|
Zymo Research
negative control grna transduced id8 gc Negative Control Grna Transduced Id8 Gc, supplied by Zymo Research, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/Negative+Control/pm41042068-658-18-40 Average 95 stars, based on 1 article reviews
negative control grna transduced id8 gc - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Integrated DNA Technologies
guidernas grna Guidernas Grna, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/Negative+Control+crRNA/bio_rxiv__2021__07__26__453250-340-1-6 Average 95 stars, based on 1 article reviews
guidernas grna - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Addgene inc
tgfbr1 overexpression vectors ![]() Tgfbr1 Overexpression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/TGFBR1+gRNA+(BRDN0001146778)+(Plasmid+%2376644)/pm30789794-40-0-36 Average 88 stars, based on 1 article reviews
tgfbr1 overexpression vectors - by Bioz Stars,
2026-09
88/100 stars
|
Buy from Supplier |
|
Addgene inc
guide rna targeting mouse cd81 gcaaccacagagctacacct ![]() Guide Rna Targeting Mouse Cd81 Gcaaccacagagctacacct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/pHAGE-SIRPB1-R240C+(Plasmid+%23116680)/pmc07419504-180-14-9 Average 93 stars, based on 1 article reviews
guide rna targeting mouse cd81 gcaaccacagagctacacct - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
human talin single guide rnas sgrnas ![]() Human Talin Single Guide Rnas Sgrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/pSpCas9n(BB)-2A-Puro+(PX462)+(Plasmid+%2348141)/pmc05881498-137-3-15 Average 94 stars, based on 1 article reviews
human talin single guide rnas sgrnas - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Addgene inc
guide rna sequences targeting ecel1 ![]() Guide Rna Sequences Targeting Ecel1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/pX601-AAV-CMV%3A%3ANLS-SaCas9-NLS-3xHA-bGHpA%3BU6%3A%3ABsaI-sgRNA+(Plasmid+%2361591)/pm30073365-57-54-50 Average 96 stars, based on 1 article reviews
guide rna sequences targeting ecel1 - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Addgene inc
human genome ![]() Human Genome, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/Human+Genome-Wide+Minimized+Double-gRNA+library+(Pooled+library+%23137999)/bio_rxiv__400291-534-34-39 Average 94 stars, based on 1 article reviews
human genome - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Addgene inc
orc2 sgrna gaaggagcgagcgcagcttt ![]() Orc2 Sgrna Gaaggagcgagcgcagcttt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/gRNA_GFP-T2+(Plasmid+%2341820)/bio_rxiv__2020__08__10__245076-163-0-11 Average 93 stars, based on 1 article reviews
orc2 sgrna gaaggagcgagcgcagcttt - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
grna cas9 dual expression vector pspcas9 bb 2a gfp px458 ![]() Grna Cas9 Dual Expression Vector Pspcas9 Bb 2a Gfp Px458, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pmc05566108-30-1-11 Average 96 stars, based on 1 article reviews
grna cas9 dual expression vector pspcas9 bb 2a gfp px458 - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Addgene inc
mis18α ![]() Mis18α, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/CAMK2D+gRNA+(BRDN0001146856)+(Plasmid+%2377187)/pmc11315898-228-5-24 Average 92 stars, based on 1 article reviews
mis18α - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Addgene inc
non targeting control sgrnas ![]() Non Targeting Control Sgrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/non-targeting+control+gRNA+(BRDN0001145598)+(Plasmid+%2380173)/bio_rxiv__2023__01__23__525275-111-18-7 Average 94 stars, based on 1 article reviews
non targeting control sgrnas - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
ATCC
plxnd1 grna ko1 ![]() Plxnd1 Grna Ko1, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/negative+control+grnas/A2E11/pmc06499541-16-54-32 Average 94 stars, based on 1 article reviews
plxnd1 grna ko1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: FASEB journal : official publication of the Federation of American Societies for Experimental Biology
Article Title: Unveiling the role of microRNA-7 in linking TGF-β-Smad-mediated epithelial-mesenchymal transition with negative regulation of trophoblast invasion.
doi: 10.1096/fj.201801898RR
Figure Lengend Snippet: Figure 1. TGFBR1 regulated cell invasion and interacted with EMT-related TFs in trophoblasts. A, B) Lentiviral transduction of shTGFBR1 efficiently down-regulated the expression of TGFBR1 (A) and its protein level (B) in both 3A-sub E and HTR-8/SVneo trophoblast cell lines. The quantification of TGFBR1 expression relative to GAPDH is shown (n = 3) (A). C) TGFBR1 silencing enhanced trophoblast invasion in Matrigel-coated Transwell assay. D) Quantitative results of invasion assay and Western blot analysis are shown (n = 6). E, F) Supplementation of TGF-b1 and transduction of shTGFBR1 significantly activated SNAIL and SLUG expression in 3A-sub E (E) and HTR-8/SVneo cells (F). However, the expression of TWIST was not altered by the administration of TGF-b1 (n = 4). Data information: 1-way ANOVA. Quantitative data are presented as means 6 SD (A, B, D–F), and statistically significant differences between groups are indicated with asterisks. ****P # 0.0001.
Article Snippet:
Techniques: Transduction, Expressing, Transwell Assay, Invasion Assay, Western Blot
Journal: FASEB journal : official publication of the Federation of American Societies for Experimental Biology
Article Title: Unveiling the role of microRNA-7 in linking TGF-β-Smad-mediated epithelial-mesenchymal transition with negative regulation of trophoblast invasion.
doi: 10.1096/fj.201801898RR
Figure Lengend Snippet: Figure 2. The differential effect of normal and malignant trophoblasts in response to silencing TGFBR1 involves miR-7. A) Heat map of miR expression in shTGFBR1-silenced trophoblasts compared with the SC. Up-regulation and down-regulation of miR expression compared with the scrambled-transduced cells are shown in red and green, respectively. miR-7 is one of the down- regulated miRs in cells with shTGFBR1 compared with the SC. B, C) TGRBR1 silencing, either via antagonizing by the selective TbRI inhibitor (SB431542) or shTGFBR1 transduction, resulted in significant reduction in miR-7 expression in both cell lines. 3A- sub E control/SB431542: n = 3; HTR-8/SVneo control: n = 5; HTR-8/SVneo SB431542: n = 4 (B). 3A-sub E SC: n = 6; 3A-sub E shTGFBR1#1: n = 5; 3A-sub E shTGFBR1#2: n = 6; HTR-8/SVneo SC/shTGFBR1#1/shTGFBR1#2: n = 3 (C). D) Constitutive expression of TGFBR1 by transduction in TD mutant resulted in significantly high miR-7 expression compared with KR mutant and WT (n = 5). E) TGRBR1 silencing by shTGFBR1 transduction resulted in significant induction of miR-7 expression in both JAR and JEG-3 cell lines (JAR SC, shTGFBR1#1, and shTGFBR1#2: n = 8, 5, and 5; JEG-3 SC, shTGFBR1#1, and shTGFBR1#2: n = 10, 4, and 7). EV, empty vector. Data information: all of the above experiments were performed without TGF-b1 supplementation; 1- way ANOVA for data, which are presented as means 6 SD (B–E). Statistically significant differences between groups are indicated with asterisks. *P , 0.05, **P , 0.01, ****P # 0.0001.
Article Snippet:
Techniques: Expressing, Transduction, Control, Mutagenesis, Plasmid Preparation
Journal: FASEB journal : official publication of the Federation of American Societies for Experimental Biology
Article Title: Unveiling the role of microRNA-7 in linking TGF-β-Smad-mediated epithelial-mesenchymal transition with negative regulation of trophoblast invasion.
doi: 10.1096/fj.201801898RR
Figure Lengend Snippet: Figure 4. miR-7 regulated trophoblast invasion through EMT. A–F) TGFBR1 silencing (A–C) and miR-7 knockdown (D–F) significantly increased the expression of EMT-related TFs, including SNAIL, SLUG, and TWIST. 3A-sub E SC, shTGFBR1#1, and shTGFBR1#2: n = 5, 3, and 3; HTR-8/SVneo SC, shTGFBR1#1, and shTGFBR1#2: n = 5, 4, and 4 (A). 3A-sub E SC, shTGFBR1#1, and shTGFBR1#2: n = 5, 2, and 4; HTR-8/SVneo SC, shTGFBR1#1, and shTGFBR1#2: n = 5, 4, and 3 (B). 3A-sub E SC, shTGFBR1#1, shTGFBR1#2: n = 6, 4, and 3; HTR-8/SVneo SC, shTGFBR1#1, and shTGFBR1#2: n = 6, 3, and 3 (C). 3A-sub E SC, shTGFBR1#1, and shTGFBR1#2: n = 5, 4, and 3; HTR-8/SVneo SC, shTGFBR1#1, and shTGFBR1#2: n = 5, 4, and 5 (D). 3A-sub E SC, shTGFBR1#1, and shTGFBR1#2: n = 4, 4, and 3; HTR-8/SVneo SC, shTGFBR1#1, and shTGFBR1#2: n = 5, 5, and 4 (E). 3A-sub E SC, shTGFBR1#1, and shTGFBR1#2: n = 6, 3, and 4; HTR-8/SVneo SC, shTGFBR1#1, and shTGFBR1#2: n = 6, 5, and 6.) (F). G, H) TGFBR1 silencing increased the level of EMT-related TFs and their downstream targets (N-cadherin, VE-cadherin, vimentin, and MMP-9). The level of the epithelial marker E-cadherin was reduced in shTGFBR1 transduced cells compared with the SC. However, the level of (continued on next page)
Article Snippet:
Techniques: Knockdown, Expressing, Marker
Journal: FASEB journal : official publication of the Federation of American Societies for Experimental Biology
Article Title: Unveiling the role of microRNA-7 in linking TGF-β-Smad-mediated epithelial-mesenchymal transition with negative regulation of trophoblast invasion.
doi: 10.1096/fj.201801898RR
Figure Lengend Snippet: Figure 5. TGFBR1 regulated miR-7 expression via Smad2-dependent pathway. A) Transduction of TGFBR1 overexpression construct (TD) demonstrated an increase in TGFBR1 and pSmad2 expression compared with KR mutants and WT and induced a down-regulation of EMT TFs (SNAIL and TWIST) and their downstream effectors (N-cadherin, vimentin, VE-cadherin, and MMP-9) and up-regulation of E-cadherin compared with WT and KR mutants, indicating an impairment of EMT. B) Transduction of aOn-TGFBR1-TD plasmid in 3A-sub E cells treated with Dox resulted in forced expressions of TGFBR1 and (continued on next page)
Article Snippet:
Techniques: Expressing, Transduction, Over Expression, Construct, Plasmid Preparation
Journal: Scientific Reports
Article Title: Molecular determinants of SR-B1-dependent Plasmodium sporozoite entry into hepatocytes
doi: 10.1038/s41598-020-70468-2
Figure Lengend Snippet: P. berghei sporozoites can infect primary mouse hepatocytes through CD81-and SR-B1-independent pathways. ( A ) Primary hepatocytes isolated from WT or SR-B1 deficient C57BL/6 mice were infected with PbGFP sporozoites in the absence or presence of neutralizing anti-mCD81 mAb MT81, and cultured for 24 h before EEF quantification (mean control values for each experiment without MT81: 63 and 266 EEFs/well in srb1 +/+ hepatocytes; 94, 311 and 420 EEFs/well in srb1 −/− hepatocytes). * p < 0.05 (ratio paired t test). (B) P. berghei infection in Hepa1-6 cells was inhibited by the anti-mCD81 mAb MT81 antibody (mean control values for each experiment without MT81: 0.64 and 1.09% PbGFP-infected cells).
