Journal: bioRxiv

Article Title: HIV-1 Infection Regulates Gene Expression by Altering Alternative Polyadenylation Through CPSF6 and CPSF5 Delocalization

doi: 10.1101/2025.08.07.669137

Figure Lengend Snippet: (A) A549 WT, NT#H1, CPSF6-KO#B4, CPSF6-KO#B7, and CPSF6-KO#C8 cells were lysed, and proteins were analyzed by Nu-PAGE, followed by western blot using anti-CPSF6, anti-CPSF5, anti-CPSF7, and anti-GAPDH antibodies. Experiments were repeated at least three times, and a representative image is shown. Graphs show the average densitometry quantification of three replicates with standard deviation. Significance was determined using unpaired t-test; *p<0.05; **p<0.01; ***p<0.001; ns, not significant. (B) Total RNA from CPSF6-KO and WT A549 cells was prepared, and polyadenylated transcripts were identified by PAC-seq, followed by APA analysis using PolyAMiner. (C) A549 WT, NT#H1, CPSF6-KO#B4, CPSF6-KO#B7, and CPSF6-KO#C8 cells were infected with increasing amounts of HIV-1-GFP for 24 or 48 h. Infection was assessed as the percentage of GFP-positive cells by flow cytometry. (D) WT and CPSF6-KO A549 cells were infected with HIV-1-GFP at an MOI of 2 for 48 h. Cells were fixed, permeabilized, and stained using the following antibodies: (i) anti-CPSF5 (red) and anti-CPSF6 (green); (ii) anti-SC-35 (red) and anti-CPSF6 (green); (iii) anti-LEDGF/p75 (red) and anti-CPSF6 (green); and (iv) anti-LEDGF/p75 (red) and anti-SC35 (green). Nuclei were stained with DAPI (blue). Scale bar, 10 µm. (E) Percentage of A549 cells containing CPSF6, CPSF5, or CPSF7 in nuclear speckles (condensates) upon HIV-1 infection (average of three independent experiments with standard deviation). Cells containing CPSF6, CPSF5, or CPSF7 in nuclear speckles were determined by visual examination of 200 cells APA, alternative polyadenylation; CPSF5, cleavage and polyadenylation specificity factor subset 5; CPSF6, cleavage and polyadenylation specificity factor subset 6; CPSF7, cleavage and polyadenylation specificity factor subset 7; DAPI, 4’,6-diamidino-2-phenylindole; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; KO, knockout; LEDGF/p75, lens epithelium-derived growth factor; MOI, multiplicity of infection; NT, non-targeting; PAC-Seq, Poly(A)-Click-Sequencing; UTR, untranslated region; WT, wild-type; hpi, hours post-infection.

Article Snippet: We used mouse monoclonal antibodies targeting the following proteins: SC35 (clone SC-35; Cat# ab11826, Abcam), CPSF5 (clone 3F8;Cat# H00011051-M12, Novus Biologicals), CPSF7 (clone A-9; Cat# sc-393880, Santa Cruz), CPSF6 (clone F-3; Cat# sc-376228, Santa Cruz), ISG15 (clone F-9; Cat# sc-166755, Santa Cruz), and HIV-1 p24 (clone 183-H12-5C; Cat# ARP-3537, NIH AIDS Reagent Program).

Techniques: Western Blot, Standard Deviation, Infection, Flow Cytometry, Staining, Knock-Out, Derivative Assay, Sequencing

Journal: bioRxiv

Article Title: HIV-1 Infection Regulates Gene Expression by Altering Alternative Polyadenylation Through CPSF6 and CPSF5 Delocalization

