nif Search Results


95
Proteintech s100a8
Confocal microscopy (lung, liver, spleen, brain) of PKH67-labeled Panc02 EXO and Panc02-H7 EXO tissue distribution (green) 24 hpi. (A) PKH-67-labeled liposomes served as controls (scale bar=100 μm). Histogram shows exosome tissue distribution quantification (n=5/group). CD45, p-Stat3, and CD11b IF staining in liver sections from controls (left) and mice treated with Panc02 EXOs(middle) or Panc02-H7 EXOs (right) for 12 d without tumor challenge. (B) Histogram shows infiltrating CD45 + cell quantification. FN and α-SMA IF staining in liver sections from controls (top) and mice treated with Panc02 EXOs(middle) or Panc02-H7 EXOs (bottom) for 12 d without tumor challenge. (C) Histogram shows infiltrating α-SMA + hStCs and FN expression quantification(400× magnification; n=5/group). Western blotting analysis showed upregulated <t>S100A8</t> and S100A9 in livers treated with Panc02-H7-derived exosomes. Histogram shows expression of the three proteins in three groupsas determined by densitometric analysis (n=3/group). (D) Pancreatic cancer-derived exosomes induce MDSC accumulation in peripheral blood. (E) Representative flow cytometric plots (left) and quantification (right) of CD11b + GR1 + MDSCs (n=5/group). *P<0.05, **P<0.01,***P<0.001.
S100a8, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/S100A8+Antibody/pmc05609937-376-6-16
Average 95 stars, based on 1 article reviews
s100a8 - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

95
Proteintech s100a9 levels
<t>S100A9</t> is highly expressed in anti-PD-1 non-responders and is associated with poor prognosis in HCC. ( A ) Schematic overview of the sample collection and RNA-seq analysis workflow. ( B ) Volcano plots showing differentially expressed genes in tumor vs. adjacent non-tumor tissues (x-axis) and in non-responders vs. responders to anti-PD-1 therapy (y-axis). ( C ) Venn diagram illustrating genes that are upregulated in tumors and non-responders, and also associated with both overall survival (OS) and relapse-free survival (RFS) in the in-house cohort. ( D ) Representative immunohistochemistry (IHC) images showing S100A9 expression in tumor tissues from responders and non-responders. ( E – J ) High S100A9 expression is associated with worse overall survival in GSE202069 ( E ), GSE14520 ( G ), TCGA ( I ), and CHCC ( J ), and with worse relapse-free survival in GSE202069 ( F ) and GSE14520 ( H )
S100a9 Levels, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/S100A9+Antibody/pmc12528344-80-1-17
Average 95 stars, based on 1 article reviews
s100a9 levels - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

93
OriGene construct expressing s100a9
<t>S100A9</t> is highly expressed in anti-PD-1 non-responders and is associated with poor prognosis in HCC. ( A ) Schematic overview of the sample collection and RNA-seq analysis workflow. ( B ) Volcano plots showing differentially expressed genes in tumor vs. adjacent non-tumor tissues (x-axis) and in non-responders vs. responders to anti-PD-1 therapy (y-axis). ( C ) Venn diagram illustrating genes that are upregulated in tumors and non-responders, and also associated with both overall survival (OS) and relapse-free survival (RFS) in the in-house cohort. ( D ) Representative immunohistochemistry (IHC) images showing S100A9 expression in tumor tissues from responders and non-responders. ( E – J ) High S100A9 expression is associated with worse overall survival in GSE202069 ( E ), GSE14520 ( G ), TCGA ( I ), and CHCC ( J ), and with worse relapse-free survival in GSE202069 ( F ) and GSE14520 ( H )
Construct Expressing S100a9, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/S100A9+(NM_002965)+Human+Untagged+Clone/bio_rxiv__2025__04__03__647038-171-7-10
Average 93 stars, based on 1 article reviews
construct expressing s100a9 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

92
Proteintech human s100a8 s100a9 elisa kit

Human S100a8 S100a9 Elisa Kit, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/Human+S100A8%2FS100A9+ELISA+Kit/pmc11228400-70-0-5
Average 92 stars, based on 1 article reviews
human s100a8 s100a9 elisa kit - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

93
Rockland Immunochemicals s100a8
IL-1β ( A ) and <t>S100A8</t> ( B ) concentrations were assessed via ELISA. All data represents mean ± SEM. Statistical significance was assessed by using the Mann-Whitney test for IL-1β and S100A8 concentrations. C Tissue damage was assessed by measuring lactate dehydrogenase (LDH) activity in vaginal lavage fluid twenty-eight days post vaccination (28dpv) and five days post challenge (5dpc). Data represents mean ± SEM. Statistical significance was assessed by two-way ANOVA with Tukey correction (* P = 0.0111, *** P = 0.0007, **** P < 0.0001). D Quantification of inflammation in vaginal tissue from sham and NXT-2 immunized mice excised 5 days post challenge. Data represents mean ± SEM. Statistical significance was assessed by unpaired student t -test (**** P < 0.0001). Vaginal tissue excised following immunization and C. albicans challenge was stained with H&E (sham— E , NXT-2— G ) and the neutrophil specific marker anti-mouse Ly6G (sham— F , NXT-2— H ). Tissue sections were scanned at 40× objective magnification using the Aperio AT2 (Leica Biosystems). Image analysis and capture was performed using ImageScope (Leica Biosystems) at 20× digital zoom level.
S100a8, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/Mouse+S100A8+ELISA+Kit/pmc12130295-202-0-8
Average 93 stars, based on 1 article reviews
s100a8 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

