

    Article Title: RCP-driven ?5?1 recycling suppresses Rac and promotes RhoA activity via the RacGAP1-IQGAP1 complex

    doi: 10.1083/jcb.201302041

    Figure Lengend Snippet: Integrin trafficking suppresses Rac activity and activates RhoA through the RacGAP1–IQGAP1 complex. (A) A2780 cells were subjected to control or RacGAP1 oligo #6 RNAi and allowed to recover for 24 h. Cells were then transfected with Raichu-Rac or Raichu-RhoA as indicated and seeded onto CDM. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C ; n ≥ 15/condition). (B) A2780 cells were subjected to control or IQGAP1 oligo #1 RNAi and allowed to recover for 24 h. Cells were then transfected with Raichu-Rac or Raichu-RhoA as indicated and seeded onto the CDM. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C ; n ≥ 8/condition). (C) A2780 cells stably expressing RacGAP1 WT , RacGAP1 249A , or RacGAP1 249D were transfected with Raichu-Rac and seeded onto CDMs. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C) . Representative images are shown ( n ≥ 8/condition). (D) A2780 cells stably expressing RacGAP1 WT , RacGAP1 249A , or RacGAP1 249D were transfected with Raichu-RhoA and seeded onto CDMs. FLIM was performed, and FRET efficiency at the cell front was calculated as in Fig. 6 (A–C) . Representative images are shown ( n ≥ 4/condition). Zoomed insets correspond to areas indicated by dotted ROIs. Yellow lines represent the baseline activity as determined by an inactive mutant of the probe. Data represent means ± SEM from at least three independent experiments. *, P

    Article Snippet: Plasmids and reagents RNAi oligonucleotides (oligo) were purchased from Thermo Fisher Scientific as follows: ON-TARGETplus nontargeting siRNA (single oligo or pool as appropriate); IQGAP1 #1 (5′-GAACGUGGCUUAUGAGUAC-3′); IQGAP1 #2 (J-004694-08); RacGAP1 (SMARTpool, oligo 6, 5′-GCGAAGUGCUCUGGAUGUU-3′; and oligo 8, 5′-GAAGUCACAUCUGCCUGUU-3′); Rac1 (SMARTpool or Rac1 #1, 5′-CGGCACCACUGUCCCAACA-3′); RhoA (SMARTpool or RhoA #1, 5′-AUGGAAAGCAGGUAGAGUU-3′); and RCP (J-015968-10). shRNA vectors for PKB/Akt isoforms were prepared using mU6Pro and the following sequences: Akt1 #1, 5′-GCTACTTCCTCCTCAAGAA-3′; Akt1 #2, 5′-CGAGTTTGAGTACCTGAAG-3′; Akt2 #1, 5′-CGTGGTGAATACATCAAGA-3′; and Akt2# 2, 5′-TCTGTCATCAAAGAAGGCT-3′.

    Techniques: Activity Assay, Transfection, Stable Transfection, Expressing, Mutagenesis

    GOF/LOF screen for p53 network genes regulated by miR-125b. (A) Loss-of-function (LOF) screens were performed in human primary lung fibroblasts (hLF) or mouse 3T3 fibroblasts by transfecting an antisense RNA against both miR-125a and miR-125b (miR-125a/b-AS), or by microinjecting morpholinos (MO) against pre- mir-125b hairpin precursors (all 3 isoforms) into zebrafish embryos. Gain-of-function (GOF) screens were performed in human SH-SY5Y and mouse N2A neuroblastoma by transfecting the miR-125b duplex into cells in culture, or by coinjecting the miR-125b duplex with the morpholinos against pre- mir-125b into zebrafish embryos. Fold changes in gene expression were measured by qRT-PCR twenty-four hours after transfection or injection, relative to the mock and negative control miRNA or morpholino, and shown as log 2 (fold change) using a heat-map. (B) Human: 13 genes were significantly derepressed by a loss of miR-125b, while 20 genes were significantly repressed by a gain of miR-125b, making a total of 22 genes that passed the screen (P

