nacl Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher nacl
    Nacl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 14337 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Thermo Fisher
    Average 99 stars, based on 14337 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    99/100 stars
      Buy from Supplier

    99
    Millipore nacl
    Nacl, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 43502 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Millipore
    Average 99 stars, based on 43502 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    99/100 stars
      Buy from Supplier

    92
    Fisher Scientific nacl
    Responses of flexor tibia motor neurons to chemosensory stimulation. Recording from a single posterior flexor tibia motor neuron showing responses to repeated applications of concentration series of each test chemical. A , Responses to <t>NaCl.</t> B , Responses to sucrose. C , Responses to <t>NHT.</t> D , Responses to lysine glutamate. The responses of the flexor tibia motor neuron showed a dose-dependent relationship with chemical concentration, with higher chemical concentrations evoking larger responses in the motor neuron. Droplets of chemical solutions were applied to the dorsal tibia and tarsus in ascending concentration at 3 min intervals. All recordings are from the same motor neuron tested with each chemical concentration at least five times. Three traces at each concentration are superimposed.
    Nacl, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 92/100, based on 906 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Fisher Scientific
    Average 92 stars, based on 906 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    92
    Merck & Co nacl
    <t>CCL2</t> production in RAW264.7 cells is not increased in excess <t>NaCl.</t> RAW264.7 cells were stimulated with additional 40
    Nacl, supplied by Merck & Co, used in various techniques. Bioz Stars score: 92/100, based on 1058 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Merck & Co
    Average 92 stars, based on 1058 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    92
    Merck KGaA nacl
    Adsorption isotherms of RhB onto <t>SDS-modified</t> α -Al 2 O 3 nanoparticles ( M 1) at two <t>NaCl</t> concentrations. The points are experimental data while solid lines are fitted by the two-step adsorption model.
    Nacl, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 92/100, based on 1335 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Merck KGaA
    Average 92 stars, based on 1335 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    92
    Avantor nacl
    Adsorption isotherms of RhB onto <t>SDS-modified</t> α -Al 2 O 3 nanoparticles ( M 1) at two <t>NaCl</t> concentrations. The points are experimental data while solid lines are fitted by the two-step adsorption model.
    Nacl, supplied by Avantor, used in various techniques. Bioz Stars score: 92/100, based on 496 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Avantor
    Average 92 stars, based on 496 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    92
    Carl Roth GmbH nacl
    Effect of tricyclazole and salt stress on the growth of P. macrospinosa , Cadophora sp., and Leptodontidium sp. Colonies were grown for 14 days on <t>PDA</t> medium supplemented with different concentrations (0, 100, 500 mM) of <t>NaCl</t> with (+) or without (–) tricyclazole. Bars represent standard deviations of the means. Two-way ANOVA ( P = 0.05; n = 9) has been applied and different letters indicate significant differences between treatments according to Tukey HSD test.
    Nacl, supplied by Carl Roth GmbH, used in various techniques. Bioz Stars score: 92/100, based on 530 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Carl Roth GmbH
    Average 92 stars, based on 530 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    94
    PerkinElmer nacl
    Backbone amide NH signal assignments for PARP1 CAT. a , [ 15 N, 1 H] TROSY spectrum of 15 N-labelled human PARP-1 656-1014 recorded at 800 MHz and 25°C, showing backbone amide NH signal assignments. Protein concentration was 400 μM in 50 mM [ 2 H 11 ] <t>Tris</t> pH 7.0, 50 mM <t>NaCl</t> and 2 mM [ 2 H 10 ] DTT in 95:5 H 2 O/ 2 H 2 O. b , Expansion of the most crowded region of the spectrum shown in a .
    Nacl, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 94/100, based on 936 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/PerkinElmer
    Average 94 stars, based on 936 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    94/100 stars
      Buy from Supplier

    92
    B. Braun nacl
    Backbone amide NH signal assignments for PARP1 CAT. a , [ 15 N, 1 H] TROSY spectrum of 15 N-labelled human PARP-1 656-1014 recorded at 800 MHz and 25°C, showing backbone amide NH signal assignments. Protein concentration was 400 μM in 50 mM [ 2 H 11 ] <t>Tris</t> pH 7.0, 50 mM <t>NaCl</t> and 2 mM [ 2 H 10 ] DTT in 95:5 H 2 O/ 2 H 2 O. b , Expansion of the most crowded region of the spectrum shown in a .
    Nacl, supplied by B. Braun, used in various techniques. Bioz Stars score: 92/100, based on 200 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/B. Braun
    Average 92 stars, based on 200 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    92
    FUJIFILM nacl
    A. Reporter assay of virF promoter activity in an hns mutant . An hns deletion mutant of S. sonnei strain MS4841 carrying virFTL-lacZ (striped bars) was grown in <t>YENB</t> media with or without 150 mM <t>NaCl</t> were subjected to the β-galactosidase assay. For a comparison of activities, the data from Figure 1C, Graph 1, which was derived from simultaneous assays, is indicated by three solid bars on the left side of the graph. Strain and concentration of NaCl are indicated at the bottom of the graph as follows: Wt, wild-type strain (solid bars); hns , hns deletion mutant (striped bars); YENB medium, 0 (white bars); YENB medium with 150 mM NaCl, 150 mM (gray bars). B. Western blot analysis of H-NS and CpxR expression . An overnight LB culture of MS390 at 30°C was inoculated into fresh media and then the cells were cultured until they reached mid-log phase ( A 600 = 0.8). Media, temperature (YENB at 37°C; LB at 30°C and 37°C) and the concentration of NaCl are indicated on the top of the panel. Antibodies used for detection are indicated on the right side of the panels. A cross-reactive unknown protein detected by the anti-H-NS antiserum was used as a loding control.
    Nacl, supplied by FUJIFILM, used in various techniques. Bioz Stars score: 92/100, based on 777 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/FUJIFILM
    Average 92 stars, based on 777 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    92
    Fisher Scientific sodium chloride nacl
    Interaction between OligoG CF-5/20 and LPS. ( a ) Heat effects per injection ( q i ) for the titration of 20 mg/ml OligoG CF-5/20 into 10 mg/ml LPS (▪), 20 mg/ml OligoG CF-5/20 into buffer (o), buffer into 10 mg/ml LPS (Δ), and buffer into buffer (∇) at 37 °C (buffer is 20 mM phosphate pH 7, 100 mM <t>NaCl,</t> 1 mM <t>EDTA).</t> ( b ) Heat effects per injection ( q i ) for the titration of 20 mg/ml OligoG CF-5/20 into 10 mg/ml LPS (▪), 20 mg/ml OligoG CF-5/20 into buffer (o), buffer into 10 mg/ml LPS (Δ), and buffer into buffer (∇) at 37 °C (buffer is 20 mM phosphate pH 7, 100 mM NaCl, 1 mM EDTA).
    Sodium Chloride Nacl, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 92/100, based on 251 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sodium chloride nacl/product/Fisher Scientific
    Average 92 stars, based on 251 article reviews
    Price from $9.99 to $1999.99
    sodium chloride nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    90
    Dyets Inc nacl diet
    Comparison of urinary <t>TGF-β1</t> excretion in WT and TGFβ1 +/− rats fed a 0.4% or 8% <t>NaCl</t> diet on weeks 0, 1, and 5 . A : free urinary TGF-β1 levels. Total urinary TGF-β1 levels are presented in B . *Significant difference
    Nacl Diet, supplied by Dyets Inc, used in various techniques. Bioz Stars score: 90/100, based on 72 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl diet/product/Dyets Inc
    Average 90 stars, based on 72 article reviews
    Price from $9.99 to $1999.99
    nacl diet - by Bioz Stars, 2021-02
    90/100 stars
      Buy from Supplier

    92
    Merck KGaA sodium chloride nacl
    Effect of <t>LiCl</t> (a) and <t>NaCl</t> (b) on viability of LNCap cells. Values are expressed as mean+SD from at least three independents experiments in triplicate. * P
    Sodium Chloride Nacl, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 92/100, based on 231 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sodium chloride nacl/product/Merck KGaA
    Average 92 stars, based on 231 article reviews
    Price from $9.99 to $1999.99
    sodium chloride nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    99
    Millipore nacl solution
    TTFields induce a dihydropyridine-sensitive Ca 2+ -entry in human glioblastoma cells. ( A ) Time course of TTFields (200 kHz, 2.5 V/cm, 3 min)-induced changes of mean (±SE; n = 8–20) fura-2 340/380 nm fluorescence ratio as recorded in T98G (left) and U251 (right) cells with Ca 2+ (1 mM)-containing <t>NaCl-solution</t> (closed triangles) and <t>EGTA</t> (0.6 mM)-buffered Ca 2+ -free NaCl-solution (open circles). ( B ) Mean (±SE; n = 13–20) fura-2 340/380 nm fluorescence ratio recorded in T98G (left) and U251 cells (right) before, during, and after application of TTFields (200 kHz, 2.5 V/cm, 3 min) during continuous superfusion with Ca 2+ -containing NaCl-solution (open circles), Ca 2+ -containing NaCl solution further containing 1 µM benidipine (red triangles) or 1 µM nifedipine (blue diamonds). ( C ) Mean (±SE; n = 13–39) fura-2 340/380 nm fluorescence ratio recorded in T98G (left) and U251 cells (right) before, during, and after application of TTFields (200 kHz, 2.5 V/cm, 3 min) during continuous superfusion with benidipine (1 µM, top, red symbols) or nifedipine (1 µM, bottom, blue symbols)-containing NaCl-solution and after wash-out of the inhibitors (open symbols). ( D ) Mean (±SE; n = 34–63) slope (as indicated by white lines in ( C )) of the fura-2 340/380 nm fluorescence ratio changes before (control), at the end and shortly after TTF-application (middle) both in the presence of benidipine (red) or nifedipine (blue) as well as after wash-out of the inhibitors. * and *** in ( D ) indicate 3 p ≤ 0.05 and 3 p ≤ 0.01, respectively, (Welch)-corrected t -test and Bonferroni correction for 3 pairwise comparisons.
    Nacl Solution, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 619 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl solution/product/Millipore
    Average 99 stars, based on 619 article reviews
    Price from $9.99 to $1999.99
    nacl solution - by Bioz Stars, 2021-02
    99/100 stars
      Buy from Supplier