93
R&D Systems recombinant ancylostoma caninum neutrophil inhibitory factor
Fig. 3. The I-domain and MIDAS motif of CD11b are critical for CR3-mediated phagocytosis of opa-negative N. gonorrhoeae. (A) Adherent, IL-8–treated primary human <t>neutrophils</t> were treated with (left group) anti-CD11b (44a; gray bar) or isotype control (white bar), or (right group) A. <t>caninum</t> NIF (gray bar) or PBS vehicle control (white bar; UT = untreated). The percentage of neutrophils with intracellular Ngo was calculated using imaging flow cytometry as in Fig. 2. Results are presented as the mean ± SEM for 3 biological replicates, with statistical significance determined by Student’s t test for the appropriate pairs. **P ≤ 0.01. (B) HL-60 human promyelocytic cells expressing human CD11b that is full length (FL) or lacking the I-domain (I-less), or carrying empty vector (Vector), were exposed to CFSE-labeled Δopa Ngo for 1 h. Cells were fixed, stained for extracellular Ngo, and processed for imaging flow cytometry. The percentage of CFSE + HL-60 cells with intracellular Ngo was calculated for 3 biological replicates. Results are presented as the mean ± SEM. Comparisons trended toward but did not reach statistical significance as analyzed using 1-way ANOVA.
Recombinant Ancylostoma Caninum Neutrophil Inhibitory Factor, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/Recombinant+A%2E+caninum+NIF+Protein%2C+CF/pm36882066-66-56-64
Average 93 stars, based on 1 article reviews
recombinant ancylostoma caninum neutrophil inhibitory factor - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

90
OriGene atgaagaagaagatgatgatgatgaataggaattcgcattcga s100a8 plasmid
Fig. 3. The I-domain and MIDAS motif of CD11b are critical for CR3-mediated phagocytosis of opa-negative N. gonorrhoeae. (A) Adherent, IL-8–treated primary human <t>neutrophils</t> were treated with (left group) anti-CD11b (44a; gray bar) or isotype control (white bar), or (right group) A. <t>caninum</t> NIF (gray bar) or PBS vehicle control (white bar; UT = untreated). The percentage of neutrophils with intracellular Ngo was calculated using imaging flow cytometry as in Fig. 2. Results are presented as the mean ± SEM for 3 biological replicates, with statistical significance determined by Student’s t test for the appropriate pairs. **P ≤ 0.01. (B) HL-60 human promyelocytic cells expressing human CD11b that is full length (FL) or lacking the I-domain (I-less), or carrying empty vector (Vector), were exposed to CFSE-labeled Δopa Ngo for 1 h. Cells were fixed, stained for extracellular Ngo, and processed for imaging flow cytometry. The percentage of CFSE + HL-60 cells with intracellular Ngo was calculated for 3 biological replicates. Results are presented as the mean ± SEM. Comparisons trended toward but did not reach statistical significance as analyzed using 1-way ANOVA.
Atgaagaagaagatgatgatgatgaataggaattcgcattcga S100a8 Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/MRP8+(S100A8)+(NM_002964)+Human+Tagged+ORF+Clone/pmc09371907__gkac618_supplemental_file-8-30-33
Average 90 stars, based on 1 article reviews
atgaagaagaagatgatgatgatgaataggaattcgcattcga s100a8 plasmid - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Boster Bio bbel mac387 polyclonal
Fig. 3. The I-domain and MIDAS motif of CD11b are critical for CR3-mediated phagocytosis of opa-negative N. gonorrhoeae. (A) Adherent, IL-8–treated primary human <t>neutrophils</t> were treated with (left group) anti-CD11b (44a; gray bar) or isotype control (white bar), or (right group) A. <t>caninum</t> NIF (gray bar) or PBS vehicle control (white bar; UT = untreated). The percentage of neutrophils with intracellular Ngo was calculated using imaging flow cytometry as in Fig. 2. Results are presented as the mean ± SEM for 3 biological replicates, with statistical significance determined by Student’s t test for the appropriate pairs. **P ≤ 0.01. (B) HL-60 human promyelocytic cells expressing human CD11b that is full length (FL) or lacking the I-domain (I-less), or carrying empty vector (Vector), were exposed to CFSE-labeled Δopa Ngo for 1 h. Cells were fixed, stained for extracellular Ngo, and processed for imaging flow cytometry. The percentage of CFSE + HL-60 cells with intracellular Ngo was calculated for 3 biological replicates. Results are presented as the mean ± SEM. Comparisons trended toward but did not reach statistical significance as analyzed using 1-way ANOVA.
Bbel Mac387 Polyclonal, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/Human+S100A9+Recombinant+Protein/pmc05468271__41598_2017_3161_MOESM1_ESM-3-141-148
Average 90 stars, based on 1 article reviews
bbel mac387 polyclonal - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

86
Neuroscience Information Framework nif caf ii
Fig. 3. The I-domain and MIDAS motif of CD11b are critical for CR3-mediated phagocytosis of opa-negative N. gonorrhoeae. (A) Adherent, IL-8–treated primary human <t>neutrophils</t> were treated with (left group) anti-CD11b (44a; gray bar) or isotype control (white bar), or (right group) A. <t>caninum</t> NIF (gray bar) or PBS vehicle control (white bar; UT = untreated). The percentage of neutrophils with intracellular Ngo was calculated using imaging flow cytometry as in Fig. 2. Results are presented as the mean ± SEM for 3 biological replicates, with statistical significance determined by Student’s t test for the appropriate pairs. **P ≤ 0.01. (B) HL-60 human promyelocytic cells expressing human CD11b that is full length (FL) or lacking the I-domain (I-less), or carrying empty vector (Vector), were exposed to CFSE-labeled Δopa Ngo for 1 h. Cells were fixed, stained for extracellular Ngo, and processed for imaging flow cytometry. The percentage of CFSE + HL-60 cells with intracellular Ngo was calculated for 3 biological replicates. Results are presented as the mean ± SEM. Comparisons trended toward but did not reach statistical significance as analyzed using 1-way ANOVA.
Nif Caf Ii, supplied by Neuroscience Information Framework, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/bands+ii+nif/10__1021_slash_acs__cgd__5c01007-31-22-22
Average 86 stars, based on 1 article reviews
nif caf ii - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