doi: 10.1101/2025.08.07.669137

Figure Lengend Snippet: (A) CPSF6-KO and control (WT and NT#H1) A549 cells were analyzed by western blot using anti-SLFN5 and anti-CPSF6 antibodies. Anti-GAPDH antibodies were used as a loading control. (B) A549 cells were challenged with HIV-1-GFP or HIV-1-Luc using an MOI of 2 for 48 hours. Subsequently, cells were lysed, and extracts were analyzed by western blot using anti-SLFN5, anti-CPSF6, anti-CPSF5, anti-p24, and anti-GAPDH antibodies. (C) A549 cells were challenged with three different HIV-1-A77V-GFP preparations using an MOI of 2 for 48 hours. Cells were lysed and analyzed by western blot using anti-SLFN5, anti-CPSF5, and anti-p24. GAPDH was used as a loading control. ( A–C ) All experiments were repeated at least three times, and a representative image is shown. Graphs show the average densitometry quantification of at least three replicates with standard deviation. Significance was determined using unpaired t-test; *p<0.05; **p<0.01; ***p<0.001; ns, not significant. CPSF5, cleavage and polyadenylation specificity factor subset 5; CPSF6, cleavage and polyadenylation specificity factor subset 6; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein KO, knockout; Luc, luciferase; MOI, multiplicity of infection; NT, non- targeting; p24, viral capsid; SLFN5, Schlafen family member 5; WT, wild-type.

Article Snippet: We used mouse monoclonal antibodies targeting the following proteins: SC35 (clone SC-35; Cat# ab11826, Abcam), CPSF5 (clone 3F8;Cat# H00011051-M12, Novus Biologicals), CPSF7 (clone A-9; Cat# sc-393880, Santa Cruz), CPSF6 (clone F-3; Cat# sc-376228, Santa Cruz), ISG15 (clone F-9; Cat# sc-166755, Santa Cruz), and HIV-1 p24 (clone 183-H12-5C; Cat# ARP-3537, NIH AIDS Reagent Program).

Techniques: Control, Western Blot, Standard Deviation, Knock-Out, Luciferase, Infection

Journal: Cancer Management and Research

Article Title: Knockdown of NUDT21 inhibits proliferation and promotes apoptosis of human K562 leukemia cells through ERK pathway

doi: 10.2147/CMAR.S173496

Figure Lengend Snippet: Expression levels of NUDT21 in human leukemia. Notes: ( A ) mRNA expression levels of NUDT21 in bone marrow samples from healthy control subjects (HC1–HC15) and CML patients (P1–P15). The mRNA ( B ) expression levels of NUDT21 were evaluated by qRT-PCR in human normal PBMCs, human leukemia cells K562, Jurkat, and hl-60 cells. The protein ( C and D ) expression levels of NUDT21 were evaluated by Western blotting in human normal PBMCs, human leukemia cells K562, Jurkat, and hl-60 cells. GAPDH was used as internal control; the data are the mean ± SD for duplicate experiments. *** P < 0.001. Abbreviations: CML, chronic myelocytic leukemia; HC, healthy control; qRT-PCR, quantitative reverse polymerase chain reaction.

Article Snippet: Specific shRNA plasmid against NUDT21 targeting 5′-ACCTCCTCAGTATCCATAT-3′ and a non-silencing shRNA control plasmid targeting 5′-TTCTCCGAACGT-GTCACGT-3′ were synthesized by Santa Cruz Biotechnology Inc.

Techniques: Expressing, Control, Quantitative RT-PCR, Western Blot, Polymerase Chain Reaction

Journal: Cancer Management and Research

Article Title: Knockdown of NUDT21 inhibits proliferation and promotes apoptosis of human K562 leukemia cells through ERK pathway

doi: 10.2147/CMAR.S173496

Figure Lengend Snippet: Knockdown of NUDT21 in leukemia cells. Notes: Western blotting ( A and B ) and qPCR ( C ) were used to confirm the knockdown effects of shRNAs against NUDT21 in K562, Jurkat and HL-60 cells. The data are the mean ± SD for duplicate experiments; *** P <0.001. Abbreviation: qRT-PCR, quantitative reverse polymerase chain reaction.

Article Snippet: Specific shRNA plasmid against NUDT21 targeting 5′-ACCTCCTCAGTATCCATAT-3′ and a non-silencing shRNA control plasmid targeting 5′-TTCTCCGAACGT-GTCACGT-3′ were synthesized by Santa Cruz Biotechnology Inc.