    Journal: PLoS Genetics

    Article Title: Conserved Regulation of p53 Network Dosage by MicroRNA-125b Occurs through Evolving miRNA-Target Gene Pairs

    doi: 10.1371/journal.pgen.1002242

    Figure Lengend Snippet: GOF/LOF screen for p53 network genes regulated by miR-125b. (A) Loss-of-function (LOF) screens were performed in human primary lung fibroblasts (hLF) or mouse 3T3 fibroblasts by transfecting an antisense RNA against both miR-125a and miR-125b (miR-125a/b-AS), or by microinjecting morpholinos (MO) against pre- mir-125b hairpin precursors (all 3 isoforms) into zebrafish embryos. Gain-of-function (GOF) screens were performed in human SH-SY5Y and mouse N2A neuroblastoma by transfecting the miR-125b duplex into cells in culture, or by coinjecting the miR-125b duplex with the morpholinos against pre- mir-125b into zebrafish embryos. Fold changes in gene expression were measured by qRT-PCR twenty-four hours after transfection or injection, relative to the mock and negative control miRNA or morpholino, and shown as log 2 (fold change) using a heat-map. (B) Human: 13 genes were significantly derepressed by a loss of miR-125b, while 20 genes were significantly repressed by a gain of miR-125b, making a total of 22 genes that passed the screen (P

    Article Snippet: Neuro-2A cells, 3T3 cells, SH-SY5Y cells and human lung fibroblast cells were transfected in suspension with 5×105 cells per well in 6-well plates using lipofectamin-2000 (Invitrogen). miRNA duplexes and antisense oligonucleotides (Ambion) were transfected at a final concentration of 80 nM.

    Techniques: Expressing, Quantitative RT-PCR, Transfection, Injection, Negative Control

    γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of GCP2 (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.

    Journal: Nature cell biology

    Article Title: The Nup107-160 complex and ?-TuRC regulate microtubule polymerization at kinetochores

    doi: 10.1038/ncb2016

    Figure Lengend Snippet: γ-TuRC is recruited to kinetochores by Nup107-160 ( a ) HeLa cells were depleted of GCP2 (second row) or Nup160 (third row) by siRNA. The cells were treated with nocodazole for 16 hrs and processed for indirect immunofluorescence with antibodies against GCP2 (second column, green) and kinetochore marker CREST serum (third column, red) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (left, blue). Inset shows enlarged, merged image of kinetochores. Top row shows HeLa cells transfected with a control siRNA, treated in an identical manner. Scale bar = 5 µm. ( b ) HeLa cells were treated as in (a), stained with antibodies against Nup107 (second row, green) and counterstained with Hoechst 33342 dye to visualize chromosomal DNA (top row, blue). ( c ) Whole cell extracts from control HeLa cells (left), cells depleted of Nup160 (center) or cells depleted of GCP2 (right) were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs.

    Article Snippet: All oligonucleotides were obtained from Qiagen, except GCP2 oligonucleotides were from Invitrogen.

    Techniques: Immunofluorescence, Marker, Transfection, Staining, Western Blot

    Nup107-160 is critical for MT nucleation at kinetochores in HeLa cells ( a ) HeLa cells transfected with a control siRNA (top panels), a siRNA against Nup160 (middle panels) or an siRNA directed against GCP2 (bottom panels). The cells were analyzed in a MT re-growth assay at 2 minutes after being returned to 37°C, with staining for α-tubulin (red) and Nup107 (green). Mitotic cells were identified by chromosome morphology through counterstaining with Hoechst 33342 dye (blue). Scale bar= 5 µm ( b ) Whole cell extracts were made from control HeLa cells (left), or cells depleted of Nup107-160 (center) or of GCP2 (right). The extracts were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs. ). Uncropped images of the blots are shown in Supplementary Information, Fig. S3 .

    Journal: Nature cell biology

    Article Title: The Nup107-160 complex and ?-TuRC regulate microtubule polymerization at kinetochores

    doi: 10.1038/ncb2016

    Figure Lengend Snippet: Nup107-160 is critical for MT nucleation at kinetochores in HeLa cells ( a ) HeLa cells transfected with a control siRNA (top panels), a siRNA against Nup160 (middle panels) or an siRNA directed against GCP2 (bottom panels). The cells were analyzed in a MT re-growth assay at 2 minutes after being returned to 37°C, with staining for α-tubulin (red) and Nup107 (green). Mitotic cells were identified by chromosome morphology through counterstaining with Hoechst 33342 dye (blue). Scale bar= 5 µm ( b ) Whole cell extracts were made from control HeLa cells (left), or cells depleted of Nup107-160 (center) or of GCP2 (right). The extracts were analyzed by Western blotting with the indicated antibodies to monitor the overall level of depletion through siRNAs. ). Uncropped images of the blots are shown in Supplementary Information, Fig. S3 .

