Journal: Cancer Cell International

Article Title: Darunavir analog precursors target mitochondrial metabolism in multiple myeloma and CLL.

doi: 10.1186/s12935-025-04142-w

Figure Lengend Snippet: The HIV protease inhibitors and BnpM-NH 2 affect the respiratory chain function altering the the expression of complex II and IV proteins . ( A ) WB analysis of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin expression in MM1S, RPMI-8226, and HG3 cells treated with BupM-NH2 and BnpM-NH2 (30 µM) for 48 h was performed. The intensity of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin intensity normalized to actin were quantified and plotted as bar graphs. The results are presented as mean ± SD of at least three replicates. ( B ) ROS production and mitochondrial mass in MM and CLL cells treated with BupM-NH 2 and BnpM-NH 2 (30 µM) for 24 h were assessed using mitosox and mitotracker assays. FACS analysis was employed to detect median fluorescent intensity (MFI), which was reported on a bar graph. Data, presented as mean ± SD, were obtained from at least three independent experiments. Significant differences ( P ≤ 0.05) were determined by one-way ANOVA with Tukey’s post analysis

Article Snippet: MTCO2 (1:6000, 26 KDa) , Proteintech , Cat#: 55070-1-AP; RRID: AB_10859832.

Techniques: Expressing

Journal: BMC Genomics

Article Title: mtDNA depletion confers specific gene expression profiles in human cells grown in culture and in xenograft

doi: 10.1186/1471-2164-9-521

Figure Lengend Snippet: Levels of HIF-1α and HIF-1 target proteins in A549 and A549 ρ 0 cells . Plateau phase cultures were treated with control vehicle (mannitol), cobalt acetate (cobalt, 100 μM), or hypoxia (1.5% oxygen atmosphere). ( A ) Levels of HIF-1α protein relative to control vehicle after 4 hours treatment as measured by ELISA. Effect of incubation under hypoxic conditions or with cobalt acetate is shown for comparison. Error bars indicate one standard deviation. ( B ) Representative Western blot showing MT-CO2, PGK1, DDIT4, GLUT1, and HSP60 levels in A549 and A549 ρ 0 cells. PGK1 and DDIT4 levels were more abundant (1.4- and 4.0-fold, respectively) in A549 ρ 0 cells relative to A549 cells. In contrast, GLUT1 and HSP60 levels were only marginally changed (1.1- and 1.25-fold less abundant) in A549 ρ 0 cells relative to A549 cells. All estimates were made via phorphorimaging analysis with HSC70 levels serving as a loading control. Note that MT-CO2 levels could not be detected in any A549 ρ 0 experiment while DDIT4 was expressed at low levels, but could be quantified in normoxic cells.

Article Snippet: Western blotting was performed using antibodies against GLUT1 (aka SLC2A1, rabbit polyclonal), PGK1 (goat polyclonal), MTCO2 (mouse monoclonal), PDK1 (rabbit polyclonal), and DDIT4 (rabbit polyclonal) obtained from Santa Cruz Biotechnology, Molecular Probes, Stressgen, and Proteintech, respectively.

Techniques: Control, Enzyme-linked Immunosorbent Assay, Incubation, Comparison, Standard Deviation, Western Blot

Journal: Cell Metabolism

Article Title: PML-Regulated Mitochondrial Metabolism Enhances Chemosensitivity in Human Ovarian Cancers

doi: 10.1016/j.cmet.2018.09.002

Figure Lengend Snippet:

Article Snippet: MTCO2-F : 5′– TCATTTTCCTTATCTGCTTCC –3′ , Eurofins , N/A.

Techniques: Virus, Derivative Assay, Recombinant, Protease Inhibitor, Western Blot, Staining, Membrane, Electron Microscopy, SYBR Green Assay, Bicinchoninic Acid Protein Assay, DNA Profiling, Reverse Transcription, Software, Imaging, Cell Culture