94
Proteintech s100a8 a9 elisa
Fig. 3. The I-domain and MIDAS motif of CD11b are critical for CR3-mediated phagocytosis of opa-negative N. gonorrhoeae. (A) Adherent, IL-8–treated primary human <t>neutrophils</t> were treated with (left group) anti-CD11b (44a; gray bar) or isotype control (white bar), or (right group) A. <t>caninum</t> NIF (gray bar) or PBS vehicle control (white bar; UT = untreated). The percentage of neutrophils with intracellular Ngo was calculated using imaging flow cytometry as in Fig. 2. Results are presented as the mean ± SEM for 3 biological replicates, with statistical significance determined by Student’s t test for the appropriate pairs. **P ≤ 0.01. (B) HL-60 human promyelocytic cells expressing human CD11b that is full length (FL) or lacking the I-domain (I-less), or carrying empty vector (Vector), were exposed to CFSE-labeled Δopa Ngo for 1 h. Cells were fixed, stained for extracellular Ngo, and processed for imaging flow cytometry. The percentage of CFSE + HL-60 cells with intracellular Ngo was calculated for 3 biological replicates. Results are presented as the mean ± SEM. Comparisons trended toward but did not reach statistical significance as analyzed using 1-way ANOVA.
S100a8 A9 Elisa, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/S100A8-A9+Fusion+Protein/pm40102943-94-0-8
Average 94 stars, based on 1 article reviews
s100a8 a9 elisa - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

90
SciCrunch Inc nif-ontology
Fig. 3. The I-domain and MIDAS motif of CD11b are critical for CR3-mediated phagocytosis of opa-negative N. gonorrhoeae. (A) Adherent, IL-8–treated primary human <t>neutrophils</t> were treated with (left group) anti-CD11b (44a; gray bar) or isotype control (white bar), or (right group) A. <t>caninum</t> NIF (gray bar) or PBS vehicle control (white bar; UT = untreated). The percentage of neutrophils with intracellular Ngo was calculated using imaging flow cytometry as in Fig. 2. Results are presented as the mean ± SEM for 3 biological replicates, with statistical significance determined by Student’s t test for the appropriate pairs. **P ≤ 0.01. (B) HL-60 human promyelocytic cells expressing human CD11b that is full length (FL) or lacking the I-domain (I-less), or carrying empty vector (Vector), were exposed to CFSE-labeled Δopa Ngo for 1 h. Cells were fixed, stained for extracellular Ngo, and processed for imaging flow cytometry. The percentage of CFSE + HL-60 cells with intracellular Ngo was calculated for 3 biological replicates. Results are presented as the mean ± SEM. Comparisons trended toward but did not reach statistical significance as analyzed using 1-way ANOVA.
Nif Ontology, supplied by SciCrunch Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/nif+ontology/pmc09547803__12021_2022_9566_MOESM1_ESM-53-14-3
Average 90 stars, based on 1 article reviews
nif-ontology - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
InterPro Inc nif sequences
Fig. 3. The I-domain and MIDAS motif of CD11b are critical for CR3-mediated phagocytosis of opa-negative N. gonorrhoeae. (A) Adherent, IL-8–treated primary human <t>neutrophils</t> were treated with (left group) anti-CD11b (44a; gray bar) or isotype control (white bar), or (right group) A. <t>caninum</t> NIF (gray bar) or PBS vehicle control (white bar; UT = untreated). The percentage of neutrophils with intracellular Ngo was calculated using imaging flow cytometry as in Fig. 2. Results are presented as the mean ± SEM for 3 biological replicates, with statistical significance determined by Student’s t test for the appropriate pairs. **P ≤ 0.01. (B) HL-60 human promyelocytic cells expressing human CD11b that is full length (FL) or lacking the I-domain (I-less), or carrying empty vector (Vector), were exposed to CFSE-labeled Δopa Ngo for 1 h. Cells were fixed, stained for extracellular Ngo, and processed for imaging flow cytometry. The percentage of CFSE + HL-60 cells with intracellular Ngo was calculated for 3 biological replicates. Results are presented as the mean ± SEM. Comparisons trended toward but did not reach statistical significance as analyzed using 1-way ANOVA.
Nif Sequences, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nif/nif+sequences/pmc08399215-2-0-6
Average 90 stars, based on 1 article reviews
nif sequences - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


Confocal microscopy (lung, liver, spleen, brain) of PKH67-labeled Panc02 EXO and Panc02-H7 EXO tissue distribution (green) 24 hpi. (A) PKH-67-labeled liposomes served as controls (scale bar=100 μm). Histogram shows exosome tissue distribution quantification (n=5/group). CD45, p-Stat3, and CD11b IF staining in liver sections from controls (left) and mice treated with Panc02 EXOs(middle) or Panc02-H7 EXOs (right) for 12 d without tumor challenge. (B) Histogram shows infiltrating CD45 + cell quantification. FN and α-SMA IF staining in liver sections from controls (top) and mice treated with Panc02 EXOs(middle) or Panc02-H7 EXOs (bottom) for 12 d without tumor challenge. (C) Histogram shows infiltrating α-SMA + hStCs and FN expression quantification(400× magnification; n=5/group). Western blotting analysis showed upregulated S100A8 and S100A9 in livers treated with Panc02-H7-derived exosomes. Histogram shows expression of the three proteins in three groupsas determined by densitometric analysis (n=3/group). (D) Pancreatic cancer-derived exosomes induce MDSC accumulation in peripheral blood. (E) Representative flow cytometric plots (left) and quantification (right) of CD11b + GR1 + MDSCs (n=5/group). *P<0.05, **P<0.01,***P<0.001.

