|
OriGene
cx43 gene gja1 ![]() Cx43 Gene Gja1, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pmc12691144-119-4-16?v=OriGene Average 93 stars, based on 1 article reviews
cx43 gene gja1 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
OriGene
qrt pcr ctr9 5 gtgacacctactctatgctggc ![]() Qrt Pcr Ctr9 5 Gtgacacctactctatgctggc, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pmc03478926__supp_jem__20112145_JEM_20112145_sm-19-62-68?v=OriGene Average 90 stars, based on 1 article reviews
qrt pcr ctr9 5 gtgacacctactctatgctggc - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
cgagaaggtctcattgacacgg ![]() Cgagaaggtctcattgacacgg, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pmc10023665-10-2-7?v=OriGene Average 91 stars, based on 1 article reviews
cgagaaggtctcattgacacgg - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
OriGene
mp215366 sh3rf3 qpcr r ![]() Mp215366 Sh3rf3 Qpcr R, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pm30540932-137-177-180?v=OriGene Average 90 stars, based on 1 article reviews
mp215366 sh3rf3 qpcr r - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
casp1 ![]() Casp1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pmc07486940-331-0-9?v=OriGene Average 90 stars, based on 1 article reviews
casp1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
tfap4 ![]() Tfap4, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pmc06597879-450-11-25?v=OriGene Average 90 stars, based on 1 article reviews
tfap4 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
sstr2 ![]() Sstr2, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pm40121305-64-14-65?v=OriGene Average 93 stars, based on 1 article reviews
sstr2 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
OriGene
p2ry12 rev 5 ![]() P2ry12 Rev 5, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pm31525508-99-8-10?v=OriGene Average 93 stars, based on 1 article reviews
p2ry12 rev 5 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
OriGene
origene epcam ![]() Origene Epcam, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pmc11725848__pnas__2422321121__sapp-94-12-12?v=OriGene Average 92 stars, based on 1 article reviews
origene epcam - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
OriGene
cxcl 1 ![]() Cxcl 1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pm30892082-213-9-25?v=OriGene Average 90 stars, based on 1 article reviews
cxcl 1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
mp206759 ![]() Mp206759, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pm30892082-213-4-25?v=OriGene Average 91 stars, based on 1 article reviews
mp206759 - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
OriGene
gtggtagtaaccaaagcatctgc ![]() Gtggtagtaaccaaagcatctgc, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+primers/pmc07385665-101-7-9?v=OriGene Average 92 stars, based on 1 article reviews
gtggtagtaaccaaagcatctgc - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cells
Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy
doi: 10.3390/cells14231852
Figure Lengend Snippet: Late-onset SMA spinal cord analyses showed an increased expression of Cx43 compared to WT. ( A ) Spinal cord slices of SMA and WT mice at ages P20, P35, and p > 100 ( n = 4–5 animals) were stained for Cx43 (green). ( B – D ) Imaging studies showed an increased expression of Cx43 in SMA at P20 (** p = 0.0035). This increased expression was also visible at P35 and p > 100 (** p = 0.0094 and p = 0.0071, respectively). Higher accumulation of Cx43 was evident around motor neurons, particularly in SMA, pointed out in the SMA P35 image. Scale bar 20 μm. ( E ) For WB studies, lumbar spinal cord tissue of n = 3–4 animals was used. Results were then adjusted to the total protein value. ( F – H ) At P35 (* p = 0.0309) and p > 100 (** p = 0.0037), Cx43 expression was increased in SMA compared to WT. At P20, we found no difference in the Cx43 expression ( p = 0.1115). Analysis was conducted using unpaired Student’s t -tests. Full blots are shown in the Additional file. Abbreviations: SMA, spinal muscular atrophy; WB, Western blot; WT, wild-type; P, postnatal day.
Article Snippet: Expression levels of the
Techniques: Expressing, Staining, Imaging, Western Blot
Journal: Cells
Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy
doi: 10.3390/cells14231852
Figure Lengend Snippet: qPCR analyses showed an increase in Cx43 mRNA expression early in the pathogenesis. ( A ) Whole lumbar spinal cord tissue of SMA and WT mice at P20, P35, and p > 100 were prepared, and qPCR analyses were performed. The results suggested an increase in mRNA expression at P20 in SMA compared to WT (* p = 0.029). ( B , C ) No significant difference was visible between SMA and WT at later stages (P35, p = 0.9485; p > 100, p = 0.0542). n = 3 individual animals, analysis was conducted using unpaired Student’s t -tests. Abbreviations: SMA, spinal muscular atrophy; qPCR, quantitative polymerase chain reaction; WT, wild-type; P, postnatal day.