Techniques: Knockdown, Western Blot, Quantitative RT-PCR, Polymerase Chain Reaction

Journal: Cancer Management and Research

Article Title: Knockdown of NUDT21 inhibits proliferation and promotes apoptosis of human K562 leukemia cells through ERK pathway

doi: 10.2147/CMAR.S173496

Figure Lengend Snippet: K562 cell growth upon knockdown of NUDT21. Notes: ( A ) Proliferation capabilities were detected by CCK-8 in K562, Jurkat, and HL-60 cells (2×10 3 ) for 5 days after transfection of shRNA control or NUDT21 shRNA. ( B ) K562 cells were transfected with shRNA control or NUDT21 shRNA for 48 hours and re-seeded in 96-well plate for BrdU assays. ( C ) Cell cycle phase distributions were detected by flow cytometry in K562 cells after transfection of shRNA control or NUDT21 shRNA. ( D ) Western blotting analysis of the protein expressions of PCNA and cyclin E after transfection of shRNA control or NUDT21 shRNA. The data are expressed as mean ± SD for duplicate experiments. * P <0.05; ** P <0.01; *** P <0.001. Abbreviations: CCK-8, Cell Counting Kit-8; BrdU, bromodeoxyuridine.

Article Snippet: Specific shRNA plasmid against NUDT21 targeting 5′-ACCTCCTCAGTATCCATAT-3′ and a non-silencing shRNA control plasmid targeting 5′-TTCTCCGAACGT-GTCACGT-3′ were synthesized by Santa Cruz Biotechnology Inc.

Techniques: Knockdown, CCK-8 Assay, Transfection, shRNA, Control, Flow Cytometry, Western Blot, Cell Counting

Journal: Cancer Management and Research

Article Title: Knockdown of NUDT21 inhibits proliferation and promotes apoptosis of human K562 leukemia cells through ERK pathway

doi: 10.2147/CMAR.S173496

Figure Lengend Snippet: K562 cell apoptosis upon knockdown of NUDT21. Notes: ( A ) The activities of Caspase3/7 were determined by Caspase-Glo 3/7 assays in K562 cells (1.5×10 4 ) after transfection of shRNA control or NUDT21 shRNA. ( B ) The percentage of annexin V-positive revealed apoptosis. Percentages of cells undergoing apoptosis in different groups are shown. ( C and D ) Bax and Bcl-2 protein were determined by Western blot analysis in K562 cells after transfection of shRNA control or NUDT21 shRNA. Data are expressed as mean ± SD for duplicate experiments. ** P <0.01; *** P <0.001. Abbreviation: PI, propidium iodide.

Article Snippet: Specific shRNA plasmid against NUDT21 targeting 5′-ACCTCCTCAGTATCCATAT-3′ and a non-silencing shRNA control plasmid targeting 5′-TTCTCCGAACGT-GTCACGT-3′ were synthesized by Santa Cruz Biotechnology Inc.

Techniques: Knockdown, Transfection, shRNA, Control, Western Blot

Journal: Cancer Management and Research

Article Title: Knockdown of NUDT21 inhibits proliferation and promotes apoptosis of human K562 leukemia cells through ERK pathway

doi: 10.2147/CMAR.S173496

Figure Lengend Snippet: Deregulation of signaling pathways upon knockdown of NUDT21. Notes: ( A ) Heatmap of 697 differentially expressed genes after knockdown of NUDT21 in K562 cells. ( B ) Enrichment analysis of differentially expressed genes in GO terms. ( C ) Enrichment analysis of differentially expressed genes in KEGG pathways. ( D ) The histogram showing the relative protein expressions of the key signaling components in K562 cells after transfection of shRNA control or NUDT21 shRNA. Data are expressed as mean ± SD for duplicate experiments. Abbreviations: GO, gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomics.

Article Snippet: Specific shRNA plasmid against NUDT21 targeting 5′-ACCTCCTCAGTATCCATAT-3′ and a non-silencing shRNA control plasmid targeting 5′-TTCTCCGAACGT-GTCACGT-3′ were synthesized by Santa Cruz Biotechnology Inc.