Journal: Oncotarget

Article Title: Pancreatic cancer-derived exosomes promote tumor metastasis and liver pre-metastatic niche formation

doi: 10.18632/oncotarget.18831

Figure Lengend Snippet: Confocal microscopy (lung, liver, spleen, brain) of PKH67-labeled Panc02 EXO and Panc02-H7 EXO tissue distribution (green) 24 hpi. (A) PKH-67-labeled liposomes served as controls (scale bar=100 μm). Histogram shows exosome tissue distribution quantification (n=5/group). CD45, p-Stat3, and CD11b IF staining in liver sections from controls (left) and mice treated with Panc02 EXOs(middle) or Panc02-H7 EXOs (right) for 12 d without tumor challenge. (B) Histogram shows infiltrating CD45 + cell quantification. FN and α-SMA IF staining in liver sections from controls (top) and mice treated with Panc02 EXOs(middle) or Panc02-H7 EXOs (bottom) for 12 d without tumor challenge. (C) Histogram shows infiltrating α-SMA + hStCs and FN expression quantification(400× magnification; n=5/group). Western blotting analysis showed upregulated S100A8 and S100A9 in livers treated with Panc02-H7-derived exosomes. Histogram shows expression of the three proteins in three groupsas determined by densitometric analysis (n=3/group). (D) Pancreatic cancer-derived exosomes induce MDSC accumulation in peripheral blood. (E) Representative flow cytometric plots (left) and quantification (right) of CD11b + GR1 + MDSCs (n=5/group). *P<0.05, **P<0.01,***P<0.001.

Article Snippet: Primary antibodies against fibronectin (1:100),α-SMA (1:50), S100A8 (1:50), S100A9 (1:50), and F4/80 (1:50) were purchased from Proteintech (Wuhan, China).

Techniques: Confocal Microscopy, Labeling, Liposomes, Staining, Expressing, Western Blot, Derivative Assay

IHC analysis and histopathological examination of macrophages (F4/80), hStCs (α-SMA), and neutrophils in liver metastatic niches of naïve mice and mice treated with PBS, Panc02 EXOs, or Panc02-H7 EXOs at 30d post-SOI (arrow shows neutrophils in liver) (A) . Representative histogram shows quantification of F4/80 + macrophages, α-SMA + hStCs, and neutrophils (B) . Identification of FN, S100A8, and S100A9 as inflammatory mediators, and collagen deposition in the liver metastatic niche (C) . Representative histogram shows FN and MTS quantification (D) . Representative histogram shows S100A8 and S100A9 quantification (E) . n=6/group.**P<0.01,***P<0.001.10 fields assessed per sample. FOV, field of view.

Journal: Oncotarget

Article Title: Pancreatic cancer-derived exosomes promote tumor metastasis and liver pre-metastatic niche formation

doi: 10.18632/oncotarget.18831

Figure Lengend Snippet: IHC analysis and histopathological examination of macrophages (F4/80), hStCs (α-SMA), and neutrophils in liver metastatic niches of naïve mice and mice treated with PBS, Panc02 EXOs, or Panc02-H7 EXOs at 30d post-SOI (arrow shows neutrophils in liver) (A) . Representative histogram shows quantification of F4/80 + macrophages, α-SMA + hStCs, and neutrophils (B) . Identification of FN, S100A8, and S100A9 as inflammatory mediators, and collagen deposition in the liver metastatic niche (C) . Representative histogram shows FN and MTS quantification (D) . Representative histogram shows S100A8 and S100A9 quantification (E) . n=6/group.**P<0.01,***P<0.001.10 fields assessed per sample. FOV, field of view.

Article Snippet: Primary antibodies against fibronectin (1:100),α-SMA (1:50), S100A8 (1:50), S100A9 (1:50), and F4/80 (1:50) were purchased from Proteintech (Wuhan, China).

Techniques:

S100A9 is highly expressed in anti-PD-1 non-responders and is associated with poor prognosis in HCC. ( A ) Schematic overview of the sample collection and RNA-seq analysis workflow. ( B ) Volcano plots showing differentially expressed genes in tumor vs. adjacent non-tumor tissues (x-axis) and in non-responders vs. responders to anti-PD-1 therapy (y-axis). ( C ) Venn diagram illustrating genes that are upregulated in tumors and non-responders, and also associated with both overall survival (OS) and relapse-free survival (RFS) in the in-house cohort. ( D ) Representative immunohistochemistry (IHC) images showing S100A9 expression in tumor tissues from responders and non-responders. ( E – J ) High S100A9 expression is associated with worse overall survival in GSE202069 ( E ), GSE14520 ( G ), TCGA ( I ), and CHCC ( J ), and with worse relapse-free survival in GSE202069 ( F ) and GSE14520 ( H )

Journal: Cellular Oncology (Dordrecht, Netherlands)