    Article Snippet: All oligonucleotides were obtained from Qiagen, except GCP2 oligonucleotides were from Invitrogen.

    Techniques: Transfection, Growth Assay, Staining, Western Blot

    Ran-GTP regulates MT nucleation by xNup107-160 / γ-TuRC complexes ( a ) Magnetic beads coated with control IgG, anti-xNup160 or anti-xGCP2 antibodies were incubated in CSF XEEs for 90 minutes. The beads were re-isolated, washed and incubated with tubulin and GTP for 10 minutes. After fixation, the beads were pelleted onto coverslips and stained with antibodies against α-tubulin. Scale bar = 2.8 µm ( b ) Proteins associated with beads prepared as in (a) were eluted with low pH. Eluted fractions and untreated XEE (input) were analyzed by Western blotting for xNup160 and γ-TuRC components. Uncropped images of the blots are shown in Supplementary Information, Fig. S3 . ( c ) Magnetic beads coated with control IgG, anti-xGCP2 or anti-xNup160 antibodies were incubated for 90 minutes in Control, Ran-T24N, Ran-Q69L or Importin-b-treated CSF XEEs. The beads were re-isolated, washed and incubated with tubulin and GTP for 10 minutes. After fixation, the beads were pelleted onto coverslips and stained with antibodies against α-tubulin. Scale bar = 2.8 µm ( d ) Proteins bound to beads as in (c) were eluted with low pH and analyzed along with untreated XEE (input) by western blotting for GCP2 and Nedd1 (γ-TuRC components). Uncropped images of the blots are shown in Supplementary Information, Fig. S3 . ( e ) To quantitate the extent of MT nucleation, magnetic beads coated with control IgG, anti-xGCP2 or anti-xNup160 antibodies were in incubated in untreated, Ran-T24N-, Ran-Q69L or Importin-β-treated CSF XEEs, as in ( c ). In three independent experiments, we scored clusters containing three to six beads for associated MTs. The graph shows the mean percentage of clusters showing MTs in each case, +/− SD.

    Journal: Nature cell biology

    Article Title: The Nup107-160 complex and ?-TuRC regulate microtubule polymerization at kinetochores

    doi: 10.1038/ncb2016

    Figure Lengend Snippet: Ran-GTP regulates MT nucleation by xNup107-160 / γ-TuRC complexes ( a ) Magnetic beads coated with control IgG, anti-xNup160 or anti-xGCP2 antibodies were incubated in CSF XEEs for 90 minutes. The beads were re-isolated, washed and incubated with tubulin and GTP for 10 minutes. After fixation, the beads were pelleted onto coverslips and stained with antibodies against α-tubulin. Scale bar = 2.8 µm ( b ) Proteins associated with beads prepared as in (a) were eluted with low pH. Eluted fractions and untreated XEE (input) were analyzed by Western blotting for xNup160 and γ-TuRC components. Uncropped images of the blots are shown in Supplementary Information, Fig. S3 . ( c ) Magnetic beads coated with control IgG, anti-xGCP2 or anti-xNup160 antibodies were incubated for 90 minutes in Control, Ran-T24N, Ran-Q69L or Importin-b-treated CSF XEEs. The beads were re-isolated, washed and incubated with tubulin and GTP for 10 minutes. After fixation, the beads were pelleted onto coverslips and stained with antibodies against α-tubulin. Scale bar = 2.8 µm ( d ) Proteins bound to beads as in (c) were eluted with low pH and analyzed along with untreated XEE (input) by western blotting for GCP2 and Nedd1 (γ-TuRC components). Uncropped images of the blots are shown in Supplementary Information, Fig. S3 . ( e ) To quantitate the extent of MT nucleation, magnetic beads coated with control IgG, anti-xGCP2 or anti-xNup160 antibodies were in incubated in untreated, Ran-T24N-, Ran-Q69L or Importin-β-treated CSF XEEs, as in ( c ). In three independent experiments, we scored clusters containing three to six beads for associated MTs. The graph shows the mean percentage of clusters showing MTs in each case, +/− SD.