    92
    Sinopharm nacl
    TTFields induce a dihydropyridine-sensitive Ca 2+ -entry in human glioblastoma cells. ( A ) Time course of TTFields (200 kHz, 2.5 V/cm, 3 min)-induced changes of mean (±SE; n = 8–20) fura-2 340/380 nm fluorescence ratio as recorded in T98G (left) and U251 (right) cells with Ca 2+ (1 mM)-containing <t>NaCl-solution</t> (closed triangles) and <t>EGTA</t> (0.6 mM)-buffered Ca 2+ -free NaCl-solution (open circles). ( B ) Mean (±SE; n = 13–20) fura-2 340/380 nm fluorescence ratio recorded in T98G (left) and U251 cells (right) before, during, and after application of TTFields (200 kHz, 2.5 V/cm, 3 min) during continuous superfusion with Ca 2+ -containing NaCl-solution (open circles), Ca 2+ -containing NaCl solution further containing 1 µM benidipine (red triangles) or 1 µM nifedipine (blue diamonds). ( C ) Mean (±SE; n = 13–39) fura-2 340/380 nm fluorescence ratio recorded in T98G (left) and U251 cells (right) before, during, and after application of TTFields (200 kHz, 2.5 V/cm, 3 min) during continuous superfusion with benidipine (1 µM, top, red symbols) or nifedipine (1 µM, bottom, blue symbols)-containing NaCl-solution and after wash-out of the inhibitors (open symbols). ( D ) Mean (±SE; n = 34–63) slope (as indicated by white lines in ( C )) of the fura-2 340/380 nm fluorescence ratio changes before (control), at the end and shortly after TTF-application (middle) both in the presence of benidipine (red) or nifedipine (blue) as well as after wash-out of the inhibitors. * and *** in ( D ) indicate 3 p ≤ 0.05 and 3 p ≤ 0.01, respectively, (Welch)-corrected t -test and Bonferroni correction for 3 pairwise comparisons.
    Nacl, supplied by Sinopharm, used in various techniques. Bioz Stars score: 92/100, based on 159 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Sinopharm
    Average 92 stars, based on 159 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    nacl  (Difco)
    92
    Difco nacl
    Morphologies of Vibrio vulnificus ATCC <t>33815</t> incubated in artificial sea water (pH 6) microcosms with varying concentrations of <t>NaCl</t> at 4 °C on the seventh day. ( A , B ) Bacterial cells in a microcosm containing 0.75% NaCl; ( C , D ) cells in a microcosm amended with 5% NaCl; ( E , F ) cells in a microcosm amended with 10% NaCl; and ( G , H ) cells in a microcosm amended with 30% NaCl. Arrows point out the collapse of cytoplasmic spaces, which resulted in the development of gaps between the cell membrane and the peripheral membrane
    Nacl, supplied by Difco, used in various techniques. Bioz Stars score: 92/100, based on 346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Difco
    Average 92 stars, based on 346 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    92
    Becton Dickinson nacl
    Morphologies of Vibrio vulnificus ATCC <t>33815</t> incubated in artificial sea water (pH 6) microcosms with varying concentrations of <t>NaCl</t> at 4 °C on the seventh day. ( A , B ) Bacterial cells in a microcosm containing 0.75% NaCl; ( C , D ) cells in a microcosm amended with 5% NaCl; ( E , F ) cells in a microcosm amended with 10% NaCl; and ( G , H ) cells in a microcosm amended with 30% NaCl. Arrows point out the collapse of cytoplasmic spaces, which resulted in the development of gaps between the cell membrane and the peripheral membrane
    Nacl, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 92/100, based on 1101 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Becton Dickinson
    Average 92 stars, based on 1101 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier

    93
    Thermo Fisher mgso4
    Morphologies of Vibrio vulnificus ATCC <t>33815</t> incubated in artificial sea water (pH 6) microcosms with varying concentrations of <t>NaCl</t> at 4 °C on the seventh day. ( A , B ) Bacterial cells in a microcosm containing 0.75% NaCl; ( C , D ) cells in a microcosm amended with 5% NaCl; ( E , F ) cells in a microcosm amended with 10% NaCl; and ( G , H ) cells in a microcosm amended with 30% NaCl. Arrows point out the collapse of cytoplasmic spaces, which resulted in the development of gaps between the cell membrane and the peripheral membrane
    Mgso4, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 7225 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mgso4/product/Thermo Fisher
    Average 93 stars, based on 7225 article reviews
    Price from $9.99 to $1999.99
    mgso4 - by Bioz Stars, 2021-02
    93/100 stars
      Buy from Supplier

    92
    Mallinckrodt nacl
    Group means ± standard error of water intake (white bars) and CS intake (quinine upper panel, citric acid lower panel) on conditioning days 1, 2, and 3. For mice injected with <t>LiCl</t> (left panel, black bars) and <t>NaCl</t> (right panel, gray bars). *Significantly
    Nacl, supplied by Mallinckrodt, used in various techniques. Bioz Stars score: 92/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Mallinckrodt
    Average 92 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-02
    92/100 stars
      Buy from Supplier




    Image Search Results


    Responses of flexor tibia motor neurons to chemosensory stimulation. Recording from a single posterior flexor tibia motor neuron showing responses to repeated applications of concentration series of each test chemical. A , Responses to NaCl. B , Responses to sucrose. C , Responses to NHT. D , Responses to lysine glutamate. The responses of the flexor tibia motor neuron showed a dose-dependent relationship with chemical concentration, with higher chemical concentrations evoking larger responses in the motor neuron. Droplets of chemical solutions were applied to the dorsal tibia and tarsus in ascending concentration at 3 min intervals. All recordings are from the same motor neuron tested with each chemical concentration at least five times. Three traces at each concentration are superimposed.

    Journal: The Journal of Neuroscience

    Article Title: Gustatory Processing in Thoracic Local Circuits of Locusts

    doi: 10.1523/JNEUROSCI.22-18-08324.2002

    Figure Lengend Snippet: Responses of flexor tibia motor neurons to chemosensory stimulation. Recording from a single posterior flexor tibia motor neuron showing responses to repeated applications of concentration series of each test chemical. A , Responses to NaCl. B , Responses to sucrose. C , Responses to NHT. D , Responses to lysine glutamate. The responses of the flexor tibia motor neuron showed a dose-dependent relationship with chemical concentration, with higher chemical concentrations evoking larger responses in the motor neuron. Droplets of chemical solutions were applied to the dorsal tibia and tarsus in ascending concentration at 3 min intervals. All recordings are from the same motor neuron tested with each chemical concentration at least five times. Three traces at each concentration are superimposed.

    Article Snippet: The following concentrations were used (in m m ): 0.05, 0.5, 2.5, and 5 NHT (Sigma, St. Louis, MO), pH 4.4–3.1; 25, 50, 75, and 100 NaCl (Fisher Scientific, Houston, TX), pH 6.3–6.6; 250, 500, 1000, and 2000 sucrose (BDH Chemicals, Poole, UK), pH 6.4–6.9; and 250, 500, 1000, and 2000 lysine glutamate (Sigma), pH 6.2–6.3.

    Techniques: Concentration Assay

    Responses of midline spiking local interneurons to chemosensory stimulation. A , Responses to NaCl. B , Responses to sucrose. C , Responses to NHT. D , Responses to lysine glutamate. Recordings from four different spiking local interneurons showing their responses to repeated applications of increasing concentrations of the four test chemicals. The greater the chemical concentration, the greater the response in an interneuron. Chemical droplets were applied once every 2 min in an ascending concentration series; each application was followed by water, and the entire sequence was repeated.

    Journal: The Journal of Neuroscience

    Article Title: Gustatory Processing in Thoracic Local Circuits of Locusts

    doi: 10.1523/JNEUROSCI.22-18-08324.2002

    Figure Lengend Snippet: Responses of midline spiking local interneurons to chemosensory stimulation. A , Responses to NaCl. B , Responses to sucrose. C , Responses to NHT. D , Responses to lysine glutamate. Recordings from four different spiking local interneurons showing their responses to repeated applications of increasing concentrations of the four test chemicals. The greater the chemical concentration, the greater the response in an interneuron. Chemical droplets were applied once every 2 min in an ascending concentration series; each application was followed by water, and the entire sequence was repeated.

    Article Snippet: The following concentrations were used (in m m ): 0.05, 0.5, 2.5, and 5 NHT (Sigma, St. Louis, MO), pH 4.4–3.1; 25, 50, 75, and 100 NaCl (Fisher Scientific, Houston, TX), pH 6.3–6.6; 250, 500, 1000, and 2000 sucrose (BDH Chemicals, Poole, UK), pH 6.4–6.9; and 250, 500, 1000, and 2000 lysine glutamate (Sigma), pH 6.2–6.3.

    Techniques: Concentration Assay, Sequencing

    Mean dose–response relationships of flexor tibia motor neurons. A , Responses to NaCl. B , Responses to sucrose. C , Responses to NHT. D , Responses to lysine glutamate. Mean ± SEM response durations of flexor tibia motor neurons to concentration series of each of the test chemicals are shown. Response duration increased with higher concentrations of each test chemical. Data are from nine recordings each of motor neurons tested with NaCl and sucrose, six tested with NHT, and four tested with lysine glutamate. Arrows indicate responses to water alone.