Article Title: S100A9 promotes resistance to anti-PD-1 immunotherapy in hepatocellular carcinoma by degrading PARP1 and activating the STAT3/PD-L1 pathway

doi: 10.1007/s13402-025-01087-0

Figure Lengend Snippet: S100A9 is highly expressed in anti-PD-1 non-responders and is associated with poor prognosis in HCC. ( A ) Schematic overview of the sample collection and RNA-seq analysis workflow. ( B ) Volcano plots showing differentially expressed genes in tumor vs. adjacent non-tumor tissues (x-axis) and in non-responders vs. responders to anti-PD-1 therapy (y-axis). ( C ) Venn diagram illustrating genes that are upregulated in tumors and non-responders, and also associated with both overall survival (OS) and relapse-free survival (RFS) in the in-house cohort. ( D ) Representative immunohistochemistry (IHC) images showing S100A9 expression in tumor tissues from responders and non-responders. ( E – J ) High S100A9 expression is associated with worse overall survival in GSE202069 ( E ), GSE14520 ( G ), TCGA ( I ), and CHCC ( J ), and with worse relapse-free survival in GSE202069 ( F ) and GSE14520 ( H )

Article Snippet: The S100A9 levels in the culture supernatant were determined using the S100A9 ELISA kit provided by Wuhan Proteintech Biotechnology Co., Ltd. To ensure the accuracy and reliability of the data, experiments were conducted strictly according to the manufacturer’s instructions.

Techniques: RNA Sequencing, Immunohistochemistry, Expressing

S100A9 inhibits the efficacy of anti-PD-1 therapy in HCC mouse models. ( A ) Schematic illustration of the establishment of subcutaneous Hepa1-6 tumor models and treatment regimen. ( B ) Representative images of subcutaneous tumors from each treatment group. ( C ) Tumor growth curves of Hepa1-6 tumors in C57BL/6 mice treated with either IgG or anti-PD-1 antibody, with or without S100a9 overexpression. ( D ) Schematic diagram depicting the generation of the hydrodynamic tail vein injection (HTVi) model and treatment strategy. ( E ) Representative gross liver tumor images from each group. ( F ) Liver-to-body weight ratios following IgG or anti-PD-1 treatment. ( G ) Quantification of tumor numbers per group post-treatment. ( H ) Representative IHC staining of mouse tumor sections for H&E, S100a9, CD4, and CD8. ( I ) Quantification of CD4⁺ and CD8⁺ T cell infiltration in tumor tissues from each group

Journal: Cellular Oncology (Dordrecht, Netherlands)

Article Title: S100A9 promotes resistance to anti-PD-1 immunotherapy in hepatocellular carcinoma by degrading PARP1 and activating the STAT3/PD-L1 pathway

doi: 10.1007/s13402-025-01087-0

Figure Lengend Snippet: S100A9 inhibits the efficacy of anti-PD-1 therapy in HCC mouse models. ( A ) Schematic illustration of the establishment of subcutaneous Hepa1-6 tumor models and treatment regimen. ( B ) Representative images of subcutaneous tumors from each treatment group. ( C ) Tumor growth curves of Hepa1-6 tumors in C57BL/6 mice treated with either IgG or anti-PD-1 antibody, with or without S100a9 overexpression. ( D ) Schematic diagram depicting the generation of the hydrodynamic tail vein injection (HTVi) model and treatment strategy. ( E ) Representative gross liver tumor images from each group. ( F ) Liver-to-body weight ratios following IgG or anti-PD-1 treatment. ( G ) Quantification of tumor numbers per group post-treatment. ( H ) Representative IHC staining of mouse tumor sections for H&E, S100a9, CD4, and CD8. ( I ) Quantification of CD4⁺ and CD8⁺ T cell infiltration in tumor tissues from each group

Article Snippet: The S100A9 levels in the culture supernatant were determined using the S100A9 ELISA kit provided by Wuhan Proteintech Biotechnology Co., Ltd. To ensure the accuracy and reliability of the data, experiments were conducted strictly according to the manufacturer’s instructions.

Techniques: Over Expression, Injection, Immunohistochemistry

S100A9 enhances PD–L1 transcription via activation of the STAT3 signaling pathway. ( A ) Gene Set Enrichment Analysis (GSEA) of S100A9- and PD–L1-associated HALLMARK pathways based on the TCGA LIHC cohort. ( B – C ) GSEA indicates a positive correlation between IL-6/JAK/STAT3 signaling and the expression of S100A9 ( B ) and PD–L1 ( C ). ( D ) Western blot analysis of MHCC-97 H cells showing that S100A9 overexpression increases STAT3 phosphorylation at Tyr705 and upregulates PD–L1 protein levels. ( E ) Quantitative PCR analysis confirms that S100A9 overexpression enhances PD–L1 mRNA expression. ( F ) Representative IHC images of HCC clinical and Hepa1-6 mouse tumor samples demonstrating expression patterns of S100A9, phosphorylated STAT3 (Tyr705), and PD–L1

Journal: Cellular Oncology (Dordrecht, Netherlands)

Article Title: S100A9 promotes resistance to anti-PD-1 immunotherapy in hepatocellular carcinoma by degrading PARP1 and activating the STAT3/PD-L1 pathway

doi: 10.1007/s13402-025-01087-0

Figure Lengend Snippet: S100A9 enhances PD–L1 transcription via activation of the STAT3 signaling pathway. ( A ) Gene Set Enrichment Analysis (GSEA) of S100A9- and PD–L1-associated HALLMARK pathways based on the TCGA LIHC cohort. ( B – C ) GSEA indicates a positive correlation between IL-6/JAK/STAT3 signaling and the expression of S100A9 ( B ) and PD–L1 ( C ). ( D ) Western blot analysis of MHCC-97 H cells showing that S100A9 overexpression increases STAT3 phosphorylation at Tyr705 and upregulates PD–L1 protein levels. ( E ) Quantitative PCR analysis confirms that S100A9 overexpression enhances PD–L1 mRNA expression. ( F ) Representative IHC images of HCC clinical and Hepa1-6 mouse tumor samples demonstrating expression patterns of S100A9, phosphorylated STAT3 (Tyr705), and PD–L1

Article Snippet: The S100A9 levels in the culture supernatant were determined using the S100A9 ELISA kit provided by Wuhan Proteintech Biotechnology Co., Ltd. To ensure the accuracy and reliability of the data, experiments were conducted strictly according to the manufacturer’s instructions.

