|
MedChemExpress
cells Cells, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/MTCO2+Antibody/pmc13048378-50-2-30 Average 97 stars, based on 1 article reviews
cells - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Genecopoeia
mtco2 rabbit mab Mtco2 Rabbit Mab, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/MTCO2+Rabbit+mAb/custom%40mab-01738%4024970799 Average 95 stars, based on 1 article reviews
mtco2 rabbit mab - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
Proteintech
mtcoii Mtcoii, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/MTCO2+Polyclonal+antibody/pm33785595-243-70-71 Average 96 stars, based on 1 article reviews
mtcoii - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Boster Bio
u2af2 U2af2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/Anti-U2AF65+Rabbit+Monoclonal+Antibody/pm41606740-82-17-20 Average 94 stars, based on 1 article reviews
u2af2 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
MitoSciences
monoclonal antibody for mtco1 in complex iv Monoclonal Antibody For Mtco1 In Complex Iv, supplied by MitoSciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/anti+mtco2/pm22259067-44-11-13 Average 90 stars, based on 1 article reviews
monoclonal antibody for mtco1 in complex iv - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
GeneTex
antihuman mitochondria antibody mtco2 Antihuman Mitochondria Antibody Mtco2, supplied by GeneTex, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/antihuman+mitochondria+antibody+mtco2/10__5858_slash_arpa__2013___0026___le-7-16-22 Average 90 stars, based on 1 article reviews
antihuman mitochondria antibody mtco2 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
ZenBio
mtco2 rabbit monoclonal antibody (r25027) Mtco2 Rabbit Monoclonal Antibody (R25027), supplied by ZenBio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/mtco2+rabbit+monoclonal+antibody++r25027+/pm38242895-57-21-29 Average 90 stars, based on 1 article reviews
mtco2 rabbit monoclonal antibody (r25027) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Busoga Forestry Company
forestry 2.3 mtco 2 expected uganda plantation Forestry 2.3 Mtco 2 Expected Uganda Plantation, supplied by Busoga Forestry Company, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/forestry+2+3+mtco+2+expected+uganda+plantation/10__1111_slash_j__1477___8947__2008__00176__x-106-8-4 Average 90 stars, based on 1 article reviews
forestry 2.3 mtco 2 expected uganda plantation - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Microsynth ag
probe northern blot: targeting mtco2 5’- gacgtccgggaattgcatctgtttt-3 Probe Northern Blot: Targeting Mtco2 5’ Gacgtccgggaattgcatctgtttt 3, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/probe+northern+blot++targeting+mtco2+5%E2%80%99++gacgtccgggaattgcatctgtttt+3/pmc09613700__41467_2022_34088_MOESM1_ESM-55-143-156 Average 90 stars, based on 1 article reviews
probe northern blot: targeting mtco2 5’- gacgtccgggaattgcatctgtttt-3 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Boster Bio
rabbit anti mouse mcm5 antibodies Rabbit Anti Mouse Mcm5 Antibodies, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/Anti-MCM5+Monoclonal+Antibody/pm27955842-83-42-46 Average 90 stars, based on 1 article reviews
rabbit anti mouse mcm5 antibodies - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
mtco2 reverse aagcctaatgtggggacagc ![]() Mtco2 Reverse Aagcctaatgtggggacagc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mtco2/aagcctaatgtggggacagc+mtco2+reverse/pmc12702225-86-0-4 Average 86 stars, based on 1 article reviews
mtco2 reverse aagcctaatgtggggacagc - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Produced in rabbits immunized with E. coli-derived Human MTCO2 fragment, and purified by antigen affinity chromatography.
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: MRPL37 promotes hepatocellular carcinoma progression through modulating mitochondrial energy metabolism
doi: 10.1016/j.isci.2025.114052
Figure Lengend Snippet: MRPL37 is closely associated with oxidative phosphorylation and protein synthesis in HCC cells (A) Workflow diagram showing the extraction of total RNA and proteins from the shCtrl and shMRPL37 groups in SNU-398 cells for transcriptomics and proteomics analysis. (B) Volcano plot displaying differentially expressed proteins (DEPs) between the shCtrl and shMRPL37 groups. (C) GO and KEGG pathway enrichment analysis of MRPL37-related DEPs. (D) GSEA pathway enrichment analysis of MRPL37-related DEPs. (E and F) WB analysis and quantification of nascent protein synthesis following MRPL37 knockdown at different time points in SNU-398 and JHH-7 cells. (G and H) qPCR and WB showing mRNA and protein levels of mitochondrial genes (MT-CO1, MT-ND2, MT-ATP6, MT-ATP8, MT-CYB, MT-CO2) in SNU-398 and JHH-7 cells following MRPL37 knockdown. Data in F and G are presented as the mean ± SD ( n = 3, n represents number of biological replicates). ∗ p < 0.05, ∗∗∗ p < 0.001. ∗∗∗∗ p < 0.0001. ns, not significant. Two-tailed Student’s t test, One-way ANOVA with Tukey’s test and two-way ANOVA with post-hoc tests.
Article Snippet:
Techniques: Phospho-proteomics, Extraction, Knockdown, Two Tailed Test