    Journal: The Journal of Neuroscience

    Article Title: Gustatory Processing in Thoracic Local Circuits of Locusts

    doi: 10.1523/JNEUROSCI.22-18-08324.2002

    Figure Lengend Snippet: Mean dose–response relationships of flexor tibia motor neurons. A , Responses to NaCl. B , Responses to sucrose. C , Responses to NHT. D , Responses to lysine glutamate. Mean ± SEM response durations of flexor tibia motor neurons to concentration series of each of the test chemicals are shown. Response duration increased with higher concentrations of each test chemical. Data are from nine recordings each of motor neurons tested with NaCl and sucrose, six tested with NHT, and four tested with lysine glutamate. Arrows indicate responses to water alone.

    Article Snippet: The following concentrations were used (in m m ): 0.05, 0.5, 2.5, and 5 NHT (Sigma, St. Louis, MO), pH 4.4–3.1; 25, 50, 75, and 100 NaCl (Fisher Scientific, Houston, TX), pH 6.3–6.6; 250, 500, 1000, and 2000 sucrose (BDH Chemicals, Poole, UK), pH 6.4–6.9; and 250, 500, 1000, and 2000 lysine glutamate (Sigma), pH 6.2–6.3.

    Techniques: Concentration Assay

    Chemosensitivity of flexor tibia motor neurons. All flexor tibia motor neurons tested in the three motor pools responded in a similar dose-dependent manner. Paired simultaneous recording of flexor tibia motor neurons showed responses to ascending concentrations of NaCl and NHT. A , A motor neuron from each of the lateral and posterior groups responds in a similar manner to each concentration of NaCl. B , The fast and slow flexor tibia motor neurons of the posterior group respond in a similar manner to a concentration series of NHT. Three traces, one at each concentration, are superimposed. Arrows indicate responses to the concentrations shown.

    Journal: The Journal of Neuroscience

    Article Title: Gustatory Processing in Thoracic Local Circuits of Locusts

    doi: 10.1523/JNEUROSCI.22-18-08324.2002

    Figure Lengend Snippet: Chemosensitivity of flexor tibia motor neurons. All flexor tibia motor neurons tested in the three motor pools responded in a similar dose-dependent manner. Paired simultaneous recording of flexor tibia motor neurons showed responses to ascending concentrations of NaCl and NHT. A , A motor neuron from each of the lateral and posterior groups responds in a similar manner to each concentration of NaCl. B , The fast and slow flexor tibia motor neurons of the posterior group respond in a similar manner to a concentration series of NHT. Three traces, one at each concentration, are superimposed. Arrows indicate responses to the concentrations shown.

    Article Snippet: The following concentrations were used (in m m ): 0.05, 0.5, 2.5, and 5 NHT (Sigma, St. Louis, MO), pH 4.4–3.1; 25, 50, 75, and 100 NaCl (Fisher Scientific, Houston, TX), pH 6.3–6.6; 250, 500, 1000, and 2000 sucrose (BDH Chemicals, Poole, UK), pH 6.4–6.9; and 250, 500, 1000, and 2000 lysine glutamate (Sigma), pH 6.2–6.3.

    Techniques: Concentration Assay

    CCL2 production in RAW264.7 cells is not increased in excess NaCl. RAW264.7 cells were stimulated with additional 40

    Journal: PLoS ONE

    Article Title: Salt-Dependent Chemotaxis of Macrophages

    doi: 10.1371/journal.pone.0073439

    Figure Lengend Snippet: CCL2 production in RAW264.7 cells is not increased in excess NaCl. RAW264.7 cells were stimulated with additional 40

    Article Snippet: 2*105 cells were placed in serum-reduced (0.5% FCS) cell culture media (see cell culture) in the upper well while the culture medium of the lower compartment was supplemented with 25 nM CXCL12, 15 nM CCL2 (both from Peprotech), or NaCl (Merck) with concentrations between 10–100 mM (reaching a final concentration of 155 to 255 mM NaCl in the media), respectively.

    Techniques:

    TonEBP is not involved in salt-dependent chemotaxis of macrophages. Western blot analysis of TonEBP protein expression with or without excess 40(wt) and TonEBP overexpressing (TonEBP overexp) RAW264.7 cells, respectively (A). Kinetics of cell migration of TonEBP overexpressing and wildtype RAW264.7 macrophages toward 40 mM excess NaCl over 20 hours using transwell migration assays (B). Western blot analysis of TonEBP expression in RAW264.7 cells following RNAi of TonEBP using lipofection for 72 hours; mock, lipofection without siRNA; ns siRNA, nonspecific control siRNA (C). Transwell migration assay of RAW264.7 cells following RNAi of TonEBP toward 40 mM excess NaCl (D). For all western blot analysis (A, C), β-actin protein expression was used as a loading control. The migration index (B, D) was determined by the number of transmigrated cells in relation to CXCL12-stimulated cells. “+”indicates that the stimulus was added to the lower well of the transwell (D). All cell migration data shown represent mean ± SD from 3 experiments performed in duplicate. ***p

    Journal: PLoS ONE

    Article Title: Salt-Dependent Chemotaxis of Macrophages

    doi: 10.1371/journal.pone.0073439

    Figure Lengend Snippet: TonEBP is not involved in salt-dependent chemotaxis of macrophages. Western blot analysis of TonEBP protein expression with or without excess 40(wt) and TonEBP overexpressing (TonEBP overexp) RAW264.7 cells, respectively (A). Kinetics of cell migration of TonEBP overexpressing and wildtype RAW264.7 macrophages toward 40 mM excess NaCl over 20 hours using transwell migration assays (B). Western blot analysis of TonEBP expression in RAW264.7 cells following RNAi of TonEBP using lipofection for 72 hours; mock, lipofection without siRNA; ns siRNA, nonspecific control siRNA (C). Transwell migration assay of RAW264.7 cells following RNAi of TonEBP toward 40 mM excess NaCl (D). For all western blot analysis (A, C), β-actin protein expression was used as a loading control. The migration index (B, D) was determined by the number of transmigrated cells in relation to CXCL12-stimulated cells. “+”indicates that the stimulus was added to the lower well of the transwell (D). All cell migration data shown represent mean ± SD from 3 experiments performed in duplicate. ***p

    Article Snippet: 2*105 cells were placed in serum-reduced (0.5% FCS) cell culture media (see cell culture) in the upper well while the culture medium of the lower compartment was supplemented with 25 nM CXCL12, 15 nM CCL2 (both from Peprotech), or NaCl (Merck) with concentrations between 10–100 mM (reaching a final concentration of 155 to 255 mM NaCl in the media), respectively.

    Techniques: Chemotaxis Assay, Western Blot, Expressing, Migration, Transwell Migration Assay

    Excess NaCl does not increase lamellipodia dynamics of motile RAW264.7 cells. Microscopial analysis of TRITC-Phalloidin stained F-actin (red) in untreated RAW264.7 cells and cells stimulated with 40 mM NaCl, 10 nM C5a, 15 nM CCL2, or 25 nM CXCL12, respectively (A). Images were performed with an inverted confocal laser scanning microscope focussed to the basal plasma membrane of the cells. Nuclei were detected with DAPI staining (blue). Microscopical analysis of lamellipodia dynamics in RAW264.7 cells (B-D) on a glass surface stimulated with excess 40 mM NaCl, 10 nM C5a, 15 nM CCL2, 25 nM CXCL12, respectively. Membrane dynamics were visualized at the basal plasma membrane by the use of phase contrast over a period of 5 min at 2 sec per frame. Subsequently, an area of interest was marked on each image of the time-series by lines (white line in B) that cross the motile lamellipodium of the polarized cell. Velocities of lamellipodia protrusion formation were analyzed by kymograph analysis and line scan analysis of yellow lines (C) using ImageJ. Quantification of lamellipodia dynamics of motile RAW264.7 cells (D). Three kymographs per cell were analyzed; each dot represents the value of one single kymograph (C). Shown data are representative for one experiment out of three. Error bars indicate ± SD. ***p

    Journal: PLoS ONE

    Article Title: Salt-Dependent Chemotaxis of Macrophages

    doi: 10.1371/journal.pone.0073439

    Figure Lengend Snippet: Excess NaCl does not increase lamellipodia dynamics of motile RAW264.7 cells. Microscopial analysis of TRITC-Phalloidin stained F-actin (red) in untreated RAW264.7 cells and cells stimulated with 40 mM NaCl, 10 nM C5a, 15 nM CCL2, or 25 nM CXCL12, respectively (A). Images were performed with an inverted confocal laser scanning microscope focussed to the basal plasma membrane of the cells. Nuclei were detected with DAPI staining (blue). Microscopical analysis of lamellipodia dynamics in RAW264.7 cells (B-D) on a glass surface stimulated with excess 40 mM NaCl, 10 nM C5a, 15 nM CCL2, 25 nM CXCL12, respectively. Membrane dynamics were visualized at the basal plasma membrane by the use of phase contrast over a period of 5 min at 2 sec per frame. Subsequently, an area of interest was marked on each image of the time-series by lines (white line in B) that cross the motile lamellipodium of the polarized cell. Velocities of lamellipodia protrusion formation were analyzed by kymograph analysis and line scan analysis of yellow lines (C) using ImageJ. Quantification of lamellipodia dynamics of motile RAW264.7 cells (D). Three kymographs per cell were analyzed; each dot represents the value of one single kymograph (C). Shown data are representative for one experiment out of three. Error bars indicate ± SD. ***p

    Article Snippet: 2*105 cells were placed in serum-reduced (0.5% FCS) cell culture media (see cell culture) in the upper well while the culture medium of the lower compartment was supplemented with 25 nM CXCL12, 15 nM CCL2 (both from Peprotech), or NaCl (Merck) with concentrations between 10–100 mM (reaching a final concentration of 155 to 255 mM NaCl in the media), respectively.