Techniques: Activation Assay, Expressing, Western Blot, Over Expression, Phospho-proteomics, Real-time Polymerase Chain Reaction

S100A9 interacts with PARP1 and promotes its degradation via the ubiquitin-proteasome pathway. ( A ) Schematic flowchart illustrating the process of immunoprecipitation followed by mass spectrometry (IP–MS). ( B ) Coomassie brilliant blue staining showing successful immunoprecipitation of S100A9 in 293 T cells. ( C ) LC–MS analysis identifying candidate proteins interacting with S100A9. ( D ) Co-immunoprecipitation and Western blotting in MHCC-97 H cells confirm the interaction between S100A9 and PARP1. ( E ) Immunofluorescence staining demonstrates co-localization of S100A9 and PARP1 in Huh7 cells. ( F ) Western blot showing that overexpression of S100A9 downregulates PARP1 protein levels in MHCC-97 H cells. ( G ) Knockdown of S100A9 in Huh7 cells increases PARP1 expression and decreases STAT3 phosphorylation (Tyr705) and PD–L1 expression, as shown by Western blot. ( H ) Schematic representation of PARP1 functional domains. ( I ) Co-immunoprecipitation assays identifying the BRCT domain as the interacting region with S100A9. ( J ) Cycloheximide (CHX) chase assay showing the degradation kinetics of PARP1 and PD–L1 upon S100A9 overexpression. ( K ) Quantification of CHX assays showing normalized PARP1 and PD–L1 protein levels over time. ( L ) Western blot analysis showing that MG132 treatment reverses the reduction of PARP1 induced by S100A9 overexpression in MHCC-97 H cells. ( M – N ) Ubiquitination assays in 293 T cells co-transfected with HA–Ub and either Flag-S100A9 (M) or S100A9 siRNA (N), with or without MG132 treatment. PARP1 was immunoprecipitated, and ubiquitination was assessed using an anti-Ub antibody

Journal: Cellular Oncology (Dordrecht, Netherlands)

Article Title: S100A9 promotes resistance to anti-PD-1 immunotherapy in hepatocellular carcinoma by degrading PARP1 and activating the STAT3/PD-L1 pathway

doi: 10.1007/s13402-025-01087-0

Figure Lengend Snippet: S100A9 interacts with PARP1 and promotes its degradation via the ubiquitin-proteasome pathway. ( A ) Schematic flowchart illustrating the process of immunoprecipitation followed by mass spectrometry (IP–MS). ( B ) Coomassie brilliant blue staining showing successful immunoprecipitation of S100A9 in 293 T cells. ( C ) LC–MS analysis identifying candidate proteins interacting with S100A9. ( D ) Co-immunoprecipitation and Western blotting in MHCC-97 H cells confirm the interaction between S100A9 and PARP1. ( E ) Immunofluorescence staining demonstrates co-localization of S100A9 and PARP1 in Huh7 cells. ( F ) Western blot showing that overexpression of S100A9 downregulates PARP1 protein levels in MHCC-97 H cells. ( G ) Knockdown of S100A9 in Huh7 cells increases PARP1 expression and decreases STAT3 phosphorylation (Tyr705) and PD–L1 expression, as shown by Western blot. ( H ) Schematic representation of PARP1 functional domains. ( I ) Co-immunoprecipitation assays identifying the BRCT domain as the interacting region with S100A9. ( J ) Cycloheximide (CHX) chase assay showing the degradation kinetics of PARP1 and PD–L1 upon S100A9 overexpression. ( K ) Quantification of CHX assays showing normalized PARP1 and PD–L1 protein levels over time. ( L ) Western blot analysis showing that MG132 treatment reverses the reduction of PARP1 induced by S100A9 overexpression in MHCC-97 H cells. ( M – N ) Ubiquitination assays in 293 T cells co-transfected with HA–Ub and either Flag-S100A9 (M) or S100A9 siRNA (N), with or without MG132 treatment. PARP1 was immunoprecipitated, and ubiquitination was assessed using an anti-Ub antibody

Article Snippet: The S100A9 levels in the culture supernatant were determined using the S100A9 ELISA kit provided by Wuhan Proteintech Biotechnology Co., Ltd. To ensure the accuracy and reliability of the data, experiments were conducted strictly according to the manufacturer’s instructions.