Article Snippet: Cells were transfected with 500 ng of LentiCrispR V2 (
Techniques: Isolation, Infection, Cell Culture, Control
Journal: Scientific Reports
Article Title: Molecular determinants of SR-B1-dependent Plasmodium sporozoite entry into hepatocytes
doi: 10.1038/s41598-020-70468-2
Figure Lengend Snippet: CRISPR-mediated inactivation of CD81 abrogates P. berghei infection in Hepa1-6 cells. (A) Hepa1-6 and CD81KOH16 cells were stained for surface CD81 with anti-CD81 MT81 monoclonal antibody and Alexa Fluor 488-conjugated secondary antibodies, before flow cytometry analysis. Histograms represent the fluorescence intensity of extracellular CD81 proteins for WT Hepa1-6 (blue) and CD81KOH16 cells (orange). The grey histogram represents cells stained with secondary antibodies only (Control). (B) Western blot analysis of total CD81 protein expression in WT Hepa1-6 and CD81KOH16 cells. GAPDH was used as loading control. (C–E) WT Hepa1-6 and CD81KOH16 cells were infected with PbGFP sporozoites and analyzed 24 h after invasion by flow cytometry (C) or microscopy (D, E) after staining with anti-UIS4 antibodies (red) and Hoechst 33342 nuclear stain (blue). The mean control values for each experiment were 0.27 and 0.93% PbGFP-infected cells ( C ), and 144, 145, 215 and 288 EEFs/well ( D ). **** p < 0.0001 (ratio paired t test). The images show PbGFP EEFs (green) surrounded by a UIS4-positive PV membrane (red) or intranuclear parasites in CD81KOH16 cells. Scale bar, 10 μm.
Article Snippet: Cells were transfected with 500 ng of LentiCrispR V2 (
Techniques: CRISPR, Infection, Staining, Flow Cytometry, Fluorescence, Control, Western Blot, Expressing, Microscopy, Membrane
Journal: Scientific Reports
Article Title: Molecular determinants of SR-B1-dependent Plasmodium sporozoite entry into hepatocytes
doi: 10.1038/s41598-020-70468-2
Figure Lengend Snippet: Mouse SR-B1 poorly supports P. berghei sporozoite invasion. (A,B) CD81KOH16 cells were transfected with either mouse or human SR-B1 plasmids, or no plasmid as a control (Mock). Total protein expression was analyzed using polyclonal anti-SR-B1 antibodies (Ab24603) by western blot (A) with GAPDH as a loading control. Surface protein expression was analyzed by flow cytometry (B) using anti-human “αH” SR-B1 polyclonal rabbit serum (blue) and anti-mouse “αM” polyclonal antibodies NB400-113 (orange). The grey histogram represents untransfected cells labeled with the corresponding antibody. (C,D) CD81KOH16 (C) and WT Hepa1-6 cells treated with siRNA against CD81 24 h before (D) , were transfected with mouse or human SR-B1 plasmids, or no plasmid as a negative control (Mock), and then infected with PbGFP sporozoites. EEF numbers were counted by microscopy after UIS4 staining, 24 h after sporozoite addition. The mean control values for each experiment were 59, 139, 214, 245, 299, 315 and 383 EEFs/well in hSR-B1-transfected CD81KOH16 cells (C) , and 30, 140, 155 and 215 EEFs/well in control Hepa1-6 cells (D) . * p < 0.05; ** p < 0.01 (repeated measures one-way ANOVA followed by Tukey’s multiple comparisons test).
Article Snippet: Cells were transfected with 500 ng of LentiCrispR V2 (
Techniques: Transfection, Plasmid Preparation, Control, Expressing, Western Blot, Flow Cytometry, Labeling, Negative Control, Infection, Microscopy, Staining
Journal: The Journal of Cell Biology
Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development
doi: 10.1083/jcb.201707055
Figure Lengend Snippet: Talin binding to the β7 cytoplasmic domain activates integrin α4β7. (A) Expression of talin and β7 in parental or talin KO β7-expressing Jurkat T cells. Top: Total expression by Western blot. Bottom: Surface expression by flow cytometry. The filled histograms represent untransfected Jurkat cells, whereas open histograms represent β7-expressing Jurkat cells or talin KO cells. (B) Binding of soluble MAdCAM-1 to β7 expressing Jurkat T cells or talin KO cells. PMA (100 nM) markedly increased binding to parental but not talin KO cells. Mn 2+ (0.5 mM) stimulated binding to both cell types. Stimulated cells were compared with resting (None) for each cell line using one-way ANOVA. (C) Adhesion of β7-expressing Jurkat T cells or Jurkat-talin KO cells to MAdCAM-1 substrate in the presence or absence of PMA (100 nM) under a wall shear stress of 2 dyn/cm 2 . Nontransfected Jurkat T cells (Jurkat) provided a negative control. Jurkat-β7-Talin KO or Jurkat were compared with the Jurkat-β7 for each condition using one-way ANOVA. (D) Structural model of the talin F3 domain in complex with integrin β7 tail (Arg 728 to Thr 766 ). Talin F3 domain is shown by a surface representation and colored by charge. A ribbon diagram of the docked β7 tail is highlighted in red. β7-Leu 758 and -Tyr 759 in the NPLY motif are shown as light blue–colored stick figures. (E) Soluble MAdCAM-1 binding to 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection. Mn 2+ (0.5 mM) was used as a positive control for integrin activation. Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (F) Adhesion of 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (G) Binding of soluble MAdCAM-1 to 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A). THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using two-way ANOVA. MFI, mean fluorescent intensity. (H) Adhesion of 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A) on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . 293T cells transfected with THD only and nontransfected 293T cells (MOCK) were used as negative controls. THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using one-way ANOVA. Error bars show means ± SD. n = 5. NS, P > 0.05; *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001.
Article Snippet: Mouse β7 and
Techniques: Binding Assay, Expressing, Western Blot, Flow Cytometry, Shear, Negative Control, Transfection, Mutagenesis, Cotransfection, Positive Control, Activation Assay, Plasmid Preparation, Control
Journal: The Journal of Cell Biology
Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development
doi: 10.1083/jcb.201707055
Figure Lengend Snippet: Blocking talin-induced change in β7 TMD topology abolished α4β7 activation. (A) Sequence alignment of partial TMDs of integrin β3 and β7 subunits. β3 Pro mutant site Ala 711 is highlighted in red. The sites in β7 that were mutated to Pro (Leu 721 and Leu 723 ) are highlighted in green and Gly 722 is highlighted in pink and are projected onto a homology model of the α4β7 TMD (α4 in blue and β7 in red). (B) Adhesion of 293T cells transfected with β7 WT or mutations (L721P, G722P, or L723P) plus α4 on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . Nontransfected 293T cells (MOCK) were used as a negative control (Ctrl). Mutant integrins were compared with the WT using one-way ANOVA. (C) Binding of soluble MAdCAM-1 to 293T cells transfected with WT α4β7 or α4 in combination with mutants (L721P, G722P, and L723P) in the presence or absence of THD. Nontransfected 293T cells (MOCK) were used as a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. Error bars show means ± SD. n = 5 (A and B) or 4 (C). *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001. MFI, mean fluorescence intensity. (D) Coimmunoprecipitation of THD with α4β7 WT or mutants. Lysates of 293T cells were transfected as in C, in combination with THD-GFP, and α4β7 was isolated by immunoprecipitation (IP). Precipitated proteins were analyzed by Western blotting with the indicated antibodies and confirmed similar THD association with the mutant and WT integrins. Data are representative of at least three independent experiments. Note that a shorter exposure time was used for the THD input. Molecular masses are given in kilodaltons. (E) A model of how a Pro mutation can prevent transmission of altered topology of the β7 TMD by talin. The complex formed between the β7 cytoplasmic tail/TMD (red) and cytoplasmic talin F3 domain (surface representation; colored by charge) alters the topology of the inner portion of the transmembrane helix, which is transmitted to the outer moiety, where it can disrupt the outer membrane clasp , resulting in destabilization of the α-β TMD complex and integrin activation. β7(L721P) breaks the TMD helix into two helices connected by a flexible kink; the flexible kink prevents transmission of the talin-induced change in intracellular TMD topology to stabilize the α-β TMD interaction and block talin-induced activation of integrin α4β7.
Article Snippet: Mouse β7 and
Techniques: Blocking Assay, Activation Assay, Sequencing, Mutagenesis, Transfection, Shear, Negative Control, Binding Assay, Fluorescence, Isolation, Immunoprecipitation, Western Blot, Transmission Assay, Membrane
Journal: The Journal of Cell Biology
Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development
doi: 10.1083/jcb.201707055
Figure Lengend Snippet: Inhibiting talin-induced change in β7 TMD topology impairs agonist-induced α4β7 activation. (A) Binding of soluble MAdCAM-1 to Jurkat T cells stably expressing WT or mutant β7(L721P or L723P) with or without CXCL12 or PMA stimulation. Mutant integrins were compared with the WT for each condition using one-way ANOVA. Error bars show means ± SD. n = 5. NS, P > 0.05; **, 0.001 < P < 0.01; ***, P < 0.001. MFI, mean fluorescence intensity. (B) β7 cell surface expression on Jurkat T cells stably expressing WT or mutant β7(L721P or L723P). Mock-transfected cells are depicted in the filled histograms. (C) α4β7 was immunoprecipitated (IP) from lysates of CXCL12-stimulated cells or unstimulated cells depicted in A, and bound proteins were analyzed by Western blotting with the indicated antibodies. Data are representative of at least three independent experiments. Molecular masses are given in kilodaltons.
Article Snippet: Mouse β7 and
Techniques: Activation Assay, Binding Assay, Stable Transfection, Expressing, Mutagenesis, Fluorescence, Transfection, Immunoprecipitation, Western Blot
Journal: The Journal of Cell Biology
Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development
doi: 10.1083/jcb.201707055
Figure Lengend Snippet: Suppressing talin-induced change in β7 TMD topology perturbed mouse lymphocyte homing to the gut. (A) Cell surface expression of α4β7 in TK1-β7 KO cells stably expressing WT β7 or mutant β7(L721P). (B) Binding of soluble mouse MAdCAM-1 to the cells shown in A with or without CXCL12 stimulation. The TK1-β7 KO cell was used as a negative control. Stimulated cells were compared with resting (None) for each cell line using one-way ANOVA. MFI, mean fluorescence intensity. (C and D) In vivo competitive homing of TK1-β7 KO cells that stably express WT β7(β7 WT) or proline mutant β7(β7[L721P]) to different lymphoid tissues. TK1-β7 WT or TK1-β7(L721P) cells were labeled with eFluor 670. TK1 parental (TK1) cells were labeled with CFSE as an input control. Equal numbers (2 × 10 7 ) of eFluor 670–labeled cells and CFSE-labeled cells were mixed and then intravenously injected into C57BL/6J mice. Lymphoid organs were isolated 2 h after injection. The eFluor 670– or CFSE-labeled cells that homed into different lymphoid organs were enumerated by flow cytometry. The total numbers of homed cells to different lymphoid organs are shown in C. MLN (per mouse), PP (per mouse), PLN (per lymph node), and SP (per mouse). The ratio of TK1 parental cells to TK1-KO cells reconstituted with β7 WT or β7(L721P) cells recovered from different lymphoid organs is shown in D. Error bars show means ± SD. n = 5 (A and B) or 24 (C and D). NS, P > 0.05; **, 0.001 < P < 0.01; ***, P < 0.001.