    Techniques: Staining, Laser-Scanning Microscopy, Size-exclusion Chromatography

    RAW264.7 cells recognize NaCl-induced hypertonicity as a chemoattractant stimulus. Transwell migration assay of the murine macrophage cell line RAW264.7 toward the hypertonic stimuli NaCl, urea or mannitol, respectively (A). The difference in Na + concentration measured in lower and upper wells by flame photometry is shown as Δ Na + (B). Transwell migration assay of RAW264.7 cells in the presence or absence of Polymyxin B, respectively (C). Transwell migration assay of BMDMs activated with 200 ng/ml LPS (D). Dose-dependency of RAW264.7 cells toward different NaCl concentrations by the use of transwell migration assays (E). The migration index was determined by the number of transmigrated cells in relation to CXCL12-stimulated cells after 20 hours. [−/−] indicates that no hypertonic stimulus was added to the transwells. [−/+] indicates that the hypertonic stimulus was added to the lower well of the transwell. [+/−] indicates that the hypertonic stimulus was added to the upper well of the transwell. [+/+] indicates that the hypertonic stimulus was added to both wells of the transwell (A). “+”indicates that the stimulus was added to the lower well of the transwell (C, D and E). Error bars indicate ± SD. *p

    Journal: PLoS ONE

    Article Title: Salt-Dependent Chemotaxis of Macrophages

    doi: 10.1371/journal.pone.0073439

    Figure Lengend Snippet: RAW264.7 cells recognize NaCl-induced hypertonicity as a chemoattractant stimulus. Transwell migration assay of the murine macrophage cell line RAW264.7 toward the hypertonic stimuli NaCl, urea or mannitol, respectively (A). The difference in Na + concentration measured in lower and upper wells by flame photometry is shown as Δ Na + (B). Transwell migration assay of RAW264.7 cells in the presence or absence of Polymyxin B, respectively (C). Transwell migration assay of BMDMs activated with 200 ng/ml LPS (D). Dose-dependency of RAW264.7 cells toward different NaCl concentrations by the use of transwell migration assays (E). The migration index was determined by the number of transmigrated cells in relation to CXCL12-stimulated cells after 20 hours. [−/−] indicates that no hypertonic stimulus was added to the transwells. [−/+] indicates that the hypertonic stimulus was added to the lower well of the transwell. [+/−] indicates that the hypertonic stimulus was added to the upper well of the transwell. [+/+] indicates that the hypertonic stimulus was added to both wells of the transwell (A). “+”indicates that the stimulus was added to the lower well of the transwell (C, D and E). Error bars indicate ± SD. *p

    Article Snippet: 2*105 cells were placed in serum-reduced (0.5% FCS) cell culture media (see cell culture) in the upper well while the culture medium of the lower compartment was supplemented with 25 nM CXCL12, 15 nM CCL2 (both from Peprotech), or NaCl (Merck) with concentrations between 10–100 mM (reaching a final concentration of 155 to 255 mM NaCl in the media), respectively.

    Techniques: Transwell Migration Assay, Concentration Assay, Migration

    Adsorption isotherms of RhB onto SDS-modified α -Al 2 O 3 nanoparticles ( M 1) at two NaCl concentrations. The points are experimental data while solid lines are fitted by the two-step adsorption model.

    Journal: Journal of Analytical Methods in Chemistry

    Article Title: Adsorptive Removal of Rhodamine B Using Novel Adsorbent-Based Surfactant-Modified Alpha Alumina Nanoparticles

    doi: 10.1155/2020/6676320

    Figure Lengend Snippet: Adsorption isotherms of RhB onto SDS-modified α -Al 2 O 3 nanoparticles ( M 1) at two NaCl concentrations. The points are experimental data while solid lines are fitted by the two-step adsorption model.

    Article Snippet: The critical micelle concentration (CMC) of SDS is measured by the conductometry under different NaCl (p. a, Merck, Germany) concentrations at 22°C mentioned in somewhere [ ].

    Techniques: Adsorption, Modification

    The ζ potential based on adsorption isotherms of the SDS onto α -Al 2 O 3 nanoparticles at pH 5.0 and under different ionic strengths of 1 and 10 mM NaCl. The standard deviation was taken by the three different measurements.

    Journal: Journal of Analytical Methods in Chemistry

    Article Title: Adsorptive Removal of Rhodamine B Using Novel Adsorbent-Based Surfactant-Modified Alpha Alumina Nanoparticles

    doi: 10.1155/2020/6676320

    Figure Lengend Snippet: The ζ potential based on adsorption isotherms of the SDS onto α -Al 2 O 3 nanoparticles at pH 5.0 and under different ionic strengths of 1 and 10 mM NaCl. The standard deviation was taken by the three different measurements.

    Article Snippet: The critical micelle concentration (CMC) of SDS is measured by the conductometry under different NaCl (p. a, Merck, Germany) concentrations at 22°C mentioned in somewhere [ ].

    Techniques: Adsorption, Standard Deviation

    The ζ potential of synthesized nano α -Al 2 O 3 , SDS-modified nano α -Al 2 O 3 ( M 1), and M 1 after RhB adsorption in 10 mM NaCl (pH 5).

    Journal: Journal of Analytical Methods in Chemistry

    Article Title: Adsorptive Removal of Rhodamine B Using Novel Adsorbent-Based Surfactant-Modified Alpha Alumina Nanoparticles

    doi: 10.1155/2020/6676320

    Figure Lengend Snippet: The ζ potential of synthesized nano α -Al 2 O 3 , SDS-modified nano α -Al 2 O 3 ( M 1), and M 1 after RhB adsorption in 10 mM NaCl (pH 5).

    Article Snippet: The critical micelle concentration (CMC) of SDS is measured by the conductometry under different NaCl (p. a, Merck, Germany) concentrations at 22°C mentioned in somewhere [ ].

    Techniques: Synthesized, Modification, Adsorption

    Effect of tricyclazole and salt stress on the growth of P. macrospinosa , Cadophora sp., and Leptodontidium sp. Colonies were grown for 14 days on PDA medium supplemented with different concentrations (0, 100, 500 mM) of NaCl with (+) or without (–) tricyclazole. Bars represent standard deviations of the means. Two-way ANOVA ( P = 0.05; n = 9) has been applied and different letters indicate significant differences between treatments according to Tukey HSD test.

    Journal: Frontiers in Microbiology

    Article Title: Salt Stress Tolerance of Dark Septate Endophytes Is Independent of Melanin Accumulation

    doi: 10.3389/fmicb.2020.562931

    Figure Lengend Snippet: Effect of tricyclazole and salt stress on the growth of P. macrospinosa , Cadophora sp., and Leptodontidium sp. Colonies were grown for 14 days on PDA medium supplemented with different concentrations (0, 100, 500 mM) of NaCl with (+) or without (–) tricyclazole. Bars represent standard deviations of the means. Two-way ANOVA ( P = 0.05; n = 9) has been applied and different letters indicate significant differences between treatments according to Tukey HSD test.

    Article Snippet: The actively growing hyphae of 2-week old fungal colonies cultivated on potato dextrose agar (PDA) medium (Roth, Karlsruhe, Germany) were cut into plugs (9.5 mm diameter) and transferred to fresh PDA medium enriched with NaCl (Roth, Karlsruhe, Germany) in different concentrations (0, 10, 100, 200, 300, 500 mM NaCl).

    Techniques:

    Melanin concentration in hyphae of P. macrospinosa , Cadophora sp., and Leptodontidium sp. Colonies were grown on PDA medium supplemented with different concentrations (0, 100, 500 mM) of NaCl with (+) or without (–) tricyclazole in concentration of 40 μg/mL and incubated at 25°C for 14 days. Bars represent standard deviations of the means. Two-way ANOVA ( P = 0.05; n = 9) has been applied and different letters indicate significant differences between treatments according to Tukey HSD test.

    Journal: Frontiers in Microbiology

    Article Title: Salt Stress Tolerance of Dark Septate Endophytes Is Independent of Melanin Accumulation

    doi: 10.3389/fmicb.2020.562931

    Figure Lengend Snippet: Melanin concentration in hyphae of P. macrospinosa , Cadophora sp., and Leptodontidium sp. Colonies were grown on PDA medium supplemented with different concentrations (0, 100, 500 mM) of NaCl with (+) or without (–) tricyclazole in concentration of 40 μg/mL and incubated at 25°C for 14 days. Bars represent standard deviations of the means. Two-way ANOVA ( P = 0.05; n = 9) has been applied and different letters indicate significant differences between treatments according to Tukey HSD test.

    Article Snippet: The actively growing hyphae of 2-week old fungal colonies cultivated on potato dextrose agar (PDA) medium (Roth, Karlsruhe, Germany) were cut into plugs (9.5 mm diameter) and transferred to fresh PDA medium enriched with NaCl (Roth, Karlsruhe, Germany) in different concentrations (0, 10, 100, 200, 300, 500 mM NaCl).

    Techniques: Concentration Assay, Incubation

    Backbone amide NH signal assignments for PARP1 CAT. a , [ 15 N, 1 H] TROSY spectrum of 15 N-labelled human PARP-1 656-1014 recorded at 800 MHz and 25°C, showing backbone amide NH signal assignments. Protein concentration was 400 μM in 50 mM [ 2 H 11 ] Tris pH 7.0, 50 mM NaCl and 2 mM [ 2 H 10 ] DTT in 95:5 H 2 O/ 2 H 2 O. b , Expansion of the most crowded region of the spectrum shown in a .

