Journal: PLoS Pathogens

Article Title: A protease-activatable luminescent biosensor and reporter cell line for authentic SARS-CoV-2 infection

doi: 10.1371/journal.ppat.1010265

Figure Lengend Snippet: ( A-B ) HEK293T-ACE2 cells were transfected with indicated FlipGFP biosensors, incubated for 12 h, then infected with SARS-CoV-2 at MOI = 1. Cells were fixed, permeabilised and stained for SARS-CoV-2 spike protein 24 h post-infection. FlipGFP and mCherry fluorescence in spike+ syncytia vs. spike- cells were analysed by confocal microscopy. Illustrative microscopy data from spike+ syncytia ( A ) and mean values ± SEM for at least 15 syncytia/cells from each condition ( B ) are shown, representative of 2 independent experiments. **** p<0.0001. mCherry, red. FlipGFP, green. Spike, yellow. DAPI, blue. DIC, differential interference contrast. ( C ) Expression levels of SARS-CoV-2 proteases. HEK293T-ACE2 cells were mock-infected, infected with SARS-CoV-2 at MOI = 1 or transfected with MPro (left panel) or PLPro (right panel) under standard conditions. Cells were lysed after 24 h and analysed by immunoblot using antibodies specific for nsp5 (MPro), the PLPro c.d. of nsp3 or nucleocapsid. β-actin was included as a loading control. Arrows indicate presumed full-length nsp3 (215 kDa) and intermediate cleavage products present in SARS-CoV-2-infected cells. Asterisk indicates recombinant PLPro c.d.. Representative of 2 independent experiments. O.E., over-expression. MPro, recombinant SARS-CoV-2 Main Protease. PLPro c.d., catalytic domain of recombinant SARS-CoV-2 Papain-Like Protease.

Article Snippet: To generate an expression vector for SARS-CoV-2 Main protease (MPro), the open reading frame was amplified by PCR from the pDONR223 SARS-CoV-2 NSP5 plasmid (Addgene, #141259, a gift from Fritz Roth [ ]), including an ATG start codon in the forward primer and a TAA stop codon in the reverse primer (MPro_Fw: GCTTGGTACCGAGCTCGCACATGT CCGGATTCCGCAAGATG; MPro_Rv: GTGATGGATATCTGCAGTTACTGGAAGGTCACAC CAGAGC), then assembled (as above) with EcoRI-linearised pcDNA3.1.

Techniques: Transfection, Incubation, Infection, Staining, Fluorescence, Confocal Microscopy, Microscopy, Expressing, Western Blot, Control, Recombinant, Over Expression

Journal: Cell cycle (Georgetown, Tex.)

Article Title: Possible functional role of NSPs in cancer.

doi: 10.4161/cc.7.12.6023

Figure Lengend Snippet: Figure 2. RT-PCR expression profile of NSP isoforms in-vitro. (A) NSP 5a3a. (B) NSP 5a3b. (C) NSP 5b3a. (D) NSP 5b3b. (E) B-actin control. Samples are as follows: (1) HT-29., (2) MANCA., (3) Hela., (4) Daudi., (5) Saos-2., (6) Ml-1., (7) CEM., (8) Caov-3., (9) H23., (10) HN30., (11) T98G., (12) MCF-7., (13) Hep3b., (14) HN12.

Article Snippet: Cells were pre-blocked for 1 hour at RT with 8% BSA then cells incubated with rabbit polyclonal anti-NSP 5a3a (Novus) at 1/500 dilution or rabbit polyclonal anti-3b (Rockland) at 1/400 dilution in 1% BSA overnight at 4°C.

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, In Vitro, Control

Journal: Cell cycle (Georgetown, Tex.)

Article Title: Possible functional role of NSPs in cancer.

doi: 10.4161/cc.7.12.6023

Figure Lengend Snippet: Figure 4. Subcellular localization of NSP 5a3a and NSP 5a3b by Immuno Blot analysis of cellular fractionation. (A) Western Blot analysis of cytoplas- mic fractions of asynchronizied Hela cells for NSP 5a3a, NSP 5a3b and cytoplasmic marker alpha-tubulin. (B) Western Blot analysis of nuclear frac- tions of asynchronizied Hela cells for NSP 5a3a, NSP 5a3b, and nuclear marker Lamin A/C.