Article Snippet: Mouse β7 and
Techniques: Expressing, Stable Transfection, Mutagenesis, Binding Assay, Negative Control, Fluorescence, In Vivo, Labeling, Control, Injection, Isolation, Flow Cytometry
Journal: The Journal of Cell Biology
Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development
doi: 10.1083/jcb.201707055
Figure Lengend Snippet: Disruption of GALT development in Itgb7 L720P/L720P mice. (A) Schematic of the Cas9/sgRNA-targeting sites in Itgb7 . The sgRNA-targeting sequences are underlined in blue, and the protospacer-adjacent motif (PAM) sequence is labeled in blue in the WT sequence. The MaeI restriction site removed from the WT and ApaI site introduced in the mutant are labeled as are the Leu codon changed to Pro. (B) Sequencing analysis of WT and β7(L720P) knock-in mice. DNA sequencing confirmed a leucine to proline substitution at position 720 of the mouse β7 integrin gene (position 721 in human β7 integrin gene). The mutation is labeled in red. The silent mutations are labeled in green and with green asterisks. (C) The absolute number of CD3 + T cells and B220 + B cells isolated from Itgb7 WT/WT mice and Itgb7 WT/L720P , or Itgb7 L720P/L720P littermates are shown. Error bars show means ± SD. n = 8. NS, P > 0.05; ***, P < 0.001.
Article Snippet: Mouse β7 and
Techniques: Disruption, Sequencing, Labeling, Mutagenesis, Knock-In, DNA Sequencing, Isolation
Journal: The Journal of Cell Biology
Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development
doi: 10.1083/jcb.201707055
Figure Lengend Snippet: Itgb7 L720P/L720P adult mice have reduced gut-tropic β7 high effector/activated T cells. (A) Equivalent cell surface expression of integrin αL, α4, β1, β2, and β7 and intracellular expression of kindlin 3 and talin in neonatal Itgb7 WT/WT mice and Itgb7 L720P/L720P littermates are shown. (B) Cell surface expression of β7 is reduced in 8-wk-old Itgb7 L720P/L720P compared with Itgb7 WT/WT littermates. (C) The ratio of cell surface expression of integrin β7 on effector/activated T cells (CD62L low CD44 high ) compared with naive T cells (CD62L high CD44 low ) in 8-wk-old Itgb7 WT/WT mice and Itgb7 L720P/L720P littermates. Mean fluorescence intensities are displayed on the representative histograms. Error bars show means ± SD. **, 0.001 < P < 0.01. Teff, effector T cells.
Article Snippet: Mouse β7 and
Techniques: Expressing, Fluorescence
Journal: Investigative ophthalmology & visual science
Article Title: Ecel1 Knockdown With an AAV2-Mediated CRISPR/Cas9 System Promotes Optic Nerve Damage-Induced RGC Death in the Mouse Retina.
doi: 10.1167/iovs.18-23784
Figure Lengend Snippet: FIGURE 2. Optic nerve crush strongly induced Ecel1 expression in the retinas of the mice. (A) qRT-PCR was performed to analyze the Ecel1 mRNA expression level, normalized to Gapdh mRNA (n ¼ 7–11 each group). (B) The protein level of Ecel1 in the retinas was examined with an immunoblot analysis. Beta actin was used as an internal control. (C) Retinal protein was immunolabeled with anti-Ecel1 with or without a blocking peptide. (D) Immunohistochemistry showed that Ecel1 was absent from the retinas of mice that underwent a sham operation, while Ecel1 protein was abundantly expressed in the GCL on day 4 after optic nerve crush. (E) Ecel1 protein was strikingly localized in the mouse GCL on day 4 after optic nerve crush and not in the other cell layers. (F) Histogram showing the number of Ecel1-positive cells in the GCL 4 days after optic nerve crush (n ¼ 4 each group). (G) Immunoreaction for Ecel1 was colocalized with RBPMS, a marker of the RGCs. Error bars denote standard deviation. NC, nerve crush. **P < 0.01, ***P < 0.001. Scale bar: 20 lm.
Article Snippet: To construct adeno-associated virus (AAV) plasmids expressing Staphylococcus aureus Cas9 and single guide RNA sequences under control of the CMV and U6 promoters, respectively, doublestrand DNA oligonucleotides corresponding to the designed guide RNA sequences were inserted into a BsaI recognition site, as follows: pX601-AAV-CMV::NLS-SaCas9-NLS-3xHAbGHpA;U6::BsaI-sgRNA (pX601; a gift from Feng Zhang;
Techniques: Expressing, Quantitative RT-PCR, Western Blot, Control, Immunolabeling, Blocking Assay, Immunohistochemistry, Marker, Standard Deviation
Journal: Investigative ophthalmology & visual science
Article Title: Ecel1 Knockdown With an AAV2-Mediated CRISPR/Cas9 System Promotes Optic Nerve Damage-Induced RGC Death in the Mouse Retina.
doi: 10.1167/iovs.18-23784
Figure Lengend Snippet: FIGURE 3. Ecel1 expression was strongly induced in damaged RGCs treated with vinblastine but not in those treated with NMDA. Relative expression levels of Thy-1.2 (A), Rbpms (B), and Ecel1 (C) in vinblastine-treated retinas, and Thy1 (D), Rbpms (E), and Ecel1 (F) in NMDA-treated retinas, were determined with quantitative RT-PCR and normalized to the Gapdh level. Error bars denote SD (vinblastine; n¼7–8, NMDA; n¼6–10 for each group at each time point). Vin, vinblastine. *P < 0.05, **P < 0.01, ***P < 0.001.
Article Snippet: To construct adeno-associated virus (AAV) plasmids expressing Staphylococcus aureus Cas9 and single guide RNA sequences under control of the CMV and U6 promoters, respectively, doublestrand DNA oligonucleotides corresponding to the designed guide RNA sequences were inserted into a BsaI recognition site, as follows: pX601-AAV-CMV::NLS-SaCas9-NLS-3xHAbGHpA;U6::BsaI-sgRNA (pX601; a gift from Feng Zhang;
Techniques: Expressing, Quantitative RT-PCR
Journal: Investigative ophthalmology & visual science
Article Title: Ecel1 Knockdown With an AAV2-Mediated CRISPR/Cas9 System Promotes Optic Nerve Damage-Induced RGC Death in the Mouse Retina.
doi: 10.1167/iovs.18-23784
Figure Lengend Snippet: FIGURE 4. Ecel1 knockdown with the CRISPR/Cas9 system promoted RGC loss after optic nerve crush. (A) Structure of the mouse Ecel1 gene; the 2nd exon is magnified. The mouse Ecel1 gene has 18 exons and 17 introns. The translation start codon (ATG) is located on the second exon. The guide RNA sequences for Ecel1 and for CFP as a control are shown in the box. (B) T7 Endonuclease 1 (T7E1) assay revealing genome editing at the Ecel1 locus in sorted mCherry-expressing cells from AAV2-mCherry and AAV2-CRISPR/Cas9-injected retinas. Asterisks indicated indel formation. (C) Mutation pattern sequencing of Ecel1 locus. (D) Immunoblotting with an anti-Ecel1 antibody in retinas injected with AAV2-CRISPR/Cas9 4 days after optic nerve crush. (E) Quantification of Ecel1 protein levels normalized with b-actin in (D) (n ¼ 3 each). (F) Immunostaining images for Ecel1 with AAV2-CRISPR/Cas9-Ecel1 treatment 4 days after optic nerve crush. (G) Histogram showing the number of Ecel1-positive cells in the GCL 4 days after optic nerve crush and treatment with AAV2-CRISPR/Cas9. (H) Representative images of FG-labeled RGCs 7 days after optic nerve crush in mice
Article Snippet: To construct adeno-associated virus (AAV) plasmids expressing Staphylococcus aureus Cas9 and single guide RNA sequences under control of the CMV and U6 promoters, respectively, doublestrand DNA oligonucleotides corresponding to the designed guide RNA sequences were inserted into a BsaI recognition site, as follows: pX601-AAV-CMV::NLS-SaCas9-NLS-3xHAbGHpA;U6::BsaI-sgRNA (pX601; a gift from Feng Zhang;
Techniques: Knockdown, CRISPR, Control, Expressing, Injection, Mutagenesis, Sequencing, Western Blot, Immunostaining, Labeling
Journal: bioRxiv
Article Title: A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteins
doi: 10.1101/2020.08.10.245076
Figure Lengend Snippet: Deletion of ORC5 in HCT116 p53-/-cells. A ) CRISPR/Cas9 biallelic targeting strategy for ORC5. ORC5 sgRNA target first methionine located upstream of Walker A motif. Second methionine locates at 133 aa. B ) DNA sequences of wild type ORC5 exon1 and three ORC5Δ clones obtained from genomic sequencing and by sequencing of cDNA. First methionine site is mutated in both allele of mutant clones. C ) Verification of ORC5 antibody. Recombinant ORC5 protein with Myc tag were expressed and blotted with indicated antibodies. Ponceau S staining shows equal loading of lysate. D ) Western blot of ORC5 in the ORC5Δ clones shows that full length and truncated ORC5 proteins are undetectable.
Article Snippet:
Techniques: CRISPR, Clone Assay, Genomic Sequencing, Sequencing, Mutagenesis, Recombinant, Staining, Western Blot
Journal: bioRxiv
Article Title: A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteins
doi: 10.1101/2020.08.10.245076
Figure Lengend Snippet: ORC protein in ORC5Δ cell lines. A ) Quantitative Western blot for ORC5 shows that 6 μg of WT cell lysate contains enough ORC5 protein to be detected, yet 120 μg of lysate from ORC5Δ clones do not give a signal. So any undetectable ORC5 protein remaining in ORC5Δ cells is at <5% WT levels. Lane 2: Lysate from cells where ORC5 has been knocked down by siRNA shows the specificity of the anti-ORC5 antibody. GL2: negative control siRNA. B ) Comparison of Coomassie Brilliant Blue staining of BSA and recombinant purified His-ORC5-AIM2PYD to show that the full length ORC5 protein (top band in recombinant ORC5 lane) is at 200 ng/μl. C ) Immunoblot of HCT116 cell lysate with the top band of recombinant ORC5 to show that 5×10e5 WT cells give an ORC5 signal equal to 2.5 ng of recombinant ORC5, which corresponds to 240×10e8 molecules of ORC5. D ) Immunoblot of indicated proteins in cell lysates of the WT and ORC5Δ clones. E ) Immunoblot of soluble and chromatin-associated proteins in the WT and ORC5Δ clones.