    Journal: Nature

    Article Title: HPF1 completes the PARP active site for DNA damage-induced ADP-ribosylation

    doi: 10.1038/s41586-020-2013-6

    Figure Lengend Snippet: Backbone amide NH signal assignments for PARP1 CAT. a , [ 15 N, 1 H] TROSY spectrum of 15 N-labelled human PARP-1 656-1014 recorded at 800 MHz and 25°C, showing backbone amide NH signal assignments. Protein concentration was 400 μM in 50 mM [ 2 H 11 ] Tris pH 7.0, 50 mM NaCl and 2 mM [ 2 H 10 ] DTT in 95:5 H 2 O/ 2 H 2 O. b , Expansion of the most crowded region of the spectrum shown in a .

    Article Snippet: The reaction buffer contained 50 mM Tris, 100 mM NaCl, pH 8.0, 1 μM DNA duplex (5' ATCAGATAGCATCTGTGCGGCCGCTTAGGG 3' and 5' CCCTAAGCGGCCGCACAGATGCTATCTGAT 3'), and 100 μM NAD+ spiked with 32 P-NAD+ from Perkin Elmer.

    Techniques: Protein Concentration

    [ 15 N, 1 H] TROSY spectra of PARP1 CAT +/- HPF1. [ 15 N, 1 H] TROSY spectra of human PARP1 656-1014 in the absence (grey) or presence (blue) of human full-length HPF1 at a 1:1 ratio, recorded at 800 MHz and 25 °C. Protein concentrations were 150 μM, samples contained 50 mM [ 2 H 11 ] Tris pH 7.0, 50 mM NaCl and 2 mM [ 2 H 10 ] DTT in 95:5 H 2 O/ 2 H 2 O. The spectra were acquired, processed and contoured identically.

    Journal: Nature

    Article Title: HPF1 completes the PARP active site for DNA damage-induced ADP-ribosylation

    doi: 10.1038/s41586-020-2013-6

    Figure Lengend Snippet: [ 15 N, 1 H] TROSY spectra of PARP1 CAT +/- HPF1. [ 15 N, 1 H] TROSY spectra of human PARP1 656-1014 in the absence (grey) or presence (blue) of human full-length HPF1 at a 1:1 ratio, recorded at 800 MHz and 25 °C. Protein concentrations were 150 μM, samples contained 50 mM [ 2 H 11 ] Tris pH 7.0, 50 mM NaCl and 2 mM [ 2 H 10 ] DTT in 95:5 H 2 O/ 2 H 2 O. The spectra were acquired, processed and contoured identically.

    Article Snippet: The reaction buffer contained 50 mM Tris, 100 mM NaCl, pH 8.0, 1 μM DNA duplex (5' ATCAGATAGCATCTGTGCGGCCGCTTAGGG 3' and 5' CCCTAAGCGGCCGCACAGATGCTATCTGAT 3'), and 100 μM NAD+ spiked with 32 P-NAD+ from Perkin Elmer.

    Techniques:

    A. Reporter assay of virF promoter activity in an hns mutant . An hns deletion mutant of S. sonnei strain MS4841 carrying virFTL-lacZ (striped bars) was grown in YENB media with or without 150 mM NaCl were subjected to the β-galactosidase assay. For a comparison of activities, the data from Figure 1C, Graph 1, which was derived from simultaneous assays, is indicated by three solid bars on the left side of the graph. Strain and concentration of NaCl are indicated at the bottom of the graph as follows: Wt, wild-type strain (solid bars); hns , hns deletion mutant (striped bars); YENB medium, 0 (white bars); YENB medium with 150 mM NaCl, 150 mM (gray bars). B. Western blot analysis of H-NS and CpxR expression . An overnight LB culture of MS390 at 30°C was inoculated into fresh media and then the cells were cultured until they reached mid-log phase ( A 600 = 0.8). Media, temperature (YENB at 37°C; LB at 30°C and 37°C) and the concentration of NaCl are indicated on the top of the panel. Antibodies used for detection are indicated on the right side of the panels. A cross-reactive unknown protein detected by the anti-H-NS antiserum was used as a loding control.

    Journal: BMC Microbiology

    Article Title: Involvement of RNA-binding protein Hfq in the osmotic-response regulation of invE gene expression in Shigella sonnei

    doi: 10.1186/1471-2180-9-110

    Figure Lengend Snippet: A. Reporter assay of virF promoter activity in an hns mutant . An hns deletion mutant of S. sonnei strain MS4841 carrying virFTL-lacZ (striped bars) was grown in YENB media with or without 150 mM NaCl were subjected to the β-galactosidase assay. For a comparison of activities, the data from Figure 1C, Graph 1, which was derived from simultaneous assays, is indicated by three solid bars on the left side of the graph. Strain and concentration of NaCl are indicated at the bottom of the graph as follows: Wt, wild-type strain (solid bars); hns , hns deletion mutant (striped bars); YENB medium, 0 (white bars); YENB medium with 150 mM NaCl, 150 mM (gray bars). B. Western blot analysis of H-NS and CpxR expression . An overnight LB culture of MS390 at 30°C was inoculated into fresh media and then the cells were cultured until they reached mid-log phase ( A 600 = 0.8). Media, temperature (YENB at 37°C; LB at 30°C and 37°C) and the concentration of NaCl are indicated on the top of the panel. Antibodies used for detection are indicated on the right side of the panels. A cross-reactive unknown protein detected by the anti-H-NS antiserum was used as a loding control.

    Article Snippet: YENB medium containing 150 mM NaCl (Wako Chemical, Tokyo Japan) was used as the physiological osmotic medium.

    Techniques: Reporter Assay, Activity Assay, Mutagenesis, Derivative Assay, Concentration Assay, Western Blot, Expressing, Cell Culture

    A. InvE expression in Δp invE:: p araBAD strain MS5512 . Δp invE:: p araBAD strain MS5512 and wild-type strain MS390 were grown overnight in LB medium containing chloramphenicol and 50 μM arabinose, washed twice with fresh LB medium, and then inoculated into YENB media containing increasing concentrations of arabinose and cultured at 37°C with or without 150 mM NaCl, as indicated. Strains (Δ pinvE::paraBAD , MS5512; Wt, wild-type strain MS390), concentration of NaCl (0 mM or 150 mM) and concentration of arabinose (0, 0.2, 0.5, 1.0 mM) are indicated above the panels. Primers and antibodies used in the experiments are indicated on the right side of the panels. B. Stability of InvE protein . Δ invE strain MS1632 carrying the expression plasmid pBAD-invE was grown in YENB media containing ampicillin and 100 μM arabinose, with or without 150 mM NaCl, at 37°C. When cultures reached an A 600 of 0.8, rifampicin was added. Cells were harvested at 10 min intervals for a period of 40 min. Whole cell cultures (10 μl) were analysed by Western blot using anti-InvE and -IpaB antibodies.

    Journal: BMC Microbiology

    Article Title: Involvement of RNA-binding protein Hfq in the osmotic-response regulation of invE gene expression in Shigella sonnei

    doi: 10.1186/1471-2180-9-110

    Figure Lengend Snippet: A. InvE expression in Δp invE:: p araBAD strain MS5512 . Δp invE:: p araBAD strain MS5512 and wild-type strain MS390 were grown overnight in LB medium containing chloramphenicol and 50 μM arabinose, washed twice with fresh LB medium, and then inoculated into YENB media containing increasing concentrations of arabinose and cultured at 37°C with or without 150 mM NaCl, as indicated. Strains (Δ pinvE::paraBAD , MS5512; Wt, wild-type strain MS390), concentration of NaCl (0 mM or 150 mM) and concentration of arabinose (0, 0.2, 0.5, 1.0 mM) are indicated above the panels. Primers and antibodies used in the experiments are indicated on the right side of the panels. B. Stability of InvE protein . Δ invE strain MS1632 carrying the expression plasmid pBAD-invE was grown in YENB media containing ampicillin and 100 μM arabinose, with or without 150 mM NaCl, at 37°C. When cultures reached an A 600 of 0.8, rifampicin was added. Cells were harvested at 10 min intervals for a period of 40 min. Whole cell cultures (10 μl) were analysed by Western blot using anti-InvE and -IpaB antibodies.

    Article Snippet: YENB medium containing 150 mM NaCl (Wako Chemical, Tokyo Japan) was used as the physiological osmotic medium.

    Techniques: Expressing, Cell Culture, Concentration Assay, Plasmid Preparation, Western Blot

    A. InvE and IpaB expression in the hfq deletion mutant . Wild-type strain MS390 and the hfq mutant strain MS4831 were cultured in YENB media with or without NaCl, and then subjected to Western blot analysis. Strains and concentration of NaCl are indicated above the panels. Antibodies used in the experiment are indicated on the right side of the panels. B. Effect of ectopic Hfq expression on InvE and IpaB in the hfq mutant . hfq deletion mutants carrying an Hfq expression plasmid or a control plasmid were subjected to Western blot analysis. Strains were grown in YENB medium containing ampicillin and IPTG, or YENB medium containing ampicillin, IPTG and 150 mM NaCl at 37°C, and then harvested. Strains, concentration of NaCl and plasmids (minus, pTrc99A; plus, pTrc-hfq) are indicated above the panel. Lane 1, wild-type strain MS390 grown in YENB medium; Lane 2, Δ hfq (pTrc99A) grown in YENB plus 0.1 mM IPTG; Lane 3, Δ hfq (pTrc-hfq) grown in YENB plus 0.1 mM IPTG; Lane 4, Δ hfq (pTrc99A) grown in YENB with 150 mM NaCl plus 1 mM IPTG; Lane 5, Δ hfq (pTrc-hfq) grown in YENB with 150 mM NaCl plus 1 mM IPTG.

