Journal: iScience

Article Title: MRPL37 promotes hepatocellular carcinoma progression through modulating mitochondrial energy metabolism

doi: 10.1016/j.isci.2025.114052

Figure Lengend Snippet: MRPL37 is closely associated with oxidative phosphorylation and protein synthesis in HCC cells (A) Workflow diagram showing the extraction of total RNA and proteins from the shCtrl and shMRPL37 groups in SNU-398 cells for transcriptomics and proteomics analysis. (B) Volcano plot displaying differentially expressed proteins (DEPs) between the shCtrl and shMRPL37 groups. (C) GO and KEGG pathway enrichment analysis of MRPL37-related DEPs. (D) GSEA pathway enrichment analysis of MRPL37-related DEPs. (E and F) WB analysis and quantification of nascent protein synthesis following MRPL37 knockdown at different time points in SNU-398 and JHH-7 cells. (G and H) qPCR and WB showing mRNA and protein levels of mitochondrial genes (MT-CO1, MT-ND2, MT-ATP6, MT-ATP8, MT-CYB, MT-CO2) in SNU-398 and JHH-7 cells following MRPL37 knockdown. Data in F and G are presented as the mean ± SD ( n = 3, n represents number of biological replicates). ∗ p < 0.05, ∗∗∗ p < 0.001. ∗∗∗∗ p < 0.0001. ns, not significant. Two-tailed Student’s t test, One-way ANOVA with Tukey’s test and two-way ANOVA with post-hoc tests.

Article Snippet: MTCO2 Reverse: AAGCCTAATGTGGGGACAGC , Sangon Biotech , N/A.

Techniques: Phospho-proteomics, Extraction, Knockdown, Two Tailed Test