Article Snippet:
Techniques: Western Blot, Clone Assay, Negative Control, Comparison, Staining, Recombinant, Purification
Journal: bioRxiv
Article Title: A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteins
doi: 10.1101/2020.08.10.245076
Figure Lengend Snippet: Cell proliferation in the ORC5Δ cell lines. A ) Immunoprecipitation of ORC3 shows the co-precipitation of ORC2 in the ORC5Δ cells. C is control antibody. B ) Cell growth of indicated clones over 5 days, expressed as MTT absorbance relative to the level at day 1. (Mean ± S.D.; n = 3 biological replicates). C ) Cell cycle profile of propidium-iodide stained cell from indicated clones. D ) Immunoblot of G2 checkpoint proteins in the WT and ORC5Δ clones. The numbers below each total protein were the ratio of phosphorylated protein and total protein.
Article Snippet:
Techniques: Immunoprecipitation, Control, Clone Assay, Staining, Western Blot
Journal: bioRxiv
Article Title: A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteins
doi: 10.1101/2020.08.10.245076
Figure Lengend Snippet: The duration of S phase in the ORC5Δ or ORC2+ORC5Δ clones. Early S phase arrested cells were released into nocodazole containing medium and collected at indicated time to measure the rate of S phase progression by propidium iodide FACS. AS: asynchronous cells. The red dotted lines indicate cell with 2N and 4N DNA content.
Article Snippet:
Techniques: Clone Assay
Journal: bioRxiv
Article Title: A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteins
doi: 10.1101/2020.08.10.245076
Figure Lengend Snippet: DNA replication in the ORC5Δ cell lines. A ) Asynchronous cells were labeled with BrdU for 30 min. % of BrdU labeled cells were measured by two color FACS (P value < 0.01, two-sided t-test, Mean ± S.D. n = 3 biological replicates). B ) Representative DNA combing images showing bi-directional origin firing in ORC5Δ or ORC2 + ORC5Δ clones. DNA combing after a pulse labeling with IdU for 30 min followed by CldU for 30 min. C ) Box and whisker plot for inter-origin distance (Left) and fork progression speed (Right) in DNA combing assays. NS: No significant difference between WT and ORC5Δ cells in two-sided Mann-Whitney U Test. N=number of tracks counted.
Article Snippet:
Techniques: Labeling, Clone Assay, Whisker Assay, MANN-WHITNEY
Journal: bioRxiv
Article Title: A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteins
doi: 10.1101/2020.08.10.245076
Figure Lengend Snippet: Simultaneous deletion of ORC2 and ORC5 in HCT116 p53-/-cells. A ) Western blot of ORC2 and ORC5 in the ORC2+ORC5Δ clones. B ) DNA sequences of ORC2 exon 4 show biallelic frame-shift mutation of ORC2 in the ORC2+ORC5Δ clones. C ) Immunoblot of soluble and chromatin-associated proteins in the ORC2+ORC5Δ clones.
Article Snippet:
Techniques: Western Blot, Clone Assay, Mutagenesis
Journal: bioRxiv
Article Title: A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteins
doi: 10.1101/2020.08.10.245076
Figure Lengend Snippet: Cell proliferation and DNA replication in the ORC2 + ORC5Δ cell lines. A ) Cell growth of indicated clones over 4 days, expressed as MTT absorbance. (Mean ± S.D.; n = 3 biological replicates). B ) Cell cycle profile of propidium-iodide stained cells from indicated clones. C ) DNA combing after a pulse labeling with IdU for 30 min followed by CldU for 30 min. Box and whisker plot for inter-origin distance (Left) and fork progression speed (Right) (****P<0.00001 between WT and ORC2 + ORC5Δ clones in two-sided Mann-Whitney U Test; N=number of tracks counted.).
Article Snippet:
Techniques: Clone Assay, Staining, Labeling, Whisker Assay, MANN-WHITNEY
Journal: Theranostics
Article Title: The gRNA-miRNA-gRNA Ternary Cassette Combining CRISPR/Cas9 with RNAi Approach Strongly Inhibits Hepatitis B Virus Replication
doi: 10.7150/thno.18114
Figure Lengend Snippet: The effect of anti-HBV pri-miR-31-mimic flanking sequence in ternary cassette. ( A ) A dual-luciferase assay was conducted to detect the production of functional miR-HBV from gRNA3-miR-HBV-gRNA2 cassettes with different lengths of anti-HBV pri-miR-31 mimic in HuH7 cells co-transfected with pGL3-HBV (1575-1604) or pGL3-control, PRL-TK and each of the plasmids containing gRNA3-miR-HBV-gRNA2 cassettes with different length of anti-HBV pri-miR-31 mimics. The vectors pGL3-control and PRL-TK were used as negative control and internal control, respectively. Data was shown as mean±SD of 4 independent experiments. ( B ) A polyA tailing reaction and a quantitative reverse transcription-PCR (qRT-PCR) were conducted to detect the production of mature miR-HBV in HuH7 cells transfected with the plasmids containing gRNA3-miR-HBV-gRNA2 cassettes with different length of anti-HBV pri-miR-31 mimics. ( C ) Schematic illustration of gRNA-gRNA binary cassette. ( D ) The expression plasmid of 1.2×HBV was co-transfected with the expression plasmid containing 3-2 binary cassette or gRNA3-miR-HBV-gRNA2 ternary cassette with different length of anti-HBV pri-miR-31 mimic flanking sequence in HuH7 cells at the ratio of 3:1 and 1:3. HBsAg levels in the cell culture supernatant were measured using a time-resolved fluoroimmunoassay at 72 hours after transfection. Data was shown as mean±SD of 5 independent experiments. (* indicated P <0.05, Mann-Whitney U test). PX458 plasmid was used as a vector control. 5S rRNA was used as the internal control.
Article Snippet: The
Techniques: Sequencing, Luciferase, Functional Assay, Transfection, Control, Negative Control, Reverse Transcription, Quantitative RT-PCR, Expressing, Plasmid Preparation, Cell Culture, MANN-WHITNEY
Journal: Theranostics
Article Title: The gRNA-miRNA-gRNA Ternary Cassette Combining CRISPR/Cas9 with RNAi Approach Strongly Inhibits Hepatitis B Virus Replication
doi: 10.7150/thno.18114
Figure Lengend Snippet: The function of miR-HBV in gRNA-miR-HBV-gRNA ternary cassettes. ( A ) A dual-luciferase assay was conducted to analyze the effect of 3-M38-2 ternary cassette in the target sequence of miR-HBV. The 3-M38-2 ternary cassette was used as a positive control. Data was shown as mean±SD of 5 independent experiments. ( B ) The expression plasmids of 1.2×HBV (genotype C) and miR-HBV or mutant miR-HBV (miR-HBVm) were co-transfected into HuH7 cells. The HBsAg levels in the cell and culture supernatant of HuH7 cells were measured using a time-resolved fluoroimmunoassay at 48 hours after transfection. Data was shown as mean±SD of 4 independent experiments. ( C ) The expression plasmids of 1.2×HBV and 3-2 binary cassette, 3-M38-3 or 3-H38-2 ternary cassette were co-transfected into HuH7 cells. The levels of HBsAg and HBeAg in the culture supernatant were measured using a time-resolved fluoroimmunoassay at 72 hours after transfection. Data was shown as mean±SD of 5 independent experiments. (D) The level of gRNA2 in the HuH7 cells transfected with the expression plasmid of vector control, 3-2 binary or 3-H38-2 ternary cassette was detected by qRT-PCR (SYBR Green). The level of (E) gRNA3 carrying flanking sequence of anti-HBV pri-miR-31 mimic and (F) mature miRNA (miR-HBV or mutant miR-HBV) in the HuH7 cells transfected with the expression plasmid of vector control, 3-2 binary or 3-H38-2 ternary cassette was detected by qRT-PCR (SYBR Green). Data was shown as mean±SD of 4 independent experiments. (** indicated P <0.01, ***indicated P <0.001, Mann-Whitney U test). PX458 plasmid was used as a vector control.
Article Snippet: The
Techniques: Luciferase, Sequencing, Positive Control, Expressing, Mutagenesis, Transfection, Plasmid Preparation, Control, Quantitative RT-PCR, SYBR Green Assay, MANN-WHITNEY
Journal: Theranostics
Article Title: The gRNA-miRNA-gRNA Ternary Cassette Combining CRISPR/Cas9 with RNAi Approach Strongly Inhibits Hepatitis B Virus Replication
doi: 10.7150/thno.18114
Figure Lengend Snippet: The efficiency of gRNA-miR-HBV-gRNA ternary cassettes in suppressing HBV replication. The expression plasmids of each genotype (A, B or C) HBV and 3-H38-2 or 4-H38-1 cassette were co-transfected into HuH7 cells, and the levels of HBsAg ( A ) and HBeAg ( B ) in the cell culture supernatant or cells were measured using a time-resolved fluoroimmunoassay at 72 hours after transfection. Data was shown as mean±SD of 5 independent experiments. ( C ) The level of HBcAg in the HuH7 cells co-transfected with the expression plasmids of each genotype (A, B or C) HBV and 3-H38-2 or 4-H38-1 cassette were measured by Western Blot. The right figures were the statistical graphs of Western Blot, which was analyzed by Image J software (NIH, Bethesda, USA) at least in triplicate. HBc: HBcAg. PX458 plasmid was used as a vector control. (** indicated P<0.01, ***indicated P<0.001, Mann-Whitney U test).
Article Snippet: The
Techniques: Expressing, Transfection, Cell Culture, Western Blot, Software, Plasmid Preparation, Control, MANN-WHITNEY
Journal: Theranostics
Article Title: The gRNA-miRNA-gRNA Ternary Cassette Combining CRISPR/Cas9 with RNAi Approach Strongly Inhibits Hepatitis B Virus Replication
doi: 10.7150/thno.18114
Figure Lengend Snippet: Detection on the HBV-specific gRNAs-mediated destruction of HBV genome. ( A ) The expression plasmids of 1.2×HBV and 3-2 binary, 3-M38-2, 3-H38-2 or 4-H38-1 ( B ) ternary cassette were co-transfected into HuH7 cells. Cellular DNA was extracted at 72 hours after transfection, and PCR amplifications were performed using the primers beyond the cleavage sites of two gRNAs. ( C ) Sequencing analysis of the smaller fragment cleft by gRNA2 and 3. ( D ) Sequencing analysis of the smaller fragment cleft by gRNA1 and 4. PX458 plasmid was used as a vector control.