Article Snippet: Cells were pre-blocked for 1 hour at RT with 8% BSA then cells incubated with rabbit polyclonal anti-NSP 5a3a (Novus) at 1/500 dilution or rabbit polyclonal anti-3b (Rockland) at 1/400 dilution in 1% BSA overnight at 4°C.

Techniques: Cell Fractionation, Western Blot, Marker

Journal: Cell cycle (Georgetown, Tex.)

Article Title: Possible functional role of NSPs in cancer.

doi: 10.4161/cc.7.12.6023

Figure Lengend Snippet: Figure 3. Subcellular localization of NSP 5a3a and NSP 5a3b by immu- nostaining. Hela cells were stained with rabbit anti-NSP5a3a then with anti- rabbit FITC secondary or Hela cells were stained with rabbit anti-3b then with anti-rabbit TRITC secondary. Controls consisted of Hela cells stained with DAPI only, with anti-rabbit TRITC secondary only, with anti-rabbit FITC secondary only and Blank image.

Article Snippet: Cells were pre-blocked for 1 hour at RT with 8% BSA then cells incubated with rabbit polyclonal anti-NSP 5a3a (Novus) at 1/500 dilution or rabbit polyclonal anti-3b (Rockland) at 1/400 dilution in 1% BSA overnight at 4°C.

Techniques: Staining

Journal: Cell cycle (Georgetown, Tex.)

Article Title: Possible functional role of NSPs in cancer.

doi: 10.4161/cc.7.12.6023

Figure Lengend Snippet: Figure 5. Cell cycle distribution of NSP 5a3a and NSP 5a3b with respect to B23 in Hela cells. (A) Hela cells stained with rabbit anti-NSP5a3a and mouse anti-B23 then with secondary anti-rabbit FITC and seconday anti-mouse PacBlue. (B) Hela cells stained with rabbit anti-3b and mouse anti-B23 then with secondary anti-rabbit FITC and secondary anti-mouse PacBlue.

Article Snippet: Cells were pre-blocked for 1 hour at RT with 8% BSA then cells incubated with rabbit polyclonal anti-NSP 5a3a (Novus) at 1/500 dilution or rabbit polyclonal anti-3b (Rockland) at 1/400 dilution in 1% BSA overnight at 4°C.

Techniques: Staining

Journal: Cell cycle (Georgetown, Tex.)

Article Title: Possible functional role of NSPs in cancer.

doi: 10.4161/cc.7.12.6023

Figure Lengend Snippet: Figure 5. Cell cycle distribution of NSP 5a3a and NSP 5a3b with respect to B23 in Hela cells. (C) Hela cells stained only with secondary anti-mouse FITC. (D) Hela cells stained only with secondary anti-rabbit Pacblue. (E) Hela cells stained only with PI.

Article Snippet: Cells were pre-blocked for 1 hour at RT with 8% BSA then cells incubated with rabbit polyclonal anti-NSP 5a3a (Novus) at 1/500 dilution or rabbit polyclonal anti-3b (Rockland) at 1/400 dilution in 1% BSA overnight at 4°C.

Techniques: Staining

Journal: Cell cycle (Georgetown, Tex.)

Article Title: Possible functional role of NSPs in cancer.

doi: 10.4161/cc.7.12.6023

Figure Lengend Snippet: Figure 8. Co-immunoprecipitation of NSP 5a3a and 5a3b with B23. (A) Hela total lysates incubated with anti-mouse sepharose beads and mouse anti-B23 then western blot done with rabbit anti-3b. (B) Hela total lysates incubated with anti-mouse sepharose beads and mouse anti-B23 then western blot done with rabbit with rabbit anti-NSP 5a3a. (C) Hela total lysates incubated with Protein A sepharose beads and either rabbit anti-3b or rabbit anti-NSP 5a3a then western blot done with mouse anti-B23.