Techniques: Ubiquitin Proteomics, Immunoprecipitation, Mass Spectrometry, Protein-Protein interactions, Staining, Liquid Chromatography with Mass Spectroscopy, Western Blot, Immunofluorescence, Over Expression, Knockdown, Expressing, Phospho-proteomics, Functional Assay, Transfection

Tasquinimod, an S100A9 inhibitor, enhances anti-PD-1 immunotherapy efficacy in a mouse model of HCC. ( A ) Western blot analysis showing the effects of increasing concentrations of the S100A9 inhibitor Tasquinimod on the protein levels of S100A9, PARP1, total STAT3, phosphorylated STAT3 (Tyr705), and PD–L1 in Huh7 cells. ( B ) Schematic diagram illustrating the drug treatment protocol in C57BL/6 mice, including administration of Tasquinimod and/or anti-PD-1 antibody. ( C ) Representative images of subcutaneous Hepa1-6 tumors from each treatment group. ( D ) Tumor growth curves of subcutaneous Hepa1-6 tumors in C57BL/6 mice treated with Tasquinimod, anti-PD-1 antibody, or the combination. ( E ) Representative immunohistochemistry (IHC) staining of mouse tumor samples, including H&E, Ki67, CD4, and CD8. ( F ) Quantification of CD4⁺ and CD8⁺ T cell infiltration in tumor tissues based on IHC analysis. ( G ) Flow cytometry analysis showing CD4⁺ and CD8⁺ T cell infiltration in the indicated treatment groups

Journal: Cellular Oncology (Dordrecht, Netherlands)

Article Title: S100A9 promotes resistance to anti-PD-1 immunotherapy in hepatocellular carcinoma by degrading PARP1 and activating the STAT3/PD-L1 pathway

doi: 10.1007/s13402-025-01087-0

Figure Lengend Snippet: Tasquinimod, an S100A9 inhibitor, enhances anti-PD-1 immunotherapy efficacy in a mouse model of HCC. ( A ) Western blot analysis showing the effects of increasing concentrations of the S100A9 inhibitor Tasquinimod on the protein levels of S100A9, PARP1, total STAT3, phosphorylated STAT3 (Tyr705), and PD–L1 in Huh7 cells. ( B ) Schematic diagram illustrating the drug treatment protocol in C57BL/6 mice, including administration of Tasquinimod and/or anti-PD-1 antibody. ( C ) Representative images of subcutaneous Hepa1-6 tumors from each treatment group. ( D ) Tumor growth curves of subcutaneous Hepa1-6 tumors in C57BL/6 mice treated with Tasquinimod, anti-PD-1 antibody, or the combination. ( E ) Representative immunohistochemistry (IHC) staining of mouse tumor samples, including H&E, Ki67, CD4, and CD8. ( F ) Quantification of CD4⁺ and CD8⁺ T cell infiltration in tumor tissues based on IHC analysis. ( G ) Flow cytometry analysis showing CD4⁺ and CD8⁺ T cell infiltration in the indicated treatment groups

Article Snippet: The S100A9 levels in the culture supernatant were determined using the S100A9 ELISA kit provided by Wuhan Proteintech Biotechnology Co., Ltd. To ensure the accuracy and reliability of the data, experiments were conducted strictly according to the manufacturer’s instructions.

Techniques: Western Blot, Immunohistochemistry, Flow Cytometry

Schematic diagram illustrating the mechanism by which S100A9 promotes resistance to anti-PD-1 immunotherapy in HCC. S100A9 directly interacts with PARP1 and promotes its degradation through the ubiquitin-proteasome pathway, resulting in enhanced phosphorylation of STAT3 at Tyr705 and subsequent transcriptional upregulation of PD–L1. This signaling cascade contributes to immune evasion and resistance to anti-PD-1 therapy. Notably, pharmacological inhibition of S100A9 with Tasquinimod significantly enhances the efficacy of anti-PD-1 treatment in HCC. (Figure created using BioRender.com)

Journal: Cellular Oncology (Dordrecht, Netherlands)

Article Title: S100A9 promotes resistance to anti-PD-1 immunotherapy in hepatocellular carcinoma by degrading PARP1 and activating the STAT3/PD-L1 pathway

doi: 10.1007/s13402-025-01087-0

Figure Lengend Snippet: Schematic diagram illustrating the mechanism by which S100A9 promotes resistance to anti-PD-1 immunotherapy in HCC. S100A9 directly interacts with PARP1 and promotes its degradation through the ubiquitin-proteasome pathway, resulting in enhanced phosphorylation of STAT3 at Tyr705 and subsequent transcriptional upregulation of PD–L1. This signaling cascade contributes to immune evasion and resistance to anti-PD-1 therapy. Notably, pharmacological inhibition of S100A9 with Tasquinimod significantly enhances the efficacy of anti-PD-1 treatment in HCC. (Figure created using BioRender.com)

Article Snippet: The S100A9 levels in the culture supernatant were determined using the S100A9 ELISA kit provided by Wuhan Proteintech Biotechnology Co., Ltd. To ensure the accuracy and reliability of the data, experiments were conducted strictly according to the manufacturer’s instructions.

Techniques: Ubiquitin Proteomics, Phospho-proteomics, Inhibition

Journal: Cell Reports Medicine

Article Title: Alarmin S100A8 imparts chemoresistance of esophageal cancer by reprogramming cancer-associated fibroblasts

doi: 10.1016/j.xcrm.2024.101576

Figure Lengend Snippet:

Article Snippet: Human S100A8/S100A9 ELISA Kit , Proteintech , Cat# KE00177.

Techniques: Virus, shRNA, Over Expression, Recombinant, Purification, Staining, Enzyme-linked Immunosorbent Assay, Sonication, Chromatin Immunoprecipitation, Software

IL-1β ( A ) and S100A8 ( B ) concentrations were assessed via ELISA. All data represents mean ± SEM. Statistical significance was assessed by using the Mann-Whitney test for IL-1β and S100A8 concentrations. C Tissue damage was assessed by measuring lactate dehydrogenase (LDH) activity in vaginal lavage fluid twenty-eight days post vaccination (28dpv) and five days post challenge (5dpc). Data represents mean ± SEM. Statistical significance was assessed by two-way ANOVA with Tukey correction (* P = 0.0111, *** P = 0.0007, **** P < 0.0001). D Quantification of inflammation in vaginal tissue from sham and NXT-2 immunized mice excised 5 days post challenge. Data represents mean ± SEM. Statistical significance was assessed by unpaired student t -test (**** P < 0.0001). Vaginal tissue excised following immunization and C. albicans challenge was stained with H&E (sham— E , NXT-2— G ) and the neutrophil specific marker anti-mouse Ly6G (sham— F , NXT-2— H ). Tissue sections were scanned at 40× objective magnification using the Aperio AT2 (Leica Biosystems). Image analysis and capture was performed using ImageScope (Leica Biosystems) at 20× digital zoom level.