Article Snippet: Expression levels of the
Techniques: Expressing, Real-time Polymerase Chain Reaction
Journal: Cells
Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy
doi: 10.3390/cells14231852
Figure Lengend Snippet: Overexpression of Cx43 in a model of in vitro-induced SMN-deficiency in astrocytes. ( A ) Astrocytic cultures were prepared from the lumbar part of the spinal cord of WT mice and transfected with SMN-siRNA to induce SMN-deficiency. Appropriate control cultures were transfected with scr-siRNA and fluorescence imaging was conducted (created with bioRender.com). ( B , C ) GFAP (green) and DAPI (blue) staining of the same cultures demonstrated an astrocyte proportion of >98% compared to all viable cells; n = four individual cultures for each of the three animals, scale bar 50 μm. ( D , E ) Immunostaining of Cx43 (green) in transfected astrocytes. Analysis showed a 1.6-fold increase in Cx43 expression in SMN-deficient cells compared to the control (* p = 0.03; n = three independent experiments for each of the three individual animals, analysis was conducted using unpaired Student’s t -tests, scale bar 50 μm. Abbreviations: DAPI, 4′,6-diamidino-2-phenylindole; GFAP, glial fibrillary acidic protein; siRNA, small interfering RNA; SMN, survival of motor neuron; WT, wild-type.
Article Snippet: Expression levels of the
Techniques: Over Expression, In Vitro, Transfection, Control, Fluorescence, Imaging, Staining, Immunostaining, Expressing, Small Interfering RNA
Journal: Cells
Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy
doi: 10.3390/cells14231852
Figure Lengend Snippet: SMN deficient hiAstrocytes showed a higher Cx43 expression compared to the control, reversible by Gap27. ( A , B ) Culture clarity and iPSC induction success were proven by GFAP staining, showing >98% astrocytes in the cultures. ( C , D ) hiAstrocytes were transfected with SMN-siRNA to induce SMN deficiency. Appropriate controls were transfected with scr-siRNA. Staining for SMN showed an effective decrease compared to the control (*** p = 0.0006). ( E , F ) Staining for Cx43 showed an increased expression after SMN-knockdown (** p = 0.02), which was reduced after treatment with the Cx43 inhibitor Gap27 (*** p = 0.0009). n = three to seven independent experiments, analysis was conducted using unpaired Student’s t -tests and ANOVA, scale bar 50 μm. Abbreviations: DAPI, 4′,6-diamidino-2-phenylindole; E, embryonal day; SMA, spinal muscular atrophy; WT, wild-type.
Article Snippet: Expression levels of the
Techniques: Expressing, Control, Staining, Transfection, Knockdown
Journal: Cells
Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy
doi: 10.3390/cells14231852
Figure Lengend Snippet: Inhibition of Cx43 in SMA slice cultures led to significantly lower WT-like Ca 2+ response in murine MN. ( A , B ) 24 h incubation of WT MNs with the SN from SMA slice cultures (SMA) caused a significant increase in the Ca 2+ response compared to incubation with the SN from WT mice slice culture (Control) (** p = 0.0076), measured by Fluo-4 staining to visualize Ca 2+ processes (green). MNs incubated with SMA slice culture SN that had Cx43 inhibited (SMA + Gap27) caused a significant decrease in the Ca 2+ response compared to incubation with the untreated SMA supernatant (** p = 0.002). SMA + Gap27 SN showed a result comparable to the control ( p = 0.82). n = three independent experiments, scale bar 100 μm. ( C , D ) After acquiring the results from ( A ), the change in the spontaneous Ca 2+ response in MNs to SN of SMA or SMA + Gap27 slice cultures was measured. Acute introduction of SMA + Gap27 slice culture supernatant to WT MNs (application at 500 frames = 1 min) showed a significant decrease in Ca 2+ spike amplitude compared to treatment with the SMA supernatant, visualized with Fluo-4 staining in all vial cells (* p < 0.05). ( E ) ΔF/F0 calcium imaging traces of SMA and SMA + Gap27 MN. ( F ) AUC of ΔF/F0 calcium imaging traces displayed in mean with 95% CI. MN treated with supernatant (SMA + Gap27) showed a reduced AUC (*** p < 0.001). n = three cell cultures per condition, each consisting of six embryonic mice, with at least 30 cells/experiment/condition measured. Scale bar 10 μm, analysis was conducted using unpaired Student’s t -tests and ANOVA. Abbreviations: MN, motor neuron; SMA, spinal muscular atrophy; SN, supernatant; WT, wild-type.