Techniques: Protein-Protein interactions, Knockdown, Transfection, shRNA, Control

Journal: Cancer Management and Research

Article Title: Knockdown of NUDT21 inhibits proliferation and promotes apoptosis of human K562 leukemia cells through ERK pathway

doi: 10.2147/CMAR.S173496

Figure Lengend Snippet: Potential mechanisms underlying the effects of NUDT21 on K562 cell growth. Notes: ( A ) The protein levels of p-ERK1/2 and PTEN were shown in K562 cells transfected with shRNA control or NUDT21 shRNA using Western blot analysis. ( B ) The mRNA levels of PTEN were compared between K562 cells of shRNA control group and NUDT21 shRNA group using qRT-PCR analysis. ( C ) BrdU incorporation in K562 cells treated with honokiol or control. ( D ) Percentages of cells undergoing apoptosis (annexin V-positive) in different groups were shown. Data are expressed as mean ± SD for duplicate experiments. * P <0.05; ** P <0.01; *** P <0.001. Abbreviations: BrdU, bromodeoxyuridine; PI, propidium iodide; PTEN, phosphatase and tensin homolog deleted on chromosome 10; qRT-PCR, quantitative reverse polymerase chain reaction.

Article Snippet: Specific shRNA plasmid against NUDT21 targeting 5′-ACCTCCTCAGTATCCATAT-3′ and a non-silencing shRNA control plasmid targeting 5′-TTCTCCGAACGT-GTCACGT-3′ were synthesized by Santa Cruz Biotechnology Inc.

Techniques: Transfection, shRNA, Control, Western Blot, Quantitative RT-PCR, BrdU Incorporation Assay, Polymerase Chain Reaction

Journal: Scientific reports

Article Title: Formation of nuclear CPSF6/CPSF5 biomolecular condensates upon HIV-1 entry into the nucleus is important for productive infection.

doi: 10.1038/s41598-023-37364-x

Figure Lengend Snippet: Figure 6. HIV-1 infection induces the formation of CPSF5 condensates that colocalize with CPSF6. A549 cells were infected or not (mock) with HIV-1-Luc at an MOI of ~ 2 for 24 h (A and B). Cells were fixed, permeabilized, and coimmunostained using rabbit polyclonal antibody to CPSF6 with mouse monoclonal antibody against CPSF5 (A) or with mouse monoclonal antibody against CPSF7 (B). Secondary antibodies were Alexa-488-conjugated donkey anti-mouse IgG (green channel) and Alexa-594-conjugated donkey anti-rabbit IgG (red channel). Stained cells were examined by fluorescence microscopy. Merging the red and green channels generated the third image in each row; yellow indicates overlapping localization of the red and green channels. Experiments were repeated at least three times, and a representative experiment is shown. Scale bar = 10 μm.

Article Snippet: We used the following mouse monoclonal antibodies: clone SC-35 against SC35 (Cat# ab11826, Abcam), clone 3F8 against CPSF5 (Cat# H00011051-M12, Novus Biologicals), clone A-9 against CPSF7 (Cat# sc-393880, Santa Cruz) and clone F3 against CPSF6 (Cat# sc-376228, Santa Cruz).

Techniques: Infection, Staining, Fluorescence, Microscopy, Generated

Journal: Scientific reports

Article Title: Formation of nuclear CPSF6/CPSF5 biomolecular condensates upon HIV-1 entry into the nucleus is important for productive infection.

doi: 10.1038/s41598-023-37364-x

Figure Lengend Snippet: Figure 7. HIV-1 infection induces the formation of CPSF6 and CPSF5 condensates in human T cells and human primary macrophages. Jurkat T cells (A) and macrophages (B) were infected or not (mock) with HIV- 1-GFP at an MOI of ~ 2 for 48 or 72 h, respectively. At 48hpi, 2,5 × 105 Jurkat cells were seeded on glass coverslips previously treated with poly-D-lysine for 1 h. Cells were fixed, permeabilized, and immunostained using rabbit polyclonal antibody to CPSF6, mouse monoclonal antibody against CPSF5 or mouse monoclonal antibody against CPSF7. Secondary antibody was Alexa-594-conjugated donkey anti-rabbit IgG (red channel). Nuclei were stained with DAPI (blue channel). Stained cells were examined by fluorescence microscopy. Merging the red and blue channels generated the third image in each row; magenta indicates overlapping of the red and blue channels. Experiments were repeated at least three times, and a representative experiment is shown. Scale bar = 10 μm.