    Journal: BMC Microbiology

    Article Title: Involvement of RNA-binding protein Hfq in the osmotic-response regulation of invE gene expression in Shigella sonnei

    doi: 10.1186/1471-2180-9-110

    Figure Lengend Snippet: A. InvE and IpaB expression in the hfq deletion mutant . Wild-type strain MS390 and the hfq mutant strain MS4831 were cultured in YENB media with or without NaCl, and then subjected to Western blot analysis. Strains and concentration of NaCl are indicated above the panels. Antibodies used in the experiment are indicated on the right side of the panels. B. Effect of ectopic Hfq expression on InvE and IpaB in the hfq mutant . hfq deletion mutants carrying an Hfq expression plasmid or a control plasmid were subjected to Western blot analysis. Strains were grown in YENB medium containing ampicillin and IPTG, or YENB medium containing ampicillin, IPTG and 150 mM NaCl at 37°C, and then harvested. Strains, concentration of NaCl and plasmids (minus, pTrc99A; plus, pTrc-hfq) are indicated above the panel. Lane 1, wild-type strain MS390 grown in YENB medium; Lane 2, Δ hfq (pTrc99A) grown in YENB plus 0.1 mM IPTG; Lane 3, Δ hfq (pTrc-hfq) grown in YENB plus 0.1 mM IPTG; Lane 4, Δ hfq (pTrc99A) grown in YENB with 150 mM NaCl plus 1 mM IPTG; Lane 5, Δ hfq (pTrc-hfq) grown in YENB with 150 mM NaCl plus 1 mM IPTG.

    Article Snippet: YENB medium containing 150 mM NaCl (Wako Chemical, Tokyo Japan) was used as the physiological osmotic medium.

    Techniques: Expressing, Mutagenesis, Cell Culture, Western Blot, Concentration Assay, Plasmid Preparation

    A. Stability of invE mRNA in low osmotic growth conditions . Pre-cultures were inoculated into 35 ml of fresh YENB media and then grown at 37°C with shaking. When cultures reached an A 600 of 0.8, rifampicin was added, then cells were harvested at 2 min intervals. Total RNA (100 ng) was used for RT-PCR analysis, and 10 μl of the amplified product was subjected to agarose gel electrophoresis. NaCl concentration (150 mM, 0 mM), strains (Wild-type strain MS390; Δ hfq , MS4831) and time after rifampicin treatment (0, 2, 4, 6, 8, or 32 min) are indicated above the panels. Primers used in the experiments are indicated on the right side of the panels. B. Decay curves of invE mRNAs . Total RNA (100 ng) was subjected to real-time PCR analysis. The amount of RNA was normalized to an internal control (6S RNA) and expression was expressed relative to expression at time 0, which was set as 1.0. The X-axis indicates time after rifampicin treatment (0 to 8 min). Presence or absence of 150 mM NaCl (plus, minus) and strains (Wt, wild-type strain MS390; Δ hfq , MS4831) are indicated on the right side of the graph.

    Journal: BMC Microbiology

    Article Title: Involvement of RNA-binding protein Hfq in the osmotic-response regulation of invE gene expression in Shigella sonnei

    doi: 10.1186/1471-2180-9-110

    Figure Lengend Snippet: A. Stability of invE mRNA in low osmotic growth conditions . Pre-cultures were inoculated into 35 ml of fresh YENB media and then grown at 37°C with shaking. When cultures reached an A 600 of 0.8, rifampicin was added, then cells were harvested at 2 min intervals. Total RNA (100 ng) was used for RT-PCR analysis, and 10 μl of the amplified product was subjected to agarose gel electrophoresis. NaCl concentration (150 mM, 0 mM), strains (Wild-type strain MS390; Δ hfq , MS4831) and time after rifampicin treatment (0, 2, 4, 6, 8, or 32 min) are indicated above the panels. Primers used in the experiments are indicated on the right side of the panels. B. Decay curves of invE mRNAs . Total RNA (100 ng) was subjected to real-time PCR analysis. The amount of RNA was normalized to an internal control (6S RNA) and expression was expressed relative to expression at time 0, which was set as 1.0. The X-axis indicates time after rifampicin treatment (0 to 8 min). Presence or absence of 150 mM NaCl (plus, minus) and strains (Wt, wild-type strain MS390; Δ hfq , MS4831) are indicated on the right side of the graph.

    Article Snippet: YENB medium containing 150 mM NaCl (Wako Chemical, Tokyo Japan) was used as the physiological osmotic medium.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Concentration Assay, Real-time Polymerase Chain Reaction, Expressing

    A. InvE and IpaB expression in different osmotic conditions . An overnight culture of strain MS390 at 30°C was inoculated into fresh YENB medium with or without osmolytes and then incubated at 37°C until mid-log phase ( A 600 = 0.8). Medium, osmolyte, and concentration are indicated at the top of the panel. Antibodies used for detection are indicated on the right of the panels. A cross-reactive unknown protein detected by the anti-InvE antiserum was used as a loading control for InvE Western blot analysis throughout this study. B . Expression of > invE and virF mRNA and InvE and IpaB protein expression in S. Sonnei . Total RNA (100 ng) and 10 μl of the indicate culture were subjected to analysis of mRNA and protein levels, respectively. The 6S RNA ssrS gene was used as control for RT-PCR. Primers and antibodies are indicated on the right side of the panels. Concentration of NaCl in the medium is indicated at top of the panel. C. Expression of invE and virF > promoter-driven reporter genes . Wild-type S. sonnei strain MS390 carrying the indicated reporter plasmids were subjected to a β-galactosidase assay: Graph 1, virFTL-lacZ translational fusion plasmid pHW848; Graph 2, invETx-lacZ transcriptional fusion plasmid pJM4320; Graph 3, invETL-lacZ translational fusion plasmid pJM4321. Concentration of NaCl is indicated at the bottom of the graphs. Details of the control experiments, indicated by black bars (NC)are described in methods.

    Journal: BMC Microbiology

    Article Title: Involvement of RNA-binding protein Hfq in the osmotic-response regulation of invE gene expression in Shigella sonnei

    doi: 10.1186/1471-2180-9-110

    Figure Lengend Snippet: A. InvE and IpaB expression in different osmotic conditions . An overnight culture of strain MS390 at 30°C was inoculated into fresh YENB medium with or without osmolytes and then incubated at 37°C until mid-log phase ( A 600 = 0.8). Medium, osmolyte, and concentration are indicated at the top of the panel. Antibodies used for detection are indicated on the right of the panels. A cross-reactive unknown protein detected by the anti-InvE antiserum was used as a loading control for InvE Western blot analysis throughout this study. B . Expression of > invE and virF mRNA and InvE and IpaB protein expression in S. Sonnei . Total RNA (100 ng) and 10 μl of the indicate culture were subjected to analysis of mRNA and protein levels, respectively. The 6S RNA ssrS gene was used as control for RT-PCR. Primers and antibodies are indicated on the right side of the panels. Concentration of NaCl in the medium is indicated at top of the panel. C. Expression of invE and virF > promoter-driven reporter genes . Wild-type S. sonnei strain MS390 carrying the indicated reporter plasmids were subjected to a β-galactosidase assay: Graph 1, virFTL-lacZ translational fusion plasmid pHW848; Graph 2, invETx-lacZ transcriptional fusion plasmid pJM4320; Graph 3, invETL-lacZ translational fusion plasmid pJM4321. Concentration of NaCl is indicated at the bottom of the graphs. Details of the control experiments, indicated by black bars (NC)are described in methods.

    Article Snippet: YENB medium containing 150 mM NaCl (Wako Chemical, Tokyo Japan) was used as the physiological osmotic medium.

    Techniques: Expressing, Incubation, Concentration Assay, Western Blot, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation

    Interaction between OligoG CF-5/20 and LPS. ( a ) Heat effects per injection ( q i ) for the titration of 20 mg/ml OligoG CF-5/20 into 10 mg/ml LPS (▪), 20 mg/ml OligoG CF-5/20 into buffer (o), buffer into 10 mg/ml LPS (Δ), and buffer into buffer (∇) at 37 °C (buffer is 20 mM phosphate pH 7, 100 mM NaCl, 1 mM EDTA). ( b ) Heat effects per injection ( q i ) for the titration of 20 mg/ml OligoG CF-5/20 into 10 mg/ml LPS (▪), 20 mg/ml OligoG CF-5/20 into buffer (o), buffer into 10 mg/ml LPS (Δ), and buffer into buffer (∇) at 37 °C (buffer is 20 mM phosphate pH 7, 100 mM NaCl, 1 mM EDTA).

    Journal: Scientific Reports

    Article Title: The antimicrobial effects of the alginate oligomer OligoG CF-5/20 are independent of direct bacterial cell membrane disruption

    doi: 10.1038/srep44731

    Figure Lengend Snippet: Interaction between OligoG CF-5/20 and LPS. ( a ) Heat effects per injection ( q i ) for the titration of 20 mg/ml OligoG CF-5/20 into 10 mg/ml LPS (▪), 20 mg/ml OligoG CF-5/20 into buffer (o), buffer into 10 mg/ml LPS (Δ), and buffer into buffer (∇) at 37 °C (buffer is 20 mM phosphate pH 7, 100 mM NaCl, 1 mM EDTA). ( b ) Heat effects per injection ( q i ) for the titration of 20 mg/ml OligoG CF-5/20 into 10 mg/ml LPS (▪), 20 mg/ml OligoG CF-5/20 into buffer (o), buffer into 10 mg/ml LPS (Δ), and buffer into buffer (∇) at 37 °C (buffer is 20 mM phosphate pH 7, 100 mM NaCl, 1 mM EDTA).