Article Snippet: Cells were pre-blocked for 1 hour at RT with 8% BSA then cells incubated with rabbit polyclonal anti-NSP 5a3a (Novus) at 1/500 dilution or rabbit polyclonal anti-3b (Rockland) at 1/400 dilution in 1% BSA overnight at 4°C.

Techniques: Immunoprecipitation, Incubation, Western Blot

Journal: Cell cycle (Georgetown, Tex.)

Article Title: Possible functional role of NSPs in cancer.

doi: 10.4161/cc.7.12.6023

Figure Lengend Snippet: Figure 9. Co-localization of NSP 5a3a and 5a3b with B23 in Hela cells in-vitro. (A) Hela cells were double-stained with rabbit anti-NSP5a3a and mouse anti-B23 then with secondary anti-rabbit TRITC and anti-mouse FITC respectively. (B) Hela cells were double-stained with rabbit anti-3b and mouse anti-B23 then with secondary anti-rabbit TRITC and anti-mouse FITC respectively.

Article Snippet: Cells were pre-blocked for 1 hour at RT with 8% BSA then cells incubated with rabbit polyclonal anti-NSP 5a3a (Novus) at 1/500 dilution or rabbit polyclonal anti-3b (Rockland) at 1/400 dilution in 1% BSA overnight at 4°C.

Techniques: In Vitro, Staining

Journal: Cell cycle (Georgetown, Tex.)

Article Title: Possible functional role of NSPs in cancer.

doi: 10.4161/cc.7.12.6023

Figure Lengend Snippet: Figure 9. Co-localization of NSP 5a3a and 5a3b with B23 in Hela cells in-vitro. (C) Controls for immunoflourescence staining.

Article Snippet: Cells were pre-blocked for 1 hour at RT with 8% BSA then cells incubated with rabbit polyclonal anti-NSP 5a3a (Novus) at 1/500 dilution or rabbit polyclonal anti-3b (Rockland) at 1/400 dilution in 1% BSA overnight at 4°C.

Techniques: In Vitro, Staining

Journal: Cells

Article Title: A Gain-of-Function Cleavage of TonEBP by Coronavirus NSP5 to Suppress IFN-β Expression.

doi: 10.3390/cells13191614

Figure Lengend Snippet: Figure 1. TonEBP is cleaved by human coronavirus NSP5. (A) HEK293T cells were transfected with a TonE-driven Photinus luciferase plasmid. pRL-TK plasmid driving the expression of Renilla luciferase was co-transfected to normalize transfection efficiency. After 16 h, the cells were infected

Article Snippet: The plasmid encoding His-SARS-CoV-2 NSP5 was obtained from Addgene (m4133256).

Techniques: Transfection, Luciferase, Plasmid Preparation, Expressing, Infection

Journal: Cells

Article Title: A Gain-of-Function Cleavage of TonEBP by Coronavirus NSP5 to Suppress IFN-β Expression.

doi: 10.3390/cells13191614

Figure Lengend Snippet: Figure 2. SARS-CoV-2 NSP5 targets Q1127 of TonEBP. (A) HEK293T cells were co-transfected with the plasmid expressing either GFP-TonEBP (see above) or TonEBP-GFP (GFP is conjugated to the C- terminus of TonEBP) along with the empty vector or His-tagged SARS-CoV-2 NSP5-expressing vector, as indicated. At 48 h later, the cells were fixed and stained with DAPI. Fluorescence images for GFP, DAPI, and the two merged are shown. Scale bar: 100 µm. GFP fluorescence intensity was quantified as the mean ± SEM, n = 3 (bottom). (B) Cells were transfected for 24 h with constructs as in (A). The cells were then treated for 6 h with vehicle (DMSO) or 10 µM MG132 before immunoblotting. Full- length GFP-TonEBP and cleaved GFP-TonEBP are marked by solid and open arrowhead, respectively. Relative intensity of the cleaved GFP-TonEBP (open arrowhead) was quantified as the mean ± SEM, n = 3 (bottom). (C) Schematic of TonEBP primary sequence with putative cleavage sites marked with Qs predicted using NetCorona1.0 (with a score higher than 0.35). RHD, Rel-homology domain; TAD, transcription activation domain. (D) Cells were transfected with various combinations of plasmids expressing GFP-TonEBP (TonEBP), GFP-TonEBP with Q1127A mutation (Q1127A), and NSP5, as indicated, before immunoblotting. ns p > 0.05, and *** p < 0.001 using t-tests (A,B).