    Article Snippet: All oligonucleotides were obtained from Qiagen, except GCP2 oligonucleotides were from Invitrogen.

    Techniques: Magnetic Beads, Incubation, Isolation, Staining, Western Blot

    Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each barcode in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.

    Journal: Scientific Reports

    Article Title: Overlap Extension Barcoding for the Next Generation Sequencing and Genotyping of Plasmodium falciparum in Individual Patients in Western Kenya

    doi: 10.1038/srep41108

    Figure Lengend Snippet: Performance of NGS Technology. ( a ) Bioinformatic pipeline for analysis of individual reads acquired from multiplex sequencing on an Ion Torrent 318 chip. ( b ) Number of reads assigned to each barcode in control DNA mixtures. ( c ) Number of reads assigned to each barcode in field-collected parasites. Coverage map across amplicon for pf-csp ( d ), pf-ama1 ( e ), and pf-k13 ( f , g ). False discovery rates at varying minor allele frequencies for reads from each gene target.

    Article Snippet: The final set of primers were designed to amplify the full length library consisting of the barcode oligonucleotides (IonTorrent Adaptor A-Barcode-Linker) and the gene target amplicons (Linker-Amplicon-TrP1) using the products of Step 1A and Step 1B as template.

    Techniques: Next-Generation Sequencing, Multiplex Assay, Sequencing, Chromatin Immunoprecipitation, Amplification

    ( a ) Workflow for preparation of individually identifiable sequence data from dried blood spots. ( b ) PCR Schema to append unique barcode oligonucleotides to multiplexed gene-target amplicons.

    Journal: Scientific Reports

    Article Title: Overlap Extension Barcoding for the Next Generation Sequencing and Genotyping of Plasmodium falciparum in Individual Patients in Western Kenya

    doi: 10.1038/srep41108

    Figure Lengend Snippet: ( a ) Workflow for preparation of individually identifiable sequence data from dried blood spots. ( b ) PCR Schema to append unique barcode oligonucleotides to multiplexed gene-target amplicons.

    Article Snippet: The final set of primers were designed to amplify the full length library consisting of the barcode oligonucleotides (IonTorrent Adaptor A-Barcode-Linker) and the gene target amplicons (Linker-Amplicon-TrP1) using the products of Step 1A and Step 1B as template.

    Techniques: Sequencing, Polymerase Chain Reaction

    Haplotypes present in clinical infection samples. ( a ) Number of unique pf-csp haplotypes contained in field-collected sample DNA by individual, sorted by barcode number. ( b ) Number of individuals bearing each pf-csp haplotype. ( c ) Distribution of pf-csp haplotypes among field-collected sample DNA. Each color indicates a different haplotype. ( d ) MOI values segregated based upon symptomaticity. ( e ) MOI values segregated based upon sampling date.

    Journal: Scientific Reports

    Article Title: Overlap Extension Barcoding for the Next Generation Sequencing and Genotyping of Plasmodium falciparum in Individual Patients in Western Kenya

    doi: 10.1038/srep41108

    Figure Lengend Snippet: Haplotypes present in clinical infection samples. ( a ) Number of unique pf-csp haplotypes contained in field-collected sample DNA by individual, sorted by barcode number. ( b ) Number of individuals bearing each pf-csp haplotype. ( c ) Distribution of pf-csp haplotypes among field-collected sample DNA. Each color indicates a different haplotype. ( d ) MOI values segregated based upon symptomaticity. ( e ) MOI values segregated based upon sampling date.

    Article Snippet: The final set of primers were designed to amplify the full length library consisting of the barcode oligonucleotides (IonTorrent Adaptor A-Barcode-Linker) and the gene target amplicons (Linker-Amplicon-TrP1) using the products of Step 1A and Step 1B as template.

    Techniques: Infection, Sampling