Article Snippet: The
Techniques: Expressing, Transfection, Sequencing, Plasmid Preparation, Control
Journal: Theranostics
Article Title: The gRNA-miRNA-gRNA Ternary Cassette Combining CRISPR/Cas9 with RNAi Approach Strongly Inhibits Hepatitis B Virus Replication
doi: 10.7150/thno.18114
Figure Lengend Snippet: Detection on the HBV-specific gRNAs-mediated destruction of HBV cccDNA. ( A ) HepAD38 cells were seeded into 10 cm dish. The expression plasmid of gRNA3-RNA2 binary or gRNA-miRNA-gRNA ternary cassette was co-transfected into HepAD38 cells. Transfection efficiency of HepAD38 cells was evaluated by observing the enhanced green fluorescent protein (EGFP) expressing cells under immunofluorescence microscopy. ( B ) HBsAg and HBeAg levels in the cell culture supernatant of HepAD38 cells were measured using a time-resolved fluoroimmunoassay. Data was shown as mean±SD of 6 independent experiments. ( C ) HBsAg levels in the cell culture supernatant of HepG2-NTCP-tet cells were measured using a time-resolved fluoroimmunoassay. Data was shown as mean±SD of 5 independent experiments. ( D ) HBV cccDNA levels in EGFP positive HepAD38 cells selected by Flow cytometry were measured using a KCl precipitation, plasmid-safe ATP-dependent DNase (PSAD) digestion, rolling circle amplification and quantitative PCR (SYBR green) combined method. Data was shown as mean±SD of 4 independent experiments. ( E ) PCR amplification of cccDNA was performed using the primers beyond the cleavage sites of two gRNAs following above rolling circle amplification. HepAD38 cells were transfected with 3-2 binary cassette expression plasmid, and then treated with or without lamivudine (3TC). The HBV DNA levels ( F ) in HepAD38 cells were detected by quantitative PCR, and HBV cccDNA levels ( G ) in EGFP positive HepAD38 cells selected by Flow cytometry were measured as above. Data was shown as mean±SD of 4 independent experiments. (* indicated P <0.05, ** indicated P <0.01, Mann-Whitney U test). PX458 plasmid was used as a vector control.
Article Snippet: The
Techniques: Expressing, Plasmid Preparation, Transfection, Immunofluorescence, Microscopy, Cell Culture, Flow Cytometry, Amplification, Real-time Polymerase Chain Reaction, SYBR Green Assay, MANN-WHITNEY, Control
Journal: EMBO Reports
Article Title: Structural basis for Mis18 complex assembly and its implications for centromere maintenance
doi: 10.1038/s44319-024-00183-w
Figure Lengend Snippet: ( A ) Diagram of proteins involved in CENP-A deposition at the centromere. The Mis18 complex (Mis18BP1 (salmon), Mis18α (purple) and Mis18β (light pink)) forms once Cdk1 activity is reduced. It interacts with CCAN/CENP-C (green) to localise to the centromere, where Plk1 regulation helps promote the recruitment of HJURP (Blue), a CENP-A chaperone. ( B ) Schematic representation of structural features of Mis18BP1 (salmon), Mis18α (purple) and Mis18β (light pink). Filled boxes represent folded domains. SANTA and SANT domain boundaries as defined in UniProt (Q6P0N0). ( C ) Cartoon representation of the crystal structure of human Mis18α Yippee homodimer (PDB ID: 7SFZ ). ( D ) Cartoon representation of the human Mis18α Yippee /Mis18β Yippee heterodimer modelled by homology to the structure in Fig. 1C. Mis18α is shown in purple and Mis18β in light pink (modelled using Phyre2, www.sbg.bio.ic.ac.uk/phyre2/ (Kelley et al, )). ( E ) Cartoon representation of the crystal structure of Mis18α C-term /Mis18β C-term (PDB ID: 7SFY ). Mis18α is shown in purple and Mis18β in light pink. ( F ) Mis18α C-term domains are shown in surface representation and coloured based on electrostatic surface potential calculated using APBS (Baker et al, ). Mis18β C-term shown as cartoon.
Article Snippet: The boundaries of ΔN for
Techniques: Activity Assay
Journal: EMBO Reports
Article Title: Structural basis for Mis18 complex assembly and its implications for centromere maintenance
doi: 10.1038/s44319-024-00183-w
Figure Lengend Snippet: ( A , B ) Domain architecture and amino acid conservation of ( A ) Mis18α and ( B ) Mis18β. Alignments include Homo sapiens ( hs ), Bos taurus ( bt ), Mus musculus ( mm ) and Gallus gallus ( gg ). The conservation score is mapped from red to cyan, where red corresponds to highly conserved and cyan to poorly conserved. Secondary structures as annotated/predicted by Conserved Domain Database [CDD] and PsiPred, http://bioinf.cs.ucl.ac.uk/psipred . Multiple sequence alignments were performed with MUSCLE (Madeira et al, ) and edited with Aline (Bond and Schüttelkopf, ). Dashed boxes highlight Yippee domains whilst solid boxes highlight C-terminus α-helices. ( C ) Superposition of Mis18β Yippee structures predicted by AlphaFold (light pink) and RaptorX (green). RaptorX generated five models and the model with the lowest estimated error (1.9 Å) is shown here. The AlphaFold and RaptorX models superpose well with an RMSD of 0.95 Å. ( D ) The PAE plot corresponding to the Mis18α/β Yippee AlphaFold model shown in Fig. .
Article Snippet: The boundaries of ΔN for
Techniques: Sequencing, Generated
Journal: EMBO Reports
Article Title: Structural basis for Mis18 complex assembly and its implications for centromere maintenance
doi: 10.1038/s44319-024-00183-w
Figure Lengend Snippet: ( A ) Representative micrograph of negative staining EM of the Mis18α/Mis18β/Mis18BP1 20-130 (Mis18 core ) complex cross-linked using GraFix (Kastner et al, ; Stark, ). Beneath is the corresponding SDS-PAGE analysis of fractions from GraFix, fractions 8 and 9 were used to make grids. ( B ) Two models (Class II-III) generated for Mis18 core from negative staining EM analysis. All show that the overall shapes of the Mis18 core resemble a telephone handset with ‘ear’ and ‘mouth’ pieces assuming different relative orientations. ( C ) Cartoon representation of the model of Mis18 core complex generated in Fig. . Zoomed in panel shows interaction between Mis18α and Mis18β Yippee domains using the second interface. Important residues for this interaction highlighted in pink and purple. ( D ) SEC profile of Mis18α WT /Mis18β WT (red) and Mis18α C154R/D160R /Mis18β WT (black) and corresponding SDS-PAGE analysis of the fractions. Samples were analysed using Superdex 200 increase 10/300 in 20 mM Tris-HCl pH 8.0, 250 mM NaCl and 2 mM DTT.
Article Snippet: The boundaries of ΔN for
Techniques: Negative Staining, SDS Page, Generated
Journal: EMBO Reports
Article Title: Structural basis for Mis18 complex assembly and its implications for centromere maintenance
doi: 10.1038/s44319-024-00183-w
Figure Lengend Snippet: ( A ) Linkage map showing the sequence position and cross-linked residue pairs between the different Mis18 core complex subunits, Mis18α, Mis18β and Mis18BP1 20-130 . Left panel highlights cross-linked residues between Mis18α and Mis18β. Black lines highlight cross-links between N-terminal α-helix of Mis18α and C-terminal helical regions of proteins. Right panel highlights cross-links observed between (i) Mis18BP1 20-130 and Mis18α (purple), (ii) Mis18BP1 20-130 and Mis18β (light pink), (iii) Mis18BP1 20-130 self cross-links (light grey). White boxes represent residual residues left over from tag cleavage. Dark boxes show Yippee domains and regions of α-helices. ( B ) Model of the Mis18 core complex generated using partial structures determined using X-ray crystallography and AlphaFold2 (Jumper et al, ) and cross-linking restrained molecular docking in EM maps. Mis18BP1 shown in salmon, Mis18α in purple and Mis18β in light pink. ( C ) Histograms show the percentage of satisfied or violated cross-links for structures modelled using MODELLER (Sali and Blundell, ). ( D ) Representative images of 2D classes from Mis18 core particles picked using CryoSPARC (Punjani et al, ). Scale bar shows 100 Å. ( E ) Model (Class I) generated for Mis18 core from negative staining EM analysis. This shows that the overall shapes of the Mis18 core resemble a telephone handset with ‘ear’ and ‘mouth’ pieces. Arrows denote the different orientations shown. ( F ) Theoretical SAXS scattering curves of Mis18α/β ΔN model compared to experimental data.
Article Snippet: The boundaries of ΔN for
Techniques: Sequencing, Residue, Generated, Negative Staining
Journal: EMBO Reports
Article Title: Structural basis for Mis18 complex assembly and its implications for centromere maintenance
doi: 10.1038/s44319-024-00183-w
Figure Lengend Snippet: ( A ) SAXS scattering curves of Mis18α/β ΔN, Mis18α/β and Mis18 core . ( B ) Guinier Plot showing Rg of 53 Å, 60 Å, and 63 Å for Mis18α/β ΔN, Mis18α/β and Mis18 core , respectively. ( C ) Modified Guinier Plot showing Rc of 26 Å, 30 Å, and 31 Å for Mis18α/β ΔN, Mis18α/β and Mis18 core , respectively. ( D ) SAXS P(r) distributions showing maximum dimensions of 190 Å, 215 Å, and 230 Å for Mis18α/β ΔN, Mis18α/β and Mis18 core , respectively.
Article Snippet: The boundaries of ΔN for
Techniques: Modification
Journal: EMBO Reports
Article Title: Structural basis for Mis18 complex assembly and its implications for centromere maintenance
doi: 10.1038/s44319-024-00183-w
Figure Lengend Snippet: ( A ) Cartoon representation of the crystal structure of Mis18α C-term /Mis18β C-term (PDB ID: 7SFY). Mis18α is shown in purple and Mis18β in light pink. Potential residues involved in the interaction are highlighted. Mis18α (purple) and Mis18β (light pink). Right panel shows SDS-PAGE analysis of cobalt and amylose pull-down of His-MBP-Mis18β 188–229 WT with His-SUMO-Mis18α 191–233 mutants. SDS-PAGE shows protein bound to nickel resin as input (I) and protein-bound to amylose resin to assess interaction (P). Control with WT proteins shown in Fig. . ( B ) Western blot analysis of co-immunoprecipitation (Co-IP) experiments using Mis18α antibody to test interaction of mCherry as a control, Mis18α−mCherry with and without mutations in the C-terminal α-helices and Mis18β-GFP. Top panel shows blot against mCherry, middle panel shows blot against GFP, and bottom panel shows blot against tubulin as loading control. ( C ) SEC-MALS of His-SUMO-Mis18α 188-233 WT , His-SUMO-Mis18α 188-233 I201A/L205A and His-SUMO-Mis18α 188-233 L212A/L215A/L219A . Normalised absorption at 280 nm (mAU, left y-axis) and molecular mass (kDa, right y-axis) are plotted against elution volume (ml, x-axis). Measured molecular weight (MW) and the calculated subunit stoichiometry based on the predicted MW. Samples were analysed using a Superdex 75 increase in 50 mM HEPES pH 8.0, 150 mM NaCl and 1 mM TCEP. ( D ) Representative immunoblots showing expression levels of endogenous proteins after treatment with siRNA. ( E ) Representative immunoblots showing expression levels of transiently expressed tagged proteins after transfection.