Journal: NPJ Vaccines

Article Title: Protective efficacy of the pan-fungal vaccine NXT-2 against vulvovaginal candidiasis in a murine model

doi: 10.1038/s41541-025-01171-4

Figure Lengend Snippet: IL-1β ( A ) and S100A8 ( B ) concentrations were assessed via ELISA. All data represents mean ± SEM. Statistical significance was assessed by using the Mann-Whitney test for IL-1β and S100A8 concentrations. C Tissue damage was assessed by measuring lactate dehydrogenase (LDH) activity in vaginal lavage fluid twenty-eight days post vaccination (28dpv) and five days post challenge (5dpc). Data represents mean ± SEM. Statistical significance was assessed by two-way ANOVA with Tukey correction (* P = 0.0111, *** P = 0.0007, **** P < 0.0001). D Quantification of inflammation in vaginal tissue from sham and NXT-2 immunized mice excised 5 days post challenge. Data represents mean ± SEM. Statistical significance was assessed by unpaired student t -test (**** P < 0.0001). Vaginal tissue excised following immunization and C. albicans challenge was stained with H&E (sham— E , NXT-2— G ) and the neutrophil specific marker anti-mouse Ly6G (sham— F , NXT-2— H ). Tissue sections were scanned at 40× objective magnification using the Aperio AT2 (Leica Biosystems). Image analysis and capture was performed using ImageScope (Leica Biosystems) at 20× digital zoom level.

Article Snippet: S100A8 : Utilizing the Mouse S100A8 ELISA kit (Rockland Immunochemicals), samples were diluted 1:100 and the manufacturer’s instructions were followed.

Techniques: Enzyme-linked Immunosorbent Assay, MANN-WHITNEY, Activity Assay, Staining, Marker

Fig. 3. The I-domain and MIDAS motif of CD11b are critical for CR3-mediated phagocytosis of opa-negative N. gonorrhoeae. (A) Adherent, IL-8–treated primary human neutrophils were treated with (left group) anti-CD11b (44a; gray bar) or isotype control (white bar), or (right group) A. caninum NIF (gray bar) or PBS vehicle control (white bar; UT = untreated). The percentage of neutrophils with intracellular Ngo was calculated using imaging flow cytometry as in Fig. 2. Results are presented as the mean ± SEM for 3 biological replicates, with statistical significance determined by Student’s t test for the appropriate pairs. **P ≤ 0.01. (B) HL-60 human promyelocytic cells expressing human CD11b that is full length (FL) or lacking the I-domain (I-less), or carrying empty vector (Vector), were exposed to CFSE-labeled Δopa Ngo for 1 h. Cells were fixed, stained for extracellular Ngo, and processed for imaging flow cytometry. The percentage of CFSE + HL-60 cells with intracellular Ngo was calculated for 3 biological replicates. Results are presented as the mean ± SEM. Comparisons trended toward but did not reach statistical significance as analyzed using 1-way ANOVA.

Journal: Journal of leukocyte biology

Article Title: Phagocytosis via complement receptor 3 enables microbes to evade killing by neutrophils.

doi: 10.1093/jleuko/qiad028

Figure Lengend Snippet: Fig. 3. The I-domain and MIDAS motif of CD11b are critical for CR3-mediated phagocytosis of opa-negative N. gonorrhoeae. (A) Adherent, IL-8–treated primary human neutrophils were treated with (left group) anti-CD11b (44a; gray bar) or isotype control (white bar), or (right group) A. caninum NIF (gray bar) or PBS vehicle control (white bar; UT = untreated). The percentage of neutrophils with intracellular Ngo was calculated using imaging flow cytometry as in Fig. 2. Results are presented as the mean ± SEM for 3 biological replicates, with statistical significance determined by Student’s t test for the appropriate pairs. **P ≤ 0.01. (B) HL-60 human promyelocytic cells expressing human CD11b that is full length (FL) or lacking the I-domain (I-less), or carrying empty vector (Vector), were exposed to CFSE-labeled Δopa Ngo for 1 h. Cells were fixed, stained for extracellular Ngo, and processed for imaging flow cytometry. The percentage of CFSE + HL-60 cells with intracellular Ngo was calculated for 3 biological replicates. Results are presented as the mean ± SEM. Comparisons trended toward but did not reach statistical significance as analyzed using 1-way ANOVA.

Article Snippet: Neutrophils were suspended in RPMI (Cytiva) + 10% heat-inactivated fetal bovine serum (HyClone) (hereafter referred to as “infection medium”) containing 10 nM human IL-8 (R&D Systems) and left to adhere to tissue culture–treated plastic coverslips (Sarstedt) for 30 min. Neutrophils were treated with blocking antibodies or matched isotype control (20 μg mL−1; see Table 1) or recombinant Ancylostoma caninum neutrophil inhibitory factor (NIF) protein (R&D Systems; 0.5 μg mL−1) for 20 min. Fluorescently labeled Ngo was then added to neutrophils by centrifugation at 400 × g for 4 min at 12 °C.

Techniques: Control, Imaging, Flow Cytometry, Expressing, Plasmid Preparation, Labeling, Staining