Journal: bioRxiv

Article Title: Nicotinic modulation insecticides act on diverse receptor subtypes with distinct subunit compositions

doi: 10.1101/2021.11.03.467052

Figure Lengend Snippet: Generation of the nAChRβ1 R81T mutant by CRISPR/Cas9 genome editing. (A) Schematic of the nAChRβ1 locus and the sequence of donor construct. The boxes represent exons and the coding regions are shown in blue. The gRNA sequence is indicated in red and the coden for amino acid substition (CGT to ACT) is highlighted in green. One synonymous mutation (G to A) is also introduced in the PAM region (in yellow) to prevent the re-cleavage from Cas9 after successful integration. (B) The sequence comparison between wild type and point mutation flies. The nucleotides replaced are highlighted in green and yellow boxex.

Article Snippet: The gRNA sequence (3L:4433329∼4433352, ATCAAACGTTTGGTTAACTTTAG) was designed with flyCRISPR Target Finder ( https://flycrispr.org/target-finder/ ) and cloned into the pDCC6 plasmid (addgene #59985).

Techniques: Mutagenesis, CRISPR, Sequencing, Construct, Comparison

Journal: Frontiers in Oncology

Article Title: MDM2 Binding Protein Induces the Resistance of Hepatocellular Carcinoma Cells to Molecular Targeting Agents via Enhancing the Transcription Factor Activity of the Pregnane X Receptor

doi: 10.3389/fonc.2021.715193

Figure Lengend Snippet: The effect of MTBP on PXR’s transcription factor activation.

Article Snippet: The lentivirus particles with the full length of MTBP and the siRNA of MTBP were purchased from the Vigene Corporation, Jinan City, Shandong Province, China.

Techniques: Activation Assay, Control, Plasmid Preparation

Journal: Frontiers in Oncology

Article Title: MDM2 Binding Protein Induces the Resistance of Hepatocellular Carcinoma Cells to Molecular Targeting Agents via Enhancing the Transcription Factor Activity of the Pregnane X Receptor

doi: 10.3389/fonc.2021.715193

Figure Lengend Snippet: MTBP enhanced the expression of PXR downstream genes. (A) The MHCC97-H cells were transfected with a control siRNA or the siRNA of MTBP, whereas the MHCC97-L cells were transfected with an empty vector or MTBP (B) . Cells were treated with solvent control or rifampicin (10μmol/L concentration) and harvested for the western blot experiments. The protein levels of PXR, MTBP, CYP3A4 and P-gp (encoding by the acbc1) in these cells were examined by the antibodies. The β-Actin was chosen as the loading control.

Article Snippet: The lentivirus particles with the full length of MTBP and the siRNA of MTBP were purchased from the Vigene Corporation, Jinan City, Shandong Province, China.

Techniques: Expressing, Transfection, Control, Plasmid Preparation, Solvent, Concentration Assay, Western Blot

Journal: Frontiers in Oncology

Article Title: MDM2 Binding Protein Induces the Resistance of Hepatocellular Carcinoma Cells to Molecular Targeting Agents via Enhancing the Transcription Factor Activity of the Pregnane X Receptor

doi: 10.3389/fonc.2021.715193

Figure Lengend Snippet: MTBP promotes the accumulation of PXR in nuclear or the recruitment of PXR to the promoter regions of its downstream gene. The MHCC97-L (A) cells were transfected with an empty vector or MTBP, whereas the MHCC97-H (B) cells were transfected with a control siRNA or the siRNA of MTBP. Cells were treated with a solvent control or rifampicin and harvested for the cellular sub-fraction experiments. The expression levels of PXR or MTBP in cellular sub-fractions was examined by the western blot assay. The Lamin A (the nuclear-skeletal protein) was used as the indicator of the nuclear sub-fraction, whereas β-Actin was used as the indicator of the cytoplasm sub-fraction. The MHCC97-L (C) cells were transfected with an empty vector or MTBP, whereas the MHCC97-H (D) cells were transfected with a control siRNA or the siRNA of MTBP. Cells were treated with a solvent control or rifampicin and harvested for the ChIP experiments.

Article Snippet: The lentivirus particles with the full length of MTBP and the siRNA of MTBP were purchased from the Vigene Corporation, Jinan City, Shandong Province, China.