Article Snippet: The boundaries of ΔN for
Techniques: SDS Page, Control, Western Blot, Immunoprecipitation, Co-Immunoprecipitation Assay, Molecular Weight, Expressing, Transfection
Journal: EMBO Reports
Article Title: Structural basis for Mis18 complex assembly and its implications for centromere maintenance
doi: 10.1038/s44319-024-00183-w
Figure Lengend Snippet: ( A ) Representative fluorescence images (left panel) and quantification (right panel) assessing the ability of Mis18α WT -mCherry ( n = 1236), Mis18α I201A/L205A -mCherry ( n = 1368), Mis18α I201D/L205D -mCherry ( n = 1373) and Mis18α L212A/L215A/L219A- mCherry ( n = 1383) to co-localise with Mis18β-GFP at endogenous centromeres in HeLa (Mann–Whitney U test; **** P ≤ 0.0001). Cells were co-transfected with either control ( n = 944) or Mis18α siRNA (with no transfected Mis18α-mCherry n = 1572), as stated, in three independent experiments shown in black, blue and red. Error bars show mean ± SD. Scale bars, 10 μm. All conditions have been normalised to control conditions: cells transfected with control siRNA and Mis18α WT -mCherry. ( B ) Schematic representation of the experimental set-up used to evaluate the effect of Mis18α and Mis18β mutants on new CENP-A-SNAP loading. ( C ) Representative fluorescence images (left panel) and quantification (right panel) assessing the ability of Mis18α WT -mCherry ( n = 896), Mis18α I201A/L205A -mCherry ( n = 886), Mis18α I201D/L205D -mCherry ( n = 1434) and Mis18α L212A/L215A/L219A -mCherry ( n = 1188) to deposit new CENP-A-SNAP at endogenous centromeres (Mann–Whitney U test; **** P ≤ 0.0001). Cells were co-transfected with either control ( n = 852) or Mis18α siRNA (with no transfected Mis18α-mCherry n = 1736), as stated, in three independent experiments shown in black, blue and red. Error bars show mean ± SD. Scale bars, 10 μm. All conditions have been normalised to control conditions: cells transfected with control siRNA and Mis18α WT -mCherry. .
Article Snippet: The boundaries of ΔN for
Techniques: Fluorescence, MANN-WHITNEY, Transfection, Control
Journal: EMBO Reports
Article Title: Structural basis for Mis18 complex assembly and its implications for centromere maintenance
doi: 10.1038/s44319-024-00183-w
Figure Lengend Snippet: ( A ) Left panel shows SDS-PAGE analysis of cobalt and amylose pull-down of His-MBP-Mis18β 188–229 WT and mutants with His-SUMO-Mis18α 191–233 . SDS-PAGE shows protein bound to nickel resin as input (I) and protein bound to amylose resin to assess interaction (P). Right panel shows Western blot analysis of co-immunoprecipitation (Co-IP) experiments using Mis18α antibody to test interaction of Mis18α−mCherry and Mis18β-GFP with and without mutations in the C-terminal α-helices or GFP as a control. Top panel shows blot against mCherry, middle panel shows blot against GFP, and bottom panel shows blot against tubulin as loading control. ( B ) Representative fluorescence images (left panel) and quantification (right panel) used to evaluate the ability of Mis18β WT -GFP ( n = 963, 927) and Mis18β L199D/I203D -GFP ( n = 1312, 1221) to co-localise with mCherry-Mis18α at endogenous centromeres. Middle panel, quantification of Mis18β signal. Right panel, quantification of Mis18α signal (Mann–Whitney U test; **** P ≤ 0.0001). Cells were co-transfected with either control ( n = 1131, 935) or Mis18β siRNA (with no transfected Mis18β-GFP n = 1170), in three independent experiments shown in black, blue and red. Error bars show mean ± SD. ( C ) Representative fluorescence images (left panel) and quantification (right panel) used to evaluate the ability of Mis18β WT -GFP ( n = 1036) and Mis18β L199D/I203D GFP ( n = 947) to deposit new CENP-A-SNAP at endogenous centromeres (Mann–Whitney U test; **** P ≤ 0.0001). Cells were co-transfected with either control ( n = 840) or Mis18β siRNA (with no transfected Mis18β-GFP n = 824), as stated, in three independent experiments shown in black, blue and red. Error bars show mean ± SD. Scale bars, 10 μm. All conditions have been normalised to control conditions: cells transfected with control siRNA and Mis18β WT -GFP. .
Article Snippet: The boundaries of ΔN for
Techniques: SDS Page, Western Blot, Immunoprecipitation, Co-Immunoprecipitation Assay, Control, Fluorescence, MANN-WHITNEY, Transfection
Journal: EMBO Reports
Article Title: Structural basis for Mis18 complex assembly and its implications for centromere maintenance
doi: 10.1038/s44319-024-00183-w
Figure Lengend Snippet: ( A ) Mis18α/Mis18β model and its surface representation coloured based on electrostatic surface potential (zoom panel), highlighting the residues proposed to be involved in Mis18BP1 binding. Mis18α shown in purple, Mis18β shown in light pink and Mis18BP1 shown in salmon or grey for the zoom panel for clarity. ( B ) Representative images and quantification showing the recruitment of either Mis18BP1 20-130 -mCherry by different Mis18α constructs (WT and mutant) tethered to the alphoid tetO array in HeLa 3–8. Tethering of TetR-eYFP-Mis18α WT ( n = 45) and TetR-eYFP-Mis18α E103R/D104R/T105A ( n = 46) testing recruitment of Mis18BP1 20-130 mCherry (Mann–Whitney U test; **** P ≤ 0.0001). Data from three independent experiments shown in black, blue and red. Error bars show mean ± SD. Scale bars, 10 μm. ( C ) Representative fluorescence images (left panel) and quantifications (right panel) evaluating the ability of Mis18α WT -mCherry ( n = 985, 856) and Mis18α E103R/D104R/T105A ( n = 1497, 1511) to co-localise with GFP-Mis18BP1 at endogenous centromeres. Middle panel, quantification of Mis18α signal and right panel, quantification of Mis18BP1 signal (Mann–Whitney U test; *** P ≤ 0.001, **** P ≤ 0.0001). Cells were co-transfected with either control ( n = 1016, 1403) or Mis18α siRNA, as stated, in three independent experiments shown in black, blue and red. Error bars show mean ± SD. Scale bars, 10 μm. ( D ) Representative fluorescence images (left panel) and quantifications (right panel) evaluating the ability of Mis18α WT -mCherry ( n = 896) and Mis18α E103R/D104R/T105A ( n = 1430) to deposit new CENP-A-SNAP at endogenous centromeres (Mann–Whitney U test; **** P ≤ 0.0001). Cells were co-transfected with either control ( n = 852) or Mis18α siRNA, as stated, in three independent experiments shown in black, blue and red. Error bars show mean ± SD. Scale bars, 10 μm. All conditions have been normalised to control conditions: cells transfected with control siRNA and Mis18α WT -mCherry. .
Article Snippet: The boundaries of ΔN for
Techniques: Binding Assay, Construct, Mutagenesis, MANN-WHITNEY, Fluorescence, Transfection, Control
Journal: bioRxiv
Article Title: Genome-wide CRISPR screens identify noncanonical translation factor eIF2A as an enhancer of SARS-CoV-2 programmed –1 ribosomal frameshifting
doi: 10.1101/2023.01.23.525275
Figure Lengend Snippet: (A ) Schematic illustration of SARS-CoV-2 –1 PRF, showing the locations of ORF1a/1b in the genomic RNA (top) and the key components within FSE (bottom). ( B ) Schematic illustration of the procedure of fluorescent reporter-based genome-wide CRIPSR/Cas9 knock out screen. ( C,D,F,G ) Fold change and statistical significance of modifiers calculated with MAGeCK. Non-targeting negative control sgRNAs are indicated in dark gray. Top-ranking suppressors ( C, D ) and enhancers ( F, G ) are indicated in blue and red, respectively. See also , . ( E ) Validation of identified –1 PRF suppressors with Fluc-FSE CoV-2 -Rluc(–1) reporter in HEK293T knockout cell lines. NT, non-targeting sgRNA. ( H ) Validation of EIF2A as a –1 PRF enhancer in HEK293T knockout cell lines. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, two-tailed t test. Data are mean ± SD.
Article Snippet: The Human GeCKOv2 CRISPR knockout pooled library (
Techniques: Genome Wide, Knock-Out, Negative Control, Biomarker Discovery, Two Tailed Test
Journal: bioRxiv
Article Title: Genome-wide CRISPR screens identify noncanonical translation factor eIF2A as an enhancer of SARS-CoV-2 programmed –1 ribosomal frameshifting
doi: 10.1101/2023.01.23.525275
Figure Lengend Snippet: Cumulative distribution of changes in the abundance of non-targeting and essential gene sgRNAs on day 7 ( A ) and day 14 ( B ) samples relative to the sgRNA library prior to transfection. NT High, non-targeting sgRNAs in GFP-to-mCherry-high sample; NT Low, non-targeting sgRNAs in GFP-to-mCherry-low sample; Ess High, sgRNAs for essential genes in GFP-to-mCherry-high sample; Ess Low, sgRNAs for essential genes in GFP-to-mCherry-low sample.