    Article Snippet: Materials were obtained from the following companies: deuterium oxide (D2 O; with 99.9% isotopic purity), LPS (from Pseudomonas aeruginosa 10), Triton X-100, carboxyfluorescein (Cbfl), colistin sulphate, polymyxin B, Tris HCl, propidium iodide (PI), 1-N -phenylnapthylamine (NPN), ethylenediaminetetraacetic acid (EDTA), sodium fluoride (Sigma-Aldrich, Gillingham, U.K.); sodium chloride (NaCl), calcium chloride (CaCl), hydrochloric acid, sodium hydroxide, acetone (Fisher Scientific, Loughborough, U.K.); phosphate buffered saline (PBS) tablets, tryptic soy broth (TSB), Mueller-Hinton (MH) broth, (Oxoid, Basingstoke, U.K.); nitrocefin, (Calbiochem, Darmstadt, Germany); and egg phosphatidylcholine (PC), phosphatidylglycerol (PG), (Lipid Products, Nutfield, UK).

    Techniques: Injection, Titration

    Comparison of urinary TGF-β1 excretion in WT and TGFβ1 +/− rats fed a 0.4% or 8% NaCl diet on weeks 0, 1, and 5 . A : free urinary TGF-β1 levels. Total urinary TGF-β1 levels are presented in B . *Significant difference

    Journal: Physiological Genomics

    Article Title: Heterozygous knockout of transforming growth factor-?1 protects Dahl S rats against high salt-induced renal injury

    doi: 10.1152/physiolgenomics.00119.2012

    Figure Lengend Snippet: Comparison of urinary TGF-β1 excretion in WT and TGFβ1 +/− rats fed a 0.4% or 8% NaCl diet on weeks 0, 1, and 5 . A : free urinary TGF-β1 levels. Total urinary TGF-β1 levels are presented in B . *Significant difference

    Article Snippet: These experiments were performed on WT and TGF-β1+/− Dahl S littermates maintained from weaning on a 0.4% NaCl diet (113755; Dyets, Bethlehem, PA) diet.

    Techniques:

    Comparison of the expression of TGF-β1 ( A ), TGF-β2, and TGF-β3 ( B ) protein in the renal cortex of WT and TGF +/− rats fed a 0.4% or 8% NaCl diet for 5 wk. *Significant difference ( P

    Journal: Physiological Genomics

    Article Title: Heterozygous knockout of transforming growth factor-?1 protects Dahl S rats against high salt-induced renal injury

    doi: 10.1152/physiolgenomics.00119.2012

    Figure Lengend Snippet: Comparison of the expression of TGF-β1 ( A ), TGF-β2, and TGF-β3 ( B ) protein in the renal cortex of WT and TGF +/− rats fed a 0.4% or 8% NaCl diet for 5 wk. *Significant difference ( P

    Article Snippet: These experiments were performed on WT and TGF-β1+/− Dahl S littermates maintained from weaning on a 0.4% NaCl diet (113755; Dyets, Bethlehem, PA) diet.

    Techniques: Expressing

    Comparison of renal cortical histology ( A ) in WT and TGF-β1 +/− rats fed a 0.4% or 8% NaCl diet for 1 and 5 wk. Glomerular injury index ( B ) and renal cortical interstitial fibrosis ( C ) were assessed. *Significant difference ( P

    Journal: Physiological Genomics

    Article Title: Heterozygous knockout of transforming growth factor-?1 protects Dahl S rats against high salt-induced renal injury

    doi: 10.1152/physiolgenomics.00119.2012

    Figure Lengend Snippet: Comparison of renal cortical histology ( A ) in WT and TGF-β1 +/− rats fed a 0.4% or 8% NaCl diet for 1 and 5 wk. Glomerular injury index ( B ) and renal cortical interstitial fibrosis ( C ) were assessed. *Significant difference ( P

    Article Snippet: These experiments were performed on WT and TGF-β1+/− Dahl S littermates maintained from weaning on a 0.4% NaCl diet (113755; Dyets, Bethlehem, PA) diet.

    Techniques:

    Comparison of renal medullary histology ( A ) in WT and TGF-β1 +/− rats fed a 0.4% or 8% NaCl diet for 1 and 5 wk. Renal medullary interstitial fibrosis ( B ) was assessed. *Significant difference ( P

    Journal: Physiological Genomics

    Article Title: Heterozygous knockout of transforming growth factor-?1 protects Dahl S rats against high salt-induced renal injury

    doi: 10.1152/physiolgenomics.00119.2012

    Figure Lengend Snippet: Comparison of renal medullary histology ( A ) in WT and TGF-β1 +/− rats fed a 0.4% or 8% NaCl diet for 1 and 5 wk. Renal medullary interstitial fibrosis ( B ) was assessed. *Significant difference ( P

    Article Snippet: These experiments were performed on WT and TGF-β1+/− Dahl S littermates maintained from weaning on a 0.4% NaCl diet (113755; Dyets, Bethlehem, PA) diet.

    Techniques:

    Comparison of the expression of COL4A1 and α-SMA protein in the renal cortex ( A and B ) and outer medulla ( C and D ) of WT and TGF-β1 +/− rats fed a 0.4% or 8% NaCl diet for 5 wk. *Significant difference ( P

    Journal: Physiological Genomics

    Article Title: Heterozygous knockout of transforming growth factor-?1 protects Dahl S rats against high salt-induced renal injury

    doi: 10.1152/physiolgenomics.00119.2012

    Figure Lengend Snippet: Comparison of the expression of COL4A1 and α-SMA protein in the renal cortex ( A and B ) and outer medulla ( C and D ) of WT and TGF-β1 +/− rats fed a 0.4% or 8% NaCl diet for 5 wk. *Significant difference ( P

    Article Snippet: These experiments were performed on WT and TGF-β1+/− Dahl S littermates maintained from weaning on a 0.4% NaCl diet (113755; Dyets, Bethlehem, PA) diet.

    Techniques: Expressing

    Comparison of renal cortical TGF-β1 levels in rats fed 0.4% or 8% NaCl diet for 1 or 5 wk. A : free renal cortical TGF-β1 levels. Total renal cortical TGF-β1 levels are presented in B . *Significant difference ( P

    Journal: Physiological Genomics

    Article Title: Heterozygous knockout of transforming growth factor-?1 protects Dahl S rats against high salt-induced renal injury

    doi: 10.1152/physiolgenomics.00119.2012

    Figure Lengend Snippet: Comparison of renal cortical TGF-β1 levels in rats fed 0.4% or 8% NaCl diet for 1 or 5 wk. A : free renal cortical TGF-β1 levels. Total renal cortical TGF-β1 levels are presented in B . *Significant difference ( P

    Article Snippet: These experiments were performed on WT and TGF-β1+/− Dahl S littermates maintained from weaning on a 0.4% NaCl diet (113755; Dyets, Bethlehem, PA) diet.

    Techniques:

    Comparison of the expression of TGF-β1, TGF-β2, and TGF-β3 protein in the renal cortex of WT and TGF-β +/− rats fed a 0.4% or 8% NaCl diet for 1 wk. A : representative blots. B, C, D : a comparison of the relative

    Journal: Physiological Genomics

    Article Title: Heterozygous knockout of transforming growth factor-?1 protects Dahl S rats against high salt-induced renal injury

    doi: 10.1152/physiolgenomics.00119.2012

    Figure Lengend Snippet: Comparison of the expression of TGF-β1, TGF-β2, and TGF-β3 protein in the renal cortex of WT and TGF-β +/− rats fed a 0.4% or 8% NaCl diet for 1 wk. A : representative blots. B, C, D : a comparison of the relative

    Article Snippet: These experiments were performed on WT and TGF-β1+/− Dahl S littermates maintained from weaning on a 0.4% NaCl diet (113755; Dyets, Bethlehem, PA) diet.

    Techniques: Expressing

    Comparison of the expression of podocin ( A ) and nephrin ( B ) protein in the renal cortex of WT and TGF-β1 +/− rats fed a 0.4% or 8% NaCl diet for 5 wk. *Significant difference ( P

    Journal: Physiological Genomics

    Article Title: Heterozygous knockout of transforming growth factor-?1 protects Dahl S rats against high salt-induced renal injury

    doi: 10.1152/physiolgenomics.00119.2012

    Figure Lengend Snippet: Comparison of the expression of podocin ( A ) and nephrin ( B ) protein in the renal cortex of WT and TGF-β1 +/− rats fed a 0.4% or 8% NaCl diet for 5 wk. *Significant difference ( P

    Article Snippet: These experiments were performed on WT and TGF-β1+/− Dahl S littermates maintained from weaning on a 0.4% NaCl diet (113755; Dyets, Bethlehem, PA) diet.

    Techniques: Expressing

    Effect of LiCl (a) and NaCl (b) on viability of LNCap cells. Values are expressed as mean+SD from at least three independents experiments in triplicate. * P

    Journal: Indian Journal of Pharmacology

    Article Title: Effect of lithium chloride and antineoplastic drugs on survival and cell cycle of androgen-dependent prostate cancer LNCap cells

    doi: 10.4103/0253-7613.103265

    Figure Lengend Snippet: Effect of LiCl (a) and NaCl (b) on viability of LNCap cells. Values are expressed as mean+SD from at least three independents experiments in triplicate. * P

    Article Snippet: LiCl and sodium chloride (NaCl) were obtained from Merck (Darmstadt, Germany), and 3-(4,5-dimethylthiazol-2-yl) 2,5-diphenyltetrazolium bromide (MTT) and propidium iodide were obtained from Sigma-Aldrich (Saint Louis, USA).