Techniques: Transfection, Plasmid Preparation, Control, Solvent, Expressing, Western Blot

Journal: Frontiers in Oncology

Article Title: MDM2 Binding Protein Induces the Resistance of Hepatocellular Carcinoma Cells to Molecular Targeting Agents via Enhancing the Transcription Factor Activity of the Pregnane X Receptor

doi: 10.3389/fonc.2021.715193

Figure Lengend Snippet: MTBP accelerates the clearance or metabolism of sorafenib in HCC cells. (A, B) The MHCC97-H (A, B) cells were transfected with a control siRNA or the siRNA of MTBP, whereas the MHCC97-L (C) cells were transfected with an empty vector or MTBP. The cells were cultured (A, C) and injected into nude mice to form subcutaneous tumor tissues. The sustaining of sorafenib in cultured HCC cells (A, C) or the subcutaneous tumors (B) was examined by the LC-MS/MS methods. The results were shown as the represented images of LC-MS/MS at represented time points or the drug sustaining curves (D–F) . *P < 0.05.

Article Snippet: The lentivirus particles with the full length of MTBP and the siRNA of MTBP were purchased from the Vigene Corporation, Jinan City, Shandong Province, China.

Techniques: Transfection, Control, Plasmid Preparation, Cell Culture, Injection, Liquid Chromatography with Mass Spectroscopy

Journal: Frontiers in Oncology

Article Title: MDM2 Binding Protein Induces the Resistance of Hepatocellular Carcinoma Cells to Molecular Targeting Agents via Enhancing the Transcription Factor Activity of the Pregnane X Receptor

doi: 10.3389/fonc.2021.715193

Figure Lengend Snippet: The effect of MTBP on the metabolism or the clearance of sorafenib in HCC cells.

Article Snippet: The lentivirus particles with the full length of MTBP and the siRNA of MTBP were purchased from the Vigene Corporation, Jinan City, Shandong Province, China.

Techniques: Cell Culture, Control, Plasmid Preparation

Journal: Frontiers in Oncology

Article Title: MDM2 Binding Protein Induces the Resistance of Hepatocellular Carcinoma Cells to Molecular Targeting Agents via Enhancing the Transcription Factor Activity of the Pregnane X Receptor

doi: 10.3389/fonc.2021.715193

Figure Lengend Snippet: MTBP decreased the antitumor effect of sorafenib on the subcutaneous growth of HCC cells. MHCC97-H cells were cultured and transfected with a control siRNA or the siRNA of MTBP. Cells were injected into mice to form subcutaneous tumor tissues and the mice received sorafenib treatment via oral administration. The mice were harvested and the tumor tissues were collected. The results were shown as the images of tumor tissues (A) , tumor volumes (B) , inhibition rates of sorafenib calculated by tumor volumes (C) , tumor weights (D) or inhibition rates of sorafenib calculated by tumor weights (E) . (F–I) the expression level (the mRNA level) of MTBP (F) , PXR (G) , cyp3a4 (H) or abcb1 (I) in subcutaneous tumors (A) was examined by qPCR and shown as the scatter-plot images (F–I) . *P < 0.05.

Article Snippet: The lentivirus particles with the full length of MTBP and the siRNA of MTBP were purchased from the Vigene Corporation, Jinan City, Shandong Province, China.

Techniques: Cell Culture, Transfection, Control, Injection, Inhibition, Expressing

Journal: Frontiers in Oncology

Article Title: MDM2 Binding Protein Induces the Resistance of Hepatocellular Carcinoma Cells to Molecular Targeting Agents via Enhancing the Transcription Factor Activity of the Pregnane X Receptor

doi: 10.3389/fonc.2021.715193

Figure Lengend Snippet: MTBP decreased the in vivo antitumor effect of molecular targeting agents.

Article Snippet: The lentivirus particles with the full length of MTBP and the siRNA of MTBP were purchased from the Vigene Corporation, Jinan City, Shandong Province, China.

Techniques: In Vivo, Control, Plasmid Preparation

Journal: Frontiers in Oncology

Article Title: MDM2 Binding Protein Induces the Resistance of Hepatocellular Carcinoma Cells to Molecular Targeting Agents via Enhancing the Transcription Factor Activity of the Pregnane X Receptor