Article Snippet: The Human GeCKOv2 CRISPR knockout pooled library (
Techniques: Transfection
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A ) Diagrams of the wild-type (WT) and truncated V5-tagged (red) forms of the cytosolic tail of murine PLXND1 (V5-C-mPLXND1) used for co-immunoprecipitation experiments. Color-coding is used to highlight the following domains and motifs. GAP1 and GAP2 (Guanosine triphosphatase-Activating Protein domains 1 and 2; black), RBD (Rho GTPase-Binding Domain; green), T-segment (C-terminal segment, includes the GBM; blue) and, GBM (GIPC-Binding Motif; magenta); see . ( B ) Diagrams of the wild-type (WT) and truncated FLAG-tagged (purple) forms of murine GIPC1 (FLAG-mGIPC) used for co-immunoprecipitation experiments. Domains indicated as follows: PDZ (PSD-95/Dlg/ZO-1; green) and GH (GIPC Homology domain) 1 (blue) and 2 (orange); see . ( C ) Western blots (top) and their quantification (bottom, bar graphs). Numbers indicate lane positions. Left-side Western blot (IP FLAG ): FLAG immunoprecipitates and V5 co-immunoprecipitates showing interactions between the indicated V5-C-mPLXND1 and FLAG-mGIPC forms. Right-side Western blot (TCL), expression levels of these proteins in total cell lysates as detected with V5 and FLAG antibodies. Quantifications. n = 3 independent experiments for each protein pair. Left-side bar graph ( C ). Means of percentual V5/FLAG relative binding [(V5 CoIP /V5 TCL )/(FLAG IP /FLAG TCL )] between the indicated protein pairs from the IP FLAG Western blot (top left) and the relative abundance of the expression levels of these proteins from the TCL Western blot (top right). Error bars, ± SEM. V5/FLAG relative binding was significantly different (p<0.05) between V5-C-mPLXND1 forms and FLAG-mGIPC, F (2, 6)=22.376, p=0.002, as determined by a one-way ANOVA test. A Tukey post hoc analysis was conducted to determine whether the percentual V5/FLAG relative binding between the three tested pairs of proteins was significantly different (p<0.05; asterisks). Right-side bar graph ( C ). Means of percentual V5 TCL /FLAG TCL relative abundance between the indicated protein pairs from the TCL Western blot (top right). Error bars, ± SEM. A Kruskal-Wallis H test was conducted to determine significant differences (p<0.05) in V5 TCL /FLAG TCL relative abundance between the indicated protein pairs. Distributions of V5 TCL /FLAG TCL relative abundance were not similar for all groups. The medians of V5 TCL /FLAG TCL relative abundances were 92.64 (for V5-C-mPLXND1 WT /FLAG-mGIPC1), 87.79 (for V5-C-mPLXND1Δ CYSEA /FLAG-mGIPC1), and 96.22 (for V5-C-mPLXND1Δ GBM /FLAG-mGIPC1), but were not statistically significantly different between them , χ(2)=0.8, p=0.670. ( D ) Western blots: Top (IP FLAG ), FLAG immunoprecipitates and their V5 co-immunoprecipitates showing interactions between the indicated V5-C-mPLXND1 and FLAG-mGIPC forms; bottom, (TCL) detection of the expression levels of these proteins in total cell lysates using antibodies against V5 and FLAG. n = 3 independent experiments for each protein pair. For additional data and statistical comparisons related to this figure, see , and .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Immunoprecipitation, Binding Assay, Western Blot, Expressing
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A, B ) Diagrams of the cytosolic tails of the zebrafish Plxnd1 proteins encoded by the WT ( A ) and plxnd1 skt6 mutant ( B ) alleles including their C-terminal amino acid sequences. Color-coding is used to highlight the following domains and motifs. GAP1 and GAP2 (Guanosine triphosphatase-Activating Protein domains 1 (left) and 2 (right); black), RBD (Rho GTPase-Binding Domain; green), T-segment (C-terminal segment, includes the GBM; blue), and GBM (GIPC-Binding Motif; magenta). In the WT protein diagram ( A ), the canonical PBM (PDZ-Binding Motif) is underlined. In the mutant protein diagram ( B ), the thin horizontal red bar denotes the amino acid sequence replacing the PBM. ( C–H ) Confocal lateral images of the trunk vasculature (green) of 32 hpf embryos (region dorsal to the yolk extension). Anterior, left; dorsal, up. Scale bars (white horizontal lines), 100 μm. Genotypes indicated on top of each image in yellow font. Angiogenesis deficits are indicated with asterisks as follows: white (DLAV gaps), magenta (truncated Se). In the WT image ( C ), the vessels are designated with the white font as follows: DLAV (Dorsal Longitudinal Anastomotic Vessel), Se (Segmental Vessel), DA (Dorsal Aorta), and PCV (Posterior Cardinal Vein). The homozygous WT and homozygous plxnd1 skt6 mutant embryos ( F–H ) are siblings derived from the incross of plxnd1 skt6 /+heterozygotes. ( I ) Bar graph. Percentage of Se-DLAV in 32 hpf embryos of the indicated genotypes belonging to each of the following four phenotypic classes. Truncated: maximal (red; includes missing Se), moderate (yellow), and minimal (gray). Non-truncated: Full (black). There was no statistically significant difference in the distribution of the four phenotypic classes between WT and plxnd1 skt6 mutants as assessed by a two-sided Fisher Exact test, p=0.05905. Quantifications. To determine whether plxnd1 skt6 complements the plxnd1 fov01b null, we analyzed vascular patterning ( C–E ) and scored Se-DLAV angiogenesis ( C, E ) in embryos of the following three genotypes: WT (124 Se-DLAV, 11 embryos, an average of 11.27 Se-DLAV/embryo), plxnd1 fov01b homozygotes (12 embryos), and plxnd1 fov01b / plxnd1 fov01b transheterozygotes (162 Se-DLAV, 16 embryos, an average of 10.13 Se-DLAV/embryo). All the WT and transheterozygotes displayed proper vascular patterns indistinguishable from each other and lacked Se-DLAV truncations. All the plxnd1 fov01b mutants displayed hyperangiogenic vascular mispatterning. To determine how Plxnd1’s inability to interact with GIPCs impacts angiogenic growth, we scored Se-DLAV angiogenesis ( F–I ) in sibling embryos of the following two genotypes: Homozygous WT (126 Se-DLAV, 12 embryos, an average of 10.5 Se-DLAV/embryo) and plxnd1 skt6 homozygous mutants (124 Se-DLAV, 12 embryos, an average of 10.33 Se-DLAV/embryo). For additional data, graphs and statistical comparisons related to this figure, see and .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Mutagenesis, Binding Assay, Sequencing, Derivative Assay
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A, B ) Diagrams of the GAL4-responsive constructs used for forced endothelial expression in plxnd1 fov01b ; Tg(fli1a:GAL4FF) ubs4 ; Tg(flt1:nls-mCherry) skt7 embryos. ( A ) Construct for expression of the green fluorescent marker EGFP (negative control). ( B ) Construct for bicistronic coexpression of 2xHA-Plxnd1 (2xHA-Plxnd1 WT or 2xHA-Plxnd1Δ GBM ) and EGFP (to fluorescently label cells with exogenous 2xHA-Plxnd1 expression). ( C–I ) Confocal lateral images of 32 hpf embryo trunks. Anterior, left; dorsal, up. Scale bars (white horizontal lines), 50 μm. Image colors: Cells with exogenous gene expression, green (EGFP + ); arterial nuclei, red; somite boundaries, blue. The position of EGFP + clones within the arterial tree indicated as follows. DLAV (Dorsal Longitudinal Anastomotic Vessel), Se (Segmental vessel), DLAV-Se (both Se and DLAV), DAd (dorsal side of the Dorsal Aorta), and DAv (ventral side of the Dorsal Aorta). White asterisks mark clones with non-endothelial, ectopic expression. ( C ) Expression of EGFP alone fails to rescue the vascular defects of plxnD1 fov01b mutants. EGFP + arterial cells form mispatterned, ectopic and over branched Se vessels and aberrantly shaped DLAVs. ( D–I ) EGFP + cells expressing 2xHA-Plxnd1 WT ( D–F ) or 2xHA-Plxnd1Δ GBM ( G–I ) rescue the vascular defects of plxnd1 fov01b mutants. These cells displayed a WT-like phenotype. Briefly, they were not found within ectopic Se sprouts, displayed normal shapes according to their position within Se and DLAVs and, when found at the base of a sprout, were properly positioned just anterior to a somite boundary; see . ( J ) Bar graph. Quantification of the vascular phenotype (WT-like or plxnd1 null-like) of EGFP + angiogenic endothelial cells (those at the DLAV, DLAV-Se, and DAd positions but not the DAV position) with exogenous expression of 2xHA-Plxnd1 WT (top) or 2xHA-Plxnd1Δ GBM (bottom) in plxnd1 fov01b mutants. Both 2xHA-Plxnd1 forms rescue the vascular defects of plxnd1 fov01b mutants with similar efficiency. Quantifications. We scored the vascular phenotype of angiogenic endothelial cells in plxnd1 fov01b mutants coexpressing EGFP and the following 2xHA-Plxnd1 forms: 2xHA-Plxnd1 WT (21 clones, 15 embryos), 2xHA-Plxnd1Δ GBM (nine clones, 17 embryos). Note that embryos harboring only DAV clones were excluded from this analysis. The significance value (p=1) was calculated using a two-sided Fisher’s Exact test. The significant difference value is p<0.05. The proportions were not significantly different. For additional supplementary information related to this figure, see , and . This figure is related to .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Construct, Expressing, Marker, Negative Control, Gene Expression, Clone Assay
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A ) Penetrance bar graph. Percentage of embryos of the indicated genotypes with Se-DLAV truncations (gray; a summation of the ‘minimal,’ ‘moderate,’ and ‘maximal’ categories) and with non-truncated Se-DLAV (black; ‘full’ category). The distributions of these two phenotypic classes were not statistically significantly different between WT and plxnd1 skt6 mutants as assessed by a two-sided Fisher Exact test, p=0.21739. ( B ) Expressivity bar graph. Percentage of ‘maximal’ (red), ‘moderate’ (yellow), and ‘minimal’ (gray) Se-DLAV truncations, and of ‘full’ (black) non-truncated Se-DLAV in plxnd1 skt6 mutants with Se-DLAV truncations. For additional supplementary information related to this figure, see . This figure is related to .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques:
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A–D ) Confocal lateral images of the trunk vasculature (green) of 32 hpf embryos (region dorsal to the yolk extension). Anterior, left; dorsal, up. Scale bars (white horizontal lines), 100 μm. Treatments (DMSO or SU5416) indicated on top, genotypes (WT or plxnd1 skt6 ) indicated on the left. Angiogenesis deficits are indicated with asterisks as follows: white (DLAV gaps), magenta (truncated Se). In the image of the DMSO-treated WT ( C ), the vessels are designated with the white font as follows: DLAV (Dorsal Longitudinal Anastomotic Vessel), Se (Segmental Vessel), DA (Dorsal Aorta), and PCV (Posterior Cardinal Vein). ( E ) Bar graph. Percentage of Se-DLAV in 32 hpf embryos of the indicated genotype and treatment combinations belonging to each of the following four phenotypic classes. Truncated: maximal (red; includes missing Se), moderate (yellow), and minimal (gray). Non-truncated: Full (black). The distributions of these four phenotypic classes were statistically significantly different between all the possible pairwise comparisons of the four combinations of treatments and genotypes. Significance values were calculated using a two-sided Fisher Exact test and significant differences (p<0.0083) assigned using a Bonferroni-type adjustment for six pairwise genotype comparisons (0.05/6 = 0.0083). Quantifications. We scored Se-DLAV angiogenesis ( A–E ) in embryos of the following four combinations of treatments and genotypes: DMSO-treated WT (312 Se-DLAV, 28 embryos, an average of 11.14 Se-DLAV/embryo), DMSO-treated plxnd1 skt6 (284 Se-DLAV, 26 embryos, an average of 10.92 Se-DLAV/embryo), SU5416-treated WT (322 Se-DLAV, 29 embryos, an average of 11.10 Se-DLAV/embryo), and SU5416-treated plxnd1 skt6 (320 Se-DLAV, 28 embryos, an average of 11.43 Se-DLAV/embryo). For additional data, graphs and statistical comparisons related to this figure, see and .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques:
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A, B ) Confocal lateral images of the trunk vasculature (green) of 32 hpf embryos (region dorsal to the yolk extension). Anterior, left; dorsal, up. Scale bars (white horizontal lines), 100 μm. Genotypes indicated on top of each image in yellow font. Angiogenesis deficits are indicated with asterisks as follows: white (DLAV gaps), magenta (truncated Se). ( C ) Bar graph. Percentage of Se-DLAV in 32 hpf embryos of the indicated genotypes belonging to each of the following four phenotypic classes. Truncated: maximal (red; includes missing Se), moderate (yellow), and minimal (gray). Non-truncated: full (black). There was a statistically significant difference (bracket with an asterisk) in distribution of the four phenotypic classes between gipc1 skt1(MZ) and gipc1 skt1(MZ) ; plxnd1 fov01b /+ embryos, as assessed by a two-sided Fisher Exact test (p<0.05). Quantifications. We scored Se-DLAV angiogenesis in embryos of the following two genotypes: gipc1 skt1(MZ) (390 Se-DLAV, 36 embryos, an average of 10.83 Se-DLAV/embryo) and gipc1 skt1(MZ) ; plxnd1 fov01b /+ (410 Se-DLAV, 38 embryos, an average of 10.79 Se-DLAV/embryo). For additional data, graphs, and statistical comparisons related to this figure, see and . Please note that given the use of different scales for scoring angiogenesis deficits, it is unfeasible to compare the quantifications in and directly.