Article Snippet: We used the following mouse monoclonal antibodies: clone SC-35 against SC35 (Cat# ab11826, Abcam), clone 3F8 against CPSF5 (Cat# H00011051-M12, Novus Biologicals), clone A-9 against CPSF7 (Cat# sc-393880, Santa Cruz) and clone F3 against CPSF6 (Cat# sc-376228, Santa Cruz).

Techniques: Infection, Staining, Fluorescence, Microscopy, Generated

Journal: Scientific reports

Article Title: Formation of nuclear CPSF6/CPSF5 biomolecular condensates upon HIV-1 entry into the nucleus is important for productive infection.

doi: 10.1038/s41598-023-37364-x

Figure Lengend Snippet: Figure 8. HIV-1 infection induces nuclear redistribution of LEDGF/p75. A549 cells were infected or not (mock) with wild-type HIV-1-Luc (A–D) or with HIV-1-GFP viruses bearing the capsid mutations N74D and A77V (E) at an MOI of ~ 2 for 24 h. Cells were fixed, permeabilized, and stained using rabbit polyclonal antibody to LEDGF/p75 (E) with mouse monoclonal antibody to CPSF6 (A and C) or with mouse monoclonal antibody to CPSF5 (B and D). Secondary antibodies were Alexa-488-conjugated donkey anti-mouse IgG (green channel) and Alexa-594-conjugated donkey anti-rabbit IgG (red channel). Nuclei were stained with DAPI (channel blue). Stained cells were examined by fluorescence microscopy. Merging the red and green channels generated the yellow color that indicates overlapping localization of these channels. Merging the red and blue channels generated the magenta color that indicates overlapping localization of these channels. For C and D z-stack images at 0.2 μm intervals were acquired. The white circle indicates an example of a condensate that contains CPSF6 (C) or CPSF5 (D) surrounded by LEDGF/p75. Scale bar = 10 μm.

Article Snippet: We used the following mouse monoclonal antibodies: clone SC-35 against SC35 (Cat# ab11826, Abcam), clone 3F8 against CPSF5 (Cat# H00011051-M12, Novus Biologicals), clone A-9 against CPSF7 (Cat# sc-393880, Santa Cruz) and clone F3 against CPSF6 (Cat# sc-376228, Santa Cruz).

Techniques: Infection, Staining, Fluorescence, Microscopy, Generated

Journal: Biology of reproduction

Article Title: Pre-messenger RNA cleavage factor I (CFIm): potential role in alternative polyadenylation during spermatogenesis.

doi: 10.1095/biolreprod.107.064774

Figure Lengend Snippet: FIG. 1. A novel Nudt21 RNA is highly enriched in mouse testis and male germ cells. A) Schematic of male germ cell and somatic Nudt21 transcripts for mouse, showing that structural differences occur in their respective 30UTRs. DNA products generated by RT-PCR (A, B, C, E) and 3’RACE (D) from mouse testis or kidney total RNA are shown below the transcripts. Arrows indicate the position of the exon 1/intron 1 junction and translation initiation sites. B) Northern blot of total RNA isolated from mouse tissues and enriched adult male germ cells using RT-PCR product A as a probe (see A). Lanes: mouse testis (T), enriched adult male germ cells (gc), kidney (K), liver (L), brain (B), and heart (H). Ethidium bromide staining of RNA loading is shown below each lane. C) Northern analysis of mouse testis and kidney total RNA using a probe specific to Nudt21 exon 1 (product B, see A). Ethidium bromide staining of ribosomal RNAs is shown below. D) Hybridization of total RNA from mouse tissues with RT-PCR product E specific to the 30UTR of mouse somatic Nudt21 mRNA (see A). The blot used in the right panel of B was reprobed for somatic-specific 30UTR sequences and detected a ;4.5-kb mRNA in brain and other tissues, but not the 1.1-kb testis-enriched transcript.