    Techniques:

    TTFields induce a dihydropyridine-sensitive Ca 2+ -entry in human glioblastoma cells. ( A ) Time course of TTFields (200 kHz, 2.5 V/cm, 3 min)-induced changes of mean (±SE; n = 8–20) fura-2 340/380 nm fluorescence ratio as recorded in T98G (left) and U251 (right) cells with Ca 2+ (1 mM)-containing NaCl-solution (closed triangles) and EGTA (0.6 mM)-buffered Ca 2+ -free NaCl-solution (open circles). ( B ) Mean (±SE; n = 13–20) fura-2 340/380 nm fluorescence ratio recorded in T98G (left) and U251 cells (right) before, during, and after application of TTFields (200 kHz, 2.5 V/cm, 3 min) during continuous superfusion with Ca 2+ -containing NaCl-solution (open circles), Ca 2+ -containing NaCl solution further containing 1 µM benidipine (red triangles) or 1 µM nifedipine (blue diamonds). ( C ) Mean (±SE; n = 13–39) fura-2 340/380 nm fluorescence ratio recorded in T98G (left) and U251 cells (right) before, during, and after application of TTFields (200 kHz, 2.5 V/cm, 3 min) during continuous superfusion with benidipine (1 µM, top, red symbols) or nifedipine (1 µM, bottom, blue symbols)-containing NaCl-solution and after wash-out of the inhibitors (open symbols). ( D ) Mean (±SE; n = 34–63) slope (as indicated by white lines in ( C )) of the fura-2 340/380 nm fluorescence ratio changes before (control), at the end and shortly after TTF-application (middle) both in the presence of benidipine (red) or nifedipine (blue) as well as after wash-out of the inhibitors. * and *** in ( D ) indicate 3 p ≤ 0.05 and 3 p ≤ 0.01, respectively, (Welch)-corrected t -test and Bonferroni correction for 3 pairwise comparisons.

    Journal: Cancers

    Article Title: Alternating Electric Fields (TTFields) Activate Cav1.2 Channels in Human Glioblastoma Cells

    doi: 10.3390/cancers11010110

    Figure Lengend Snippet: TTFields induce a dihydropyridine-sensitive Ca 2+ -entry in human glioblastoma cells. ( A ) Time course of TTFields (200 kHz, 2.5 V/cm, 3 min)-induced changes of mean (±SE; n = 8–20) fura-2 340/380 nm fluorescence ratio as recorded in T98G (left) and U251 (right) cells with Ca 2+ (1 mM)-containing NaCl-solution (closed triangles) and EGTA (0.6 mM)-buffered Ca 2+ -free NaCl-solution (open circles). ( B ) Mean (±SE; n = 13–20) fura-2 340/380 nm fluorescence ratio recorded in T98G (left) and U251 cells (right) before, during, and after application of TTFields (200 kHz, 2.5 V/cm, 3 min) during continuous superfusion with Ca 2+ -containing NaCl-solution (open circles), Ca 2+ -containing NaCl solution further containing 1 µM benidipine (red triangles) or 1 µM nifedipine (blue diamonds). ( C ) Mean (±SE; n = 13–39) fura-2 340/380 nm fluorescence ratio recorded in T98G (left) and U251 cells (right) before, during, and after application of TTFields (200 kHz, 2.5 V/cm, 3 min) during continuous superfusion with benidipine (1 µM, top, red symbols) or nifedipine (1 µM, bottom, blue symbols)-containing NaCl-solution and after wash-out of the inhibitors (open symbols). ( D ) Mean (±SE; n = 34–63) slope (as indicated by white lines in ( C )) of the fura-2 340/380 nm fluorescence ratio changes before (control), at the end and shortly after TTF-application (middle) both in the presence of benidipine (red) or nifedipine (blue) as well as after wash-out of the inhibitors. * and *** in ( D ) indicate 3 p ≤ 0.05 and 3 p ≤ 0.01, respectively, (Welch)-corrected t -test and Bonferroni correction for 3 pairwise comparisons.

    Article Snippet: Control, CACNA1C- or nt siRNA-transfected T98G and U251 cells (48 h after transfection) were incubated with fura-2/AM (2 µM for 30 min at 37 °C; Molecular Probes, Goettingen, Germany) in RPMI-1640/10% FCS and DMEM/10% FCS medium, respectively. free [Ca2+ ]i was recorded at 37 °C during superfusion with Ca2+ -containing NaCl solution (in mM: 125 NaCl, 32 HEPES, 5 KCl, 5 d -glucose, 1 MgCl2 , 1 CaCl2 , titrated with NaOH to pH 7.4), with Ca2+ -free NaCl solution (in mM: 125 NaCl, 32 HEPES, 5 KCl, 5 d -glucose, 1 MgCl2 , 0.6 EGTA, titrated with NaOH to pH 7.4), or with Ca2+ -containing NaCl solution further containing the L-, N-, T-type Ca2+ channel blocker benidipine or the L-type inhibitor nifedipine (both 1 µM, Sigma-Aldrich, Taufkirchen, Germany) before, during and after application of TTFields (200 kHz, 0–2.5 V/cm).

    Techniques: Fluorescence

    Morphologies of Vibrio vulnificus ATCC 33815 incubated in artificial sea water (pH 6) microcosms with varying concentrations of NaCl at 4 °C on the seventh day. ( A , B ) Bacterial cells in a microcosm containing 0.75% NaCl; ( C , D ) cells in a microcosm amended with 5% NaCl; ( E , F ) cells in a microcosm amended with 10% NaCl; and ( G , H ) cells in a microcosm amended with 30% NaCl. Arrows point out the collapse of cytoplasmic spaces, which resulted in the development of gaps between the cell membrane and the peripheral membrane

    Journal: Food Science and Biotechnology

    Article Title: Effects of varying concentrations of sodium chloride and acidic conditions on the behavior of Vibrio parahaemolyticus and Vibrio vulnificus cold-starved in artificial sea water microcosms

    doi: 10.1007/s10068-017-0105-3

    Figure Lengend Snippet: Morphologies of Vibrio vulnificus ATCC 33815 incubated in artificial sea water (pH 6) microcosms with varying concentrations of NaCl at 4 °C on the seventh day. ( A , B ) Bacterial cells in a microcosm containing 0.75% NaCl; ( C , D ) cells in a microcosm amended with 5% NaCl; ( E , F ) cells in a microcosm amended with 10% NaCl; and ( G , H ) cells in a microcosm amended with 30% NaCl. Arrows point out the collapse of cytoplasmic spaces, which resulted in the development of gaps between the cell membrane and the peripheral membrane

    Article Snippet: V. parahaemolyticus ATCC 27969, V. parahaemolyticus ATCC 33844, and V. vulnificus ATCC 33815 in ASW were plating-counted on tryptic soy agar supplemented with 3% NaCl (TSA, Difco) and thiosulphate-citrate-bile salts-sucrose (TCBS, Difco).

    Techniques: Incubation

    Loss of culturability in Vibrio vulnificus ATCC 33815 incubated in artificial sea water microcosms (pH 4, 5, 6, and 7) containing ( A ) 0.75% NaCl or supplemented with ( B ) 5%, ( C ) 10%, and ( D ) 30% NaCl, respectively, at 4 °C for 30 days. These culutrabilities were enumerated on a nonselective medium (tryptic soy agar, TSA). The number of viable cells of V. vulnificus ATCC 33815 was measured via the fluorescent microscopic assay using the Live/Dead BacLight R bacterial viability kit. Filled circle , culturability at pH 7; open circle , viability at pH 7; filled triangle , culturability at pH 6; open triangle , viability at pH 6; filled square , culturability at pH 5; open square , viability at pH 5; filled diamond culturability at pH 4; open diamond , viability at pH 4

    Journal: Food Science and Biotechnology

    Article Title: Effects of varying concentrations of sodium chloride and acidic conditions on the behavior of Vibrio parahaemolyticus and Vibrio vulnificus cold-starved in artificial sea water microcosms

    doi: 10.1007/s10068-017-0105-3

    Figure Lengend Snippet: Loss of culturability in Vibrio vulnificus ATCC 33815 incubated in artificial sea water microcosms (pH 4, 5, 6, and 7) containing ( A ) 0.75% NaCl or supplemented with ( B ) 5%, ( C ) 10%, and ( D ) 30% NaCl, respectively, at 4 °C for 30 days. These culutrabilities were enumerated on a nonselective medium (tryptic soy agar, TSA). The number of viable cells of V. vulnificus ATCC 33815 was measured via the fluorescent microscopic assay using the Live/Dead BacLight R bacterial viability kit. Filled circle , culturability at pH 7; open circle , viability at pH 7; filled triangle , culturability at pH 6; open triangle , viability at pH 6; filled square , culturability at pH 5; open square , viability at pH 5; filled diamond culturability at pH 4; open diamond , viability at pH 4

    Article Snippet: V. parahaemolyticus ATCC 27969, V. parahaemolyticus ATCC 33844, and V. vulnificus ATCC 33815 in ASW were plating-counted on tryptic soy agar supplemented with 3% NaCl (TSA, Difco) and thiosulphate-citrate-bile salts-sucrose (TCBS, Difco).

    Techniques: Incubation

    Group means ± standard error of water intake (white bars) and CS intake (quinine upper panel, citric acid lower panel) on conditioning days 1, 2, and 3. For mice injected with LiCl (left panel, black bars) and NaCl (right panel, gray bars). *Significantly

    Journal: Chemical Senses

    Article Title: Citric Acid and Quinine Share Perceived Chemosensory Features Making Oral Discrimination Difficult in C57BL/6J Mice

    doi: 10.1093/chemse/bjr010

    Figure Lengend Snippet: Group means ± standard error of water intake (white bars) and CS intake (quinine upper panel, citric acid lower panel) on conditioning days 1, 2, and 3. For mice injected with LiCl (left panel, black bars) and NaCl (right panel, gray bars). *Significantly

    Article Snippet: LiCl (Sigma Chemical Co.) and NaCl (Mallinckrodt Chemicals) served as the unconditioned stimuli.

    Techniques: Mouse Assay, Injection