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques:
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A ) Penetrance bar graph. Percentage of embryos of the indicated genotypes with Se-DLAV truncations (gray; a summation of the ‘minimal,’ ‘moderate,’ and ‘maximal’ categories) and with non-truncated Se-DLAV (black; ‘full’ category). The distributions of these two phenotypic classes were statistically significantly different between gipc1 skt1(MZ) and gipc1 skt1(MZ) ; plxnd1 fov01b /+ embryos as assessed by a two-sided Fisher Exact test, p=0.0361. ( B ) Expressivity bar graph. Percentage of ‘maximal’ (red), ‘moderate’ (yellow), and ‘minimal’ (gray) Se-DLAV truncations and of ‘full’ (black) non-truncated Se-DLAV in embryos with Se-DLAV truncations of the indicated genotypes. The distributions of these four phenotypic classes were statistically significantly different between gipc1 skt1(MZ) and gipc1 skt1(MZ) ; plxnd1 fov01b /+ embryos (brackets and asterisks) as assessed by a two-sided Fisher Exact test, p=0.00004. For additional supplementary information related to this figure, see . This figure is related to .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques:
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A–D ) Confocal lateral images of the trunk vasculature (green) of 32 hpf embryos (region dorsal to the yolk extension). Anterior, left; dorsal, up. Scale bars (white horizontal lines), 100 μm. Morpholino injection (un-injected or injected with plxnd1 morpholino) indicated on top, genotypes (WT or gipc1 skt1(MZ) ; gipc2 skt4(MZ) ) indicated on the left. The un-injected WT picture ( A ) shows the names of the major vessels in white font: DLAV (Dorsal Longitudinal Anastomotic Vessel), Se (Segmental Vessel), DA (Dorsal Aorta), and PCV (Posterior Cardinal Vein). Vascular defects highlighted as follows: truncated or missing Se (magenta asterisk), thin Se (white greater/less-than signs), DLAV gaps (white asterisk). Quantifications. The following number of embryos were analyzed: WT (four embryos), WT injected with plxnd1 morpholino (four embryos; 4/4 showed a vascular phenotype similar to that of plxnd1 fov01b nulls), gipc1 skt1(MZ) ; gipc2 skt4(MZ) (12 embryos; 7/12 showed angiogenesis deficits), and gipc1 skt1(MZ) ; gipc2 skt4(MZ) injected with plxnd1 morpholino (11 embryos; 11/11 showed a vascular phenotype similar to that of plxnd1 fov01b nulls).
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Injection
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A–D ) Representative Western blot of active ERK1/2 (pERK) and total ERK1/2 (ERK Total ) from total cell lysates of HUVEC/TERT2 cells under the four conditions (shRNA and gRNA combinations) and the three ligand treatments indicated. Conditions. Control (A; bold black font), PLXND1 loss (B; bold red font), GIPC loss (C; bold green font), and GIPC-PLXND1 double loss (D; bold blue font). Treatments. Vehicle (-) and 2 nM SEMA3E for the indicated times. Cells stably carried a vector coexpressing the Cas9 nuclease and the indicated gRNAs. The alleles of the PLXND1 gRNAs (KOs) are stable and defined (see and ). ( E ) Bar graph. Means of percentual relative ERK activity (pERK/ERK Total ) under the described conditions (color coded as above) and treatments. Error bars, ± SEM. Relative ERK activity. Statistically significant differences between pairwise combinations of conditions and treatments are indicated (brackets and asterisks). Quantifications. n = 4 independent experiments per PLXND1 gRNA KO (for a pooled total of 8 experiments); n = 4 independent experiments per non-targeting gRNA (for a pooled total of 8 experiments). One-way ANOVA tests were conducted to determine whether relative ERK activity was significantly different between cells in the control, PLXND1 loss, GIPC loss, and GIPC-PLXND1 double loss conditions across each treatment. There were no outliers in the data, as assessed by inspection of a boxplot. Relative ERK activity data were normally distributed, for each treatment, as determined by Shapiro-Wilk’s test (p>0.05) except for the SEMA3E 15 min treatment; p=0.031. There was homogeneity of variances, as assessed by Levene's test (p>0.05) for equality of variances in all conditions. One-way ANOVA tests summary. Relative ERK activity was not statistically significantly different between conditions under vehicle treatment ( F (3, 28)=0.004, p=1). Relative ERK activity was statistically significantly different between conditions under SEMA3E 15 min treatment ( F (3, 28)=10.291, p<0.0005), effect size was ω 2 = 0.46. Relative ERK activity was statistically significantly different between conditions under SEMA3E 45 min treatment ( F (3, 28)=28.738, p<0.0005), effect size was ω 2 = 0.72. Summary of the four statistically significant differences revealed by Tukey post hoc analysis (between conditions under SEMA3E 15 min treatment). Control versus PLXND1 loss was statistically significantly different (p<0.05): (95% CI (17.2450 to 67.2680); p=0.001). Control versus GIPC- PLXND1 double loss was statistically significantly different (p<0.05): (95% CI (−80.9622 to −12.0628); p=0.005). GIPC loss versus PLXND1 loss was statistically significantly different (p<0.05): (95% CI (17.1753 to 86.0747); p=0.002). GIPC loss versus GIPC-PLXND1 double loss was statistically significantly different (p<0.05): (95% CI (−90.0872 to −21.1878); p=0.001). Summary of the five statistically significant differences revealed by Tukey post hoc analysis (between conditions under SEMA3E 45 min treatment). Control versus PLXND1 loss was statistically significantly different (p<0.05): (95% CI (−59.2432 to −16.5068); p<0.0005). Control versus GIPC-PLXND1 double loss was statistically significantly different (p<0.05): (95% CI (−57.3307 to −14.5943); p<0.0005). GIPC loss versus PLXND1 loss was statistically significantly different (p<0.05): (95% CI 39.9193 to 82.6557); p<0.0005). GIPC loss versus GIPC-PLXND1 loss was statistically significantly different (p<0.05): (95% CI-80.7432 to −38.0068); p<0.0005). Control versus GIPC loss was statistically significantly different (p<0.05): (95% CI (2.0443 to 44.7807); p=0.028). For additional data, graphs, and statistical comparisons related to this figure, see .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Western Blot, shRNA, Control, Stable Transfection, Plasmid Preparation, Activity Assay
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A, B ) Bar graphs. Means of percentual relative ERK activity (pERK/ERK Total ) under the described conditions and SEMA3E treatments. Error bars, ± SEM. Relative ERK activity. ( A ) Conditions: control (black; cells with non-targeting gRNA#1 infected with non-targeting shRNAs), PLXND1 loss (red; cells with PLXND1 gRNA KO#1 infected with non-targeting shRNAs), GIPC loss (green; cells with non-targeting gRNA#1 infected with GIPC shRNAs), and GIPC-PLXND1 double loss (blue; cells with PLXND1 gRNA KO#1 infected with GIPC shRNAs). ( B ) Conditions: control (black; cells with non-targeting gRNA#2 infected with non-targeting shRNAs), PLXND1 loss (red; cells with PLXND1 gRNA KO#2 infected with non-targeting shRNAs), GIPC loss (green; cells with non-targeting gRNA#2 infected with GIPC shRNAs), and GIPC-PLXND1 double loss (blue; cells with PLXND1 gRNA KO#2 infected with GIPC shRNAs). For additional data, graphs, and statistical comparisons related to this figure, see . This figure is related to .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Activity Assay, Control, Infection
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A–H ) Western blots for GIPC1-2, PLXND1, and GAPDH (loading control) from TCLs of stable cells demonstrating the effective decrease of GIPC1-2 and PLXND1 levels. ( A–D ) TCLs from non-targeting gRNA#1 cells ( A, C ) and PLXND1 gRNA KO#1 cells ( B, D ) infected with the indicated shRNAs and under the different SEMA3E treatments. ( E–H ) TCLs from non-targeting gRNA#2 cells ( E, G ) and PLXND1 gRNA KO#2 cells ( F, H ) infected with the indicated shRNAs and under the different SEMA3E treatments. This figure is related to and .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Western Blot, Control, Infection
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: ( A–F ). Representative fluorescent images of HUVEC morphology in cell collapse experiments under the following conditions. No ligand ( A–C ; top) or 45 min stimulation with 10 nM of SEMA3E ( D–F ; bottom). In each picture, the square area marked by yellow dotted sides is shown at twice the magnification at the bottom left corner and delimited by white sides. shRNA treatments as follows. Non-targeting, control ( A, D ), GIPC ( GIPC1, GIPC2, and GIPC3 ; B, E ), and PLXND1 ( C, F ). Scale bars (white horizontal lines), 100 μm. ( A–C ) Without ligand stimulation cells are uncollapsed regardless of the knockdown condition. ( D, E ) Cell collapse under ligand stimulation. Cells treated with non-targeting, control shRNA collapse ( D ). GIPC knockdown cells hypercollapse ( E ). SEMA3E-induced collapse is PLXND1-dependent. PLXND1 knockdown abrogates the morphological response ( F ). Cell collapse data collected from three independent experiments. This figure is related to .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: shRNA, Control, Knockdown
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet: Western blots for GIPC1, GIPC2, PLXND1, and GAPDH (loading control) from TCLs of cells infected with the indicated shRNA lentiviral particles. Note the effective decrease of GIPC1-2 and PLXND1 levels. GIPC3 expression was absent under all the experimental conditions assayed. Hence, for brevity, the corresponding Western blots are not shown. This figure is related to .
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Western Blot, Control, Infection, shRNA, Expressing
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet:
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Transgenic Assay, Plasmid Preparation, Mutagenesis, Derivative Assay, Selection, Stable Transfection, Knock-Out, Recombinant, Control, shRNA, Sequencing, Construct, Synthesized, Positive Control, Sterility, Concentration Assay
Journal: eLife
Article Title: GIPC proteins negatively modulate Plexind1 signaling during vascular development
doi: 10.7554/eLife.30454
Figure Lengend Snippet:
Article Snippet: Cell line ( Homo sapiens ) , PLXND1 gRNA KO1. Monoclonal PLXND1 KO HUVEC/TERT2 cell line. , This paper , , Biallelic (transheterozygous) PLXND1 knockout line. Derived from HUVEC/TERT 2 cell line (
Techniques: Sequencing