Article Snippet: Expression levels of the
Techniques: Inhibition, Incubation, Control, Staining, Imaging
Journal: Cells
Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy
doi: 10.3390/cells14231852
Figure Lengend Snippet: Glutamate assay showed increased expression in SMA, reversible by inhibiting Cx43. ( A ) Slice cultures showed higher glutamate levels in SMA compared to WT (*** p < 0.001). Gap27 treatment (200 µM) in SMA resulted in a decrease in glutamate levels (*** p < 0.001) to the level of WT ( p = 0.1). ( B ) Murine cell cultures also showed higher glutamate levels when SMN was knocked down (*** p < 0.001), with the levels decreasing with 200 µM Gap27 (*** p < 0.001) to the level of WT ( p = 0.85). ( C ) Similarly, hiAstrocytes showed increased glutamate levels when SMN was knocked down (*** p < 0.001). This significantly decreased after treatment with 200 µM Gap27 ( p < 0.001) to the level of the control ( p = 0.92). Analysis was conducted using unpaired Student’s t -tests. Abbreviations: SMA, spinal muscular atrophy; SMN, survival of motor neuron; WT, wild-type. hiAstrocytes, human induced astrocytes.
Article Snippet: Expression levels of the
Techniques: Glutamate Assay, Expressing, Control
Journal: Nature Communications
Article Title: Pre-symptomatic Caspase-1 inhibitor delays cognitive decline in a mouse model of Alzheimer disease and aging
doi: 10.1038/s41467-020-18405-9
Figure Lengend Snippet: a Il-1β and Il-18 mRNA levels in the hippocampus at 4-week ( n = 4 WT + veh, 3 J20 + veh, 3 J20 + VX mice), 12-week ( n = 4 WT + veh, 3 J20 + veh, 3 J20 + VX mice) and 20-week ( n = 4 mice per group) WO. b IL-1β western blots showing hippocampal inactive (pro-) and active (Δ) IL-1β per group at 4- and 20-week WO. c – h IL-1β western blot quantification in the hippocampus and cortex comparing ( c , f ) pro IL-1β, ( d , g ) ΔIL-1β and ( e , h ) total IL-1β at ( c – e ) 4-week WO, and ( f – h ) 20-week WO [cortical ΔIL-1β 20-week WO F(2,7) = 12.03, p = 0.0054, ANOVA, Dunnett’s post hoc compared to WT + vehicle]. In ( c – h ), n = 7 mice per group in 4-week WO hippocampus; n = 8 WT + veh, 7 J20 + veh, 7 J20 + VX mice in 20-week WO hippocampus; n = 3 per group in 4- and 20-week WO cortex. i ELISA measuring total hippocampal and cortical IL-1β levels at 4-week ( n = 7 WT + veh, 7 J20 + veh, 8 J20 + VX mice), 12-week ( n = 8 WT + veh, 6 J20 + veh, 7 J20 + VX mice) and 20-week ( n = 8 WT + veh, 7 J20 + veh, 7 J20 + VX mice) WO. j Casp1 and Casp6 mRNA levels in the hippocampus at 4-week ( n = 4 WT + veh, 3 J20 + veh, 3 J20 + VX mice), 12- ( n = 4 WT + veh, n J20 + veh, 3 J20 + VX mice) and 20-week ( n = 4 mice per group) WO. Data represents mean and s.e.m. ** p < 0.01.
Article Snippet:
Techniques: Western Blot, Enzyme-linked Immunosorbent Assay
Journal: Scientific reports
Article Title: Characterizing SSTR2 expression and modulation for targeted imaging and therapy in preclinical models of triple-negative breast cancer.
doi: 10.1038/s41598-025-94578-x
Figure Lengend Snippet: Fig. 1. Baseline SSTR2 expression varies in mouse mammary carcinoma cell lines. (a) Representative Western blot showing mouse mammary carcinoma cell lines basal expression of SSTR2 (~ 76 kDa) relative to β-actin (42 kDa). ThermoFisher MagicMark XP ladder is in the left lane and H727 pulmonary NET cells are used as a positive control. (b) Immunohistochemical data showing somatostatin expression in untreated syngeneic EO771 (top) and 4T1 (bottom) mouse breast cancer tumors with matched hematoxylin and eosin slides. Scale bar represents 50 µm. (c) Quantification of SSTR2 IHC staining in untreated EO771 and 4T1 tumors via MATLAB code (n = 7). (d) Cellular uptake of [52Mn]Mn-DOTATATE shows EO771 cells have significantly higher uptake compared to 4T1 cells (p = 0.0003 for 0.001, p = 0.0004 for 0.01, p = 0.0087 for 0.1). Uptake was normalized to milligram of protein and represented as % cell uptake/mg of protein (n = 4 per group).