Article Snippet: After blocking with 1% nonfat milk for 1 h at room temperature, the blots were incubated with antibody raised against NUDT21/ CPSF5 (1:1000; #BC001403; ProteinTech Group, Chicago, IL) or CPSF6 (1:1000; Abnova, Taipei City, Taiwan) overnight at 48C.

Techniques: Generated, Reverse Transcription Polymerase Chain Reaction, Northern Blot, Isolation, Staining, Hybridization

Journal: Biology of reproduction

Article Title: Pre-messenger RNA cleavage factor I (CFIm): potential role in alternative polyadenylation during spermatogenesis.

doi: 10.1095/biolreprod.107.064774

Figure Lengend Snippet: FIG. 2. Nucleotide and coding sequences for mouse testis Nudt21. A) Composite cDNA sequence for mouse testis Nudt21. Primers used to amplify various RT-PCR and 3’RACE products are underlined. The translational initiation and stop codons (bold) as well as putative canonical and noncanonical polyadenylation signals (dashed boxes) and upstream CFIm binding sites (solid line boxes) in the 30UTR are indicated. B) Predicted coding sequences for NUDT21 from mouse testis and somatic human NUDT21 isoforms (hNUDT21–1, 2). See text for GenBank Accession numbers. Asterisks indicate identity with the predicted mouse testis amino acid sequence, while residues absent in the human splice variant hNUDT21–2 are shown with dashes.

Article Snippet: After blocking with 1% nonfat milk for 1 h at room temperature, the blots were incubated with antibody raised against NUDT21/ CPSF5 (1:1000; #BC001403; ProteinTech Group, Chicago, IL) or CPSF6 (1:1000; Abnova, Taipei City, Taiwan) overnight at 48C.

Techniques: Sequencing, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Variant Assay

Journal: Biology of reproduction

Article Title: Pre-messenger RNA cleavage factor I (CFIm): potential role in alternative polyadenylation during spermatogenesis.

doi: 10.1095/biolreprod.107.064774

Figure Lengend Snippet: FIG. 6. Distinct developmental variation of CFIm subunit mRNAs and proteins during male germ cell development. A) Total RNA from purified type A spermatogonia (lane A), type B spermatogonia (lane B), prepubertal pachytene spermatocytes (lane PP), pachytene spermatocytes (lane PS), round spermatids (lane RS), and residual bodies (RB) were hybridized with Nudt21 probe A and Cpsf6 probe F. The same blot was probed in each case. Ethidium bromide staining of RNA loading is shown below. B) NUDT21 and CPSF6 protein concentrations are similar in mitotic, meiotic, and spermiogenic germ cell populations. B, B type spermatogo- nia; PS, pachytene spermatocytes; RS, round spermatids; gc, enriched adult mouse male germ cells.

Article Snippet: After blocking with 1% nonfat milk for 1 h at room temperature, the blots were incubated with antibody raised against NUDT21/ CPSF5 (1:1000; #BC001403; ProteinTech Group, Chicago, IL) or CPSF6 (1:1000; Abnova, Taipei City, Taiwan) overnight at 48C.

Techniques: Purification, Staining

Journal: Biology of reproduction

Article Title: Pre-messenger RNA cleavage factor I (CFIm): potential role in alternative polyadenylation during spermatogenesis.

doi: 10.1095/biolreprod.107.064774

Figure Lengend Snippet: FIG. 5. CFIm subunit proteins are elevated in mouse testis and male germ cells. A) Western analysis of NUDT21 (left panel) and CPSF6 (right panel) proteins in whole testis (T) and kidney (K). Equivalency of protein loading was confirmed by Ponceau-S staining (not shown). B) NUDT21 (left) and CPSF6 (right) proteins in nuclear extracts of enriched adult mouse spermatogenic cells (gc).

Article Snippet: After blocking with 1% nonfat milk for 1 h at room temperature, the blots were incubated with antibody raised against NUDT21/ CPSF5 (1:1000; #BC001403; ProteinTech Group, Chicago, IL) or CPSF6 (1:1000; Abnova, Taipei City, Taiwan) overnight at 48C.