Article Snippet: The plasmid encoding His-SARS-CoV-2 NSP5 was obtained from Addgene (m4133256).

Techniques: Transfection, Plasmid Preparation, Expressing, Staining, Fluorescence, Construct, Western Blot, Sequencing, Activation Assay, Mutagenesis

Journal: Cells

Article Title: A Gain-of-Function Cleavage of TonEBP by Coronavirus NSP5 to Suppress IFN-β Expression.

doi: 10.3390/cells13191614

Figure Lengend Snippet: Figure 5. Cleavage of TonEBP promotes binding to the PRD II domain of the IFN-β promoter. (A) HEK293T cells were co-transfected for 16 h with a plasmid expressing GFP-IRF3 without or with the plasmid expressing Flag-TonEBP NT. Cell lysates (Input) were immunoprecipitated (IP) with anti- Flag antibody. (B) Cells were transfected and analyzed as in (A) except that YPF-p65 was expressed instead of GFP-IRF3. (C) HEK293T cells were co-transfected for 24 h with various combinations of two plasmids expressing Flag-TonEBP NT and MAVS, as indicated. Chromatin immunoprecipitation was performed using normal rabbit IgG or anti-TonEBP antibody. The IFN-β promoter region indicated was quantified using qPCR. Mean ± SEM, n = 3. (D) Cells were co-transfected for 24 h with various combinations of three plasmids expressing Flag-TonEBP, Flag-TonEBP Q1127A and SARS-CoV-2 NSP5, as indicated. Chromatin immunoprecipitation was performed as in (C). (E) Schematic of TonEBP NT (1–1127) and TonEBP sNT (1–548). (F) Cells were transfected for 24 h with the IFN- β promoter luciferase reporter plasmid and pRL-TK plus one of the combinations of plasmids expressing p65, TonEBP NT, and TonEBP sNT (1–548), as indicated. Luciferases were measured to assess the activity of IFN-β promoter. (G) Nucleotide sequence of a portion of the human IFN-β promoter for binding of IRF3 and NF-κB (p65). Sequences of three probes are shown below. PRDIII, PRDI, and PRDII regions are marked by yellow, green, and orange colors, respectively. (H,I) The probes shown above were biotinylated and individually immobilized on streptavidin sensor chips for surface plasmon resonance assay. Various concentrations of p65 (H) or TonEBP sNT (1–548) (I) recombinant proteins were injected over the sensor surface. Binding affinity was determined by plotting the maximum response unit versus the concentration of injected proteins using GraphPad Prism 9.0. The values of KD are shown. (J) 100 nM each of Cy5.5-labeled IFN-β promoter probes were individually incubated without or with 500 nM TonEBP sNT (1–548) and resolved in an agarose gel. (K) Combinations of 0, 100, 200, or 500 nM TonEBP sNT (1–548) and p65 recombinant proteins (0 or 100 nM), as indicated, were each incubated for 25 min with 100 nM of Cy5.5-labeled IRF3/p65 probe and resolved in an agarose gel. The solid arrowhead denotes the complex of TonEBP sNT (1–548) with the probe and the open arrowhead denotes the complex of p65 with the probe. (L) A model for the IFN-β induction and its inhibition by TonEBP NT by replacing DNA bound p65. Data are shown as the mean ± SEM, n = 3; ns p > 0.05, and *** p < 0.001 using t-tests (C,D,F).

Article Snippet: The plasmid encoding His-SARS-CoV-2 NSP5 was obtained from Addgene (m4133256).

Techniques: Binding Assay, Transfection, Plasmid Preparation, Expressing, Immunoprecipitation, Chromatin Immunoprecipitation, Luciferase, Activity Assay, Sequencing, SPR Assay, Recombinant, Injection, Concentration Assay, Labeling, Incubation, Agarose Gel Electrophoresis, Inhibition