Article Snippet: The sequences of the PCR primers used for the analysis of mRNA expression of
Techniques: Expressing, Western Blot, Positive Control, Immunohistochemical staining, Immunohistochemistry
Journal: Scientific reports
Article Title: Characterizing SSTR2 expression and modulation for targeted imaging and therapy in preclinical models of triple-negative breast cancer.
doi: 10.1038/s41598-025-94578-x
Figure Lengend Snippet: Fig. 2. PET imaging reveals model-dependent differences in SSTR2 expression. (a) Representative images from EO771 and 4T1 tumor-bearing mice taken 60-min post-injection of 100 ± 20 µCi [68Ga]Ga-DOTATATE on day 0. ROIs encircling tumors are represented by grey dotted circles. (b) Frequency histogram distributions for [68Ga]Ga-DOTATATE uptake in EO771 and 4T1 tumors are represented as the average ± standard deviation, comparison of the two models, and individual animals from each model. (c) SUV values are significantly higher for EO771 tumors compared to 4T1 tumors in the top 10% (p = 0.0014) of frequency distributions (n = 12 for EO771, n = 17 for 4T1).
Article Snippet: The sequences of the PCR primers used for the analysis of mRNA expression of
Techniques: Imaging, Expressing, Injection, Standard Deviation, Comparison
Journal: Scientific reports
Article Title: Characterizing SSTR2 expression and modulation for targeted imaging and therapy in preclinical models of triple-negative breast cancer.
doi: 10.1038/s41598-025-94578-x
Figure Lengend Snippet: Fig. 3. SAHA increases expression of SSTR2 at the transcriptional, translational, and functional levels of two TNBC cell lines. (a) qRT-PCR shows 4 × increase (p < 0.0001 for 1.7 µM and 3.3 µM) in mRNA expression of Sstr2 expression in EO771 cells treated with SAHA compared to control. (b) qRT-PCR shows 2 × change (p = 0.001 for 3 µM) and almost 8 × increase (p = 0.0009 for 5 µM) in Sstr2 mRNA in 4T1 cells treated with SAHA compared to control. Flow cytometry demonstrates increased cell surface expression of SSTR2 for EO771 (p < 0.0001 for 1.7 µM and 3.3 µM) and 4T1 (p = 0.0001 for 3 µM, p = 0.0006 for 5 µM) cells following SAHA treatment compared to DMSO control (c, d). Cell binding assay with [52n]Mn-DOTATATE shows increased uptake of somatostatin analogue in 4T1 (p < 0.0001 for 3 µM and 5 µM) and EO771 (p = 0.002 for 1.7 µM, p < 0.0001 for 3.3 µM) cells compared to DMSO control after HDACi for 48 h (e, f).
Article Snippet: The sequences of the PCR primers used for the analysis of mRNA expression of
Techniques: Expressing, Functional Assay, Quantitative RT-PCR, Control, Flow Cytometry, Cell Binding Assay
Journal: Scientific reports
Article Title: Characterizing SSTR2 expression and modulation for targeted imaging and therapy in preclinical models of triple-negative breast cancer.
doi: 10.1038/s41598-025-94578-x
Figure Lengend Snippet: Fig. 4. HDAC inhibition increases SSTR2 expression and overall survival in vivo. (a) Representative images from EO771 and 4T1 tumor-bearing mice at day 0 and 7 of treatment with SAHA (n = 12 EO771, n = 17 4T1) or saline for control animals (n = 4) taken 60-min post-injection of 100 ± 20 µCi [68Ga]Ga-DOTATATE. (b) Quantification of the highest voxel, SUVmax, of [68Ga]Ga-DOTATATE uptake normalized to muscle is significantly increased in EO771 tumors following treatment with SAHA (p = 0.0583). (c) Quantification of SUV shows that radiotracer uptake is significantly higher after treatment with SAHA in the top 10% (right, p = 0.0113) of the frequency distribution for EO771 tumors. (e) [68Ga]Ga-DOTATATE SUVmax normalized to heart and muscle is significantly increased in 4T1 tumors following treatment with SAHA (p = 0.014). (f) SUV uptake in the top 10% (p = 0.0448) of the distribution is significantly increased after SAHA treatment in 4T1 tumors. Overall survival is significantly increased for animals with EO771 tumors (d, p = 0.0043) and 4T1 tumors (g, p = 0.023) treated with SAHA.
Article Snippet: The sequences of the PCR primers used for the analysis of mRNA expression of
Techniques: Inhibition, Expressing, In Vivo, Saline, Control, Injection