Techniques: Western Blot, Staining

Journal: Biology of reproduction

Article Title: Pre-messenger RNA cleavage factor I (CFIm): potential role in alternative polyadenylation during spermatogenesis.

doi: 10.1095/biolreprod.107.064774

Figure Lengend Snippet: FIG. 8. CFIm transcripts are enriched in human testis. Northern blots of total RNA from different human tissues were probed for Nudt21 (upper panel; probe A) and Cpsf6 (lower panel; probe F) mRNAs. Ethidium bromide staining is shown below for each blot. Lanes: human liver (L), pancreas (P), heart (H), lung (Lu), muscle (M), kidney (K), spleen (S), testis (T), and small intestine (SI).

Article Snippet: After blocking with 1% nonfat milk for 1 h at room temperature, the blots were incubated with antibody raised against NUDT21/ CPSF5 (1:1000; #BC001403; ProteinTech Group, Chicago, IL) or CPSF6 (1:1000; Abnova, Taipei City, Taiwan) overnight at 48C.

Techniques: Northern Blot, Staining

Journal: Biology of reproduction

Article Title: Pre-messenger RNA cleavage factor I (CFIm): potential role in alternative polyadenylation during spermatogenesis.

doi: 10.1095/biolreprod.107.064774

Figure Lengend Snippet: FIG. 9. ChIP analysis of NUDT21 in adult mouse germ cells and kidney. Formalde- hyde-cross-linked chromatin was precipi- tated with antibodies to NUDT21 (Anti- NUDT21) or using beads alone without primary antibody (No Ab Ctl). A) Following reversal of crosslinks, DNA precipitated from adult male germ cells was assayed for mouse Srebf2, Nr6a1, and Gabra6 genomic sequences by PCR. Specific bands generat- ed by the respective PCR reactions are shown in each case. Aliquots of input DNA (Input) were assayed as positive controls. B) NUDT21 ChIP analysis of proximal (Srebf2_v1) and distal (Srebf2) 30UTRs for the mouse Srebf2 gene in mouse sper- matogenic cell (Germ cells) and kidney chromatin.

Article Snippet: After blocking with 1% nonfat milk for 1 h at room temperature, the blots were incubated with antibody raised against NUDT21/ CPSF5 (1:1000; #BC001403; ProteinTech Group, Chicago, IL) or CPSF6 (1:1000; Abnova, Taipei City, Taiwan) overnight at 48C.

Techniques: Genomic Sequencing

Journal: Molecular and Cellular Biology

Article Title: ARS2 Regulates Nuclear Paraspeckle Formation through 3′-End Processing and Stability of NEAT1 Long Noncoding RNA

doi: 10.1128/MCB.00269-19

Figure Lengend Snippet: Antibodies used in this study

Article Snippet: The antibodies used in this study are shown in . table ft1 table-wrap mode="anchored" t5 TABLE 3 caption a7 Antigen Type Source or reference ARS2 Rabbit Bethyl, Montgomery, TX CPSF6 Rabbit Bethyl, Montgomery, TX NUDT21 Rabbit Proteintech, Rosemont, IL FLAG Mouse Sigma-Aldrich, St. Louis, MO GAPDH Rabbit Abcam, Cambridge, UK α-Tubulin Rabbit Abcam, Cambridge, UK ZC3H18 Rabbit Sigma-Aldrich, St. Louis, MO DIG Mouse Abcam, Cambridge, UK SFPQ Mouse MBL, Aichi, Japan PHAX Mouse 21 CBP80 Mouse 21 Open in a separate window Antibodies used in this study

Techniques:

Journal: The EMBO Journal

Article Title: Prevention of dsRNA‐induced interferon signaling by AGO1x is linked to breast cancer cell proliferation

doi: 10.15252/embj.2019103922

Figure Lengend Snippet: Plasmids and oligonucleotides used in this study

Article Snippet: NUDT21 Rev , CCTGACGACCCAGTATCTCTG , Microsynth.

Techniques: Sequencing, Modification, Clone Assay, Expressing, Plasmid Preparation