doi: 10.3389/fonc.2021.715193

Figure Lengend Snippet: MTBP decreased the antitumor effect of sorafenib on the subcutaneous growth HCC cells. (A) MHCC97-H cells were cultured and transfected with a control siRNA or the siRNA of MTBP. Cells were first injected into mice to form subcutaneous tumor tissues; the micro-blocks of subcutaneous tissues were transplanted into the liver of each mouse to form intrahepatic tumor lesions (nodules). Then, the mice were given a sorafenib (0.5mg/kg) treatment via oral administration. The results were shown as the images of micro-PET, the quantitative results of micro-PET images (A) or the images of liver organs with nodules formed by HCC cells, the radio-activation of liver organs to blood, the intensity of liver regions to body-background (micro-PET’s images) or the relative area of the nodules. (B) MHCC97-L cells were cultured and transfected with empty vectors or the vectors of MTBP. Cells were first injected into mice to form subcutaneous tumor tissues and the micro-blocks of subcutaneous tissues were transplanted into the each liver to form the intrahepatic tumor lesions (nodules). Then, the mice were given sorafenib (3.0mg/kg) treatment via oral administration. The results were shown as the images of micro-PET, the quantitative results of micro-PET images (A) or the images of liver organs with nodules formed by HCC cells, the radio-activation of liver organs to blood, the intensity of liver regions to body-background (micro-PET’s images) or the relative area of nodules. *P < 0.05 The white arrow in Figure 7 indicated the liver region from mirco PET examination; whereas the black arrow in Figure 7 indicated the nodules or lesions formed by HCC cells in the liver organs.

Article Snippet: The lentivirus particles with the full length of MTBP and the siRNA of MTBP were purchased from the Vigene Corporation, Jinan City, Shandong Province, China.

Techniques: Cell Culture, Transfection, Control, Injection, Micro-PET, Activation Assay

Journal: Theranostics

Article Title: MTBP regulates cell survival and therapeutic sensitivity in TP53 wildtype glioblastomas

doi: 10.7150/thno.35747

Figure Lengend Snippet: Effect of MTBP silencing on in vitro TP53wt GBM cell growth. A: Effect of MTBP knockdown by shRNA on cell viability in TP53wt GF-1712 and U87 cells. B: Representative images of EdU staining cell proliferation assay (left) and quantification of EdU-positive cells (right). Nuclei were counterstained with Hoechst 33342. Scale bar: 50 μm. C: Effect of MTBP silencing on TP53wt GBM cell colony formation. D: Representative images of GF-1712 and U87 neurospheres transduced with shRNA targeting MTBP, with ShC serving as a control (left). Quantification of relative neurosphere sizes of indicated GSCs (right). Scale bar: 20 μm (upper) and 50 μm (lower). E: Effect of MTBP silencing on the in vitro clonogenicity of GF-1712 and U87 GSCs. F: Western blotting analysis of MTBP, MDM2, p53, p21, PUMA, active caspase3 and c-myc protein levels in GF-1712 and U87 cells transfected with shRNAs targeting MTBP or a control shRNA. G: Effect of MTBP knockdown on G0/G1 in TP53wt GBM cells as determined by flow cytometry. H: Effect of MTBP silencing on the apoptosis of GF-1712 and U87 cells as demonstrated by Annexin V/PI staining and flow cytometry analyses. Results are presented as mean ± SEM of triplicate samples from three independent experiments. *P<0.05, **P < 0.01.

Article Snippet: Independent shRNAs targeting MTBP or MYC, siRNAs targeting MDM2 or p53, and respective scrambled controls were obtained from GeneChem (Shanghai, China).

Techniques: In Vitro, Knockdown, shRNA, Staining, Proliferation Assay, Transduction, Control, Western Blot, Transfection, Flow Cytometry

Journal: Theranostics

Article Title: MTBP regulates cell survival and therapeutic sensitivity in TP53 wildtype glioblastomas

doi: 10.7150/thno.35747

Figure Lengend Snippet: Effect of MTBP overexpression on in vitro TP53wt GBM cell growth. A: Effect on GS-1802 cell viability. B: Effect on GS-1802 cell proliferation as determined by EdU incorporation assays. Scale bar: 50 μm. C: Effect on the colony formation of GS-1802 cells as established by soft agar colony assays. D: Representative images of GS-1802 neurospheres transduced with MTBP-overexpressing plasmids or empty vector (left) and quantification of relative neurosphere sizes of indicated GSCs (right). Scale bar, 50 μm. E: Effect on in vitro clonogenicity of GS-1802 GSCs as assessed by limiting dilution neurosphere formation assays. F: Western blotting assays of the MTBP, MDM2, p53, p21, PUMA, active caspase3 and c-myc protein levels in GS-1802 cells transfected with MTBP-overexpressing plasmids or empty vector. G: Flow cytometry analysis of GS-1802 cells with MTBP overexpression. H: Annexin V/PI staining and flow cytometry analyses of GS-1802 cells with MTBP overexpression. Results are presented as mean ± SEM of triplicate samples from three independent experiments. *P<0.05, **P < 0.01. OE: overexpression. EV: empty vector.

Article Snippet: Independent shRNAs targeting MTBP or MYC, siRNAs targeting MDM2 or p53, and respective scrambled controls were obtained from GeneChem (Shanghai, China).

Techniques: Over Expression, In Vitro, Transduction, Plasmid Preparation, Western Blot, Transfection, Flow Cytometry, Staining

Journal: Theranostics

Article Title: MTBP regulates cell survival and therapeutic sensitivity in TP53 wildtype glioblastomas

doi: 10.7150/thno.35747

Figure Lengend Snippet: Influence of p53 expression on the pro-survival effect of MTBP in GF-1712 cells. A: MTBP bound to MDM2 but not to p53, whereas MDM2 bound to both MTBP and p53 in GF-1712 and U87 cells as shown by co-immunoprecipitation. B: Effect of p53 silencing on the cell viability of MTBP-knockdown GF-1712 cells. C: Effect of p53 silencing on the colony formation of MTBP-knockdown GF-1712 cells as assessed by soft agar colony assays. D: Representative images of GF-1712 neurospheres transduced with indicated plasmids (left) and quantification of relative neurosphere sizes of indicated GSCs (right). Scale bar: 20 μm. E: Effect of p53 silencing on clonogenicity in MTBP-knockdown GF-1712 cells as determined by limiting dilution neurosphere forming assays. F: Effect of p53 silencing on the expressions of p21, PUMA, active caspase3, and c-myc in MTBP-knockdown GF-1712 cells as established by western blotting analyses. G: Effect of p53 silencing on G0/G1 arrest in MTBP-knockdown GF-1712 cells as shown by flow cytometry. H: Effect of p53 silencing on apoptosis in MTBP-knockdown GF-1712 cells. Results are presented as mean ± SEM of triplicate samples from three independent experiments. *P<0.05, **P < 0.01.

Article Snippet: Independent shRNAs targeting MTBP or MYC, siRNAs targeting MDM2 or p53, and respective scrambled controls were obtained from GeneChem (Shanghai, China).

Techniques: Expressing, Immunoprecipitation, Knockdown, Transduction, Western Blot, Flow Cytometry

Journal: Theranostics

Article Title: MTBP regulates cell survival and therapeutic sensitivity in TP53 wildtype glioblastomas

doi: 10.7150/thno.35747

Figure Lengend Snippet: Effect of MTBP silencing on the therapeutic sensitivity of TP53wt GSCs. A and B: Effect of c-myc silencing (A) and overexpression (B) on MTBP promoter activities in GF-1712 and GS-1802 cells respectively as determined by luciferase assays. C: ChIP-qPCR assessment of the binding between c-myc and MTBP promoter. D: Examination of c-myc and MTBP expressions in GF-1712 and GS-1802 cells transduced with indicated plasmids using western blotting analysis. E and F: Effect of 4 Gy radiation exposure on the neurosphere formation rate (E) and the apoptotic rate (F) of TP53wt GF-1712 and GW1806 GSCs previously transduced with either control or shMTBP-2 containing lentivirus. Scale bar: 100 µm. G-H: Effect of 100 μM TMZ treatment on the neurosphere formation rate (G) and the apoptotic rate (H) of GF-1712 and GW1806 GSCs transduced with either control or shMTBP-2 containing lentivirus. Scale bar: 100 µm. I-J: The combined effect of MTBP knockdown and genotoxic treatment in mouse xenograft tumors. Brains were harvested at 20 days after transplantation. Scale bar: 1 mm. Kaplan-Meier survival curves of mice intracranially transplanted GF-1712 GSCs with shC or shMTBP-1 in response to radiation (J; Log-rank P-value: shC vs. shC + Radiation: 0.169, shC vs. shMTBP-1 : 0.002, shC + Radiation vs. shMTBP-1 + Radiation: 0.002, shMTBP-1 vs. shMTBP-1 + Radiation: 0.032) or TMZ treatment (L; Log-rank P-value: shC + Control vs. shC + TMZ: 0.668; shC + Control vs. shMTBP-1 + Control : 0.002; shC + TMZ vs. shMTBP-1 + TMZ: 0.001; shMTBP-1 + Control vs. shMTBP-1 + TMZ: 0.02). Results are presented as mean ± SEM of triplicate samples from three independent experiments. *P < 0.05, **P < 0.01.

Article Snippet: Independent shRNAs targeting MTBP or MYC, siRNAs targeting MDM2 or p53, and respective scrambled controls were obtained from GeneChem (Shanghai, China).

Techniques: Over Expression, Luciferase, ChIP-qPCR, Binding Assay, Transduction, Western Blot, Control, Knockdown, Transplantation Assay