Journal: Cells

Article Title: The Effect of Ursodeoxycholic Acid (UDCA) on Serum Expression of miR-34a and miR-506 in Patients with Chronic Cholestatic Liver Diseases

doi: 10.3390/cells14151137

Figure Lengend Snippet: Basal serum expression levels of miR-34a and miR-506 in patients with PBC and PSC before the introduction of UDCA treatment. miR-34a ( A ) expression was significantly elevated in PBC patients compared to age- and sex-matched healthy controls, while no significant difference was observed in PSC patients due to high intra-group variability. miR-506 ( B ) expression was markedly elevated—by several-dozen-fold—in PBC patients relative to controls. Comparisons between experimental groups were performed using the Mann–Whitney U test. Data are presented as mean ± SEM. Abbreviations: PBC, primary biliary cholangitis; PSC, primary sclerosing cholangitis; UDCA, ursodeoxycholic acid.

Article Snippet: The levels of miR-34a (478048_mir) and miR-506 (478958_mir), along with miR-16 (477860_mir), which was used as an endogenous control, were measured using TaqMan ® Advanced miRNA Assays (Applied Biosystems).

Techniques: Expressing, MANN-WHITNEY

Journal: Cells

Article Title: The Effect of Ursodeoxycholic Acid (UDCA) on Serum Expression of miR-34a and miR-506 in Patients with Chronic Cholestatic Liver Diseases

doi: 10.3390/cells14151137

Figure Lengend Snippet: The effect of UDCA treatment on the serum expression of miR-34a and miR-506. UDCA suppressed the expression of miR-34a ( A ) and miR-506 ( C ) in patients with PBC but not PSC ( B ). Each symbol represents one patient. A Student’s paired t -test was used to test statistical significance. The median duration of UDCA administration was 44 months (range: 22–56 months). PBC, primary biliary cholangitis; PSC, primary sclerosing cholangitis; UDCA naive, values before the introduction of ursodeoxycholic acid; UDCA, after treatment with UDCA.

Article Snippet: The levels of miR-34a (478048_mir) and miR-506 (478958_mir), along with miR-16 (477860_mir), which was used as an endogenous control, were measured using TaqMan ® Advanced miRNA Assays (Applied Biosystems).

Techniques: Expressing

Journal: Cells

Article Title: The Effect of Ursodeoxycholic Acid (UDCA) on Serum Expression of miR-34a and miR-506 in Patients with Chronic Cholestatic Liver Diseases

doi: 10.3390/cells14151137

Figure Lengend Snippet: Effects of UDCA on LPS-induced expression of TREM-2, miR-34a, and ADAM17 in NHC cell lines. qPCR analysis demonstrated that TREM-2 ( A ) was not induced by LPS stimulation alone; however, co-treatment with UDCA resulted in activation of this gene. The LPS-induced expression of miR-34a ( B ) and ADAM17 ( C ) mRNA was significantly suppressed by co-treatment with UDCA. Data are presented as mean ± SEM from four independent experiments. Statistical analysis was performed using two-way ANOVA followed by Fisher’s least significant difference (LSD) test. Abbreviations: ADAM17, a disintegrin and metalloprotease 17; LPS, lipopolysaccharide from Escherichia coli; NHC, normal human cholangiocytes; TREM-2, triggering receptor expressed on myeloid cells 2; UDCA, ursodeoxycholic acid.

Article Snippet: The levels of miR-34a (478048_mir) and miR-506 (478958_mir), along with miR-16 (477860_mir), which was used as an endogenous control, were measured using TaqMan ® Advanced miRNA Assays (Applied Biosystems).

Techniques: Expressing, Activation Assay

Journal: International Journal of Molecular Sciences

Article Title: Identification of Endogenous Control miRNAs for RT-qPCR in T-Cell Acute Lymphoblastic Leukemia

doi: 10.3390/ijms19102858

Figure Lengend Snippet: Candidate endogenous normalizer miRNAs.

Article Snippet: hsa-miR-26a-5p , 477995_mir , −3.558 , 0.997 , 91.

Techniques: Selection, Control

Journal: International Journal of Molecular Sciences

Article Title: Identification of Endogenous Control miRNAs for RT-qPCR in T-Cell Acute Lymphoblastic Leukemia

doi: 10.3390/ijms19102858

Figure Lengend Snippet: Amplification efficiency of miRNA assays.

Article Snippet: hsa-miR-26a-5p , 477995_mir , −3.558 , 0.997 , 91.

Techniques: Amplification, Control

Journal: International Journal of Molecular Sciences

Article Title: Identification of Endogenous Control miRNAs for RT-qPCR in T-Cell Acute Lymphoblastic Leukemia

doi: 10.3390/ijms19102858

Figure Lengend Snippet: Mean raw Cq and standard deviation (SD) values for candidate endogenous normalizer miRNA across analyzed samples with respect to biological groups.

Article Snippet: hsa-miR-26a-5p , 477995_mir , −3.558 , 0.997 , 91.

Techniques: Standard Deviation

Journal: International Journal of Molecular Sciences

Article Title: Identification of Endogenous Control miRNAs for RT-qPCR in T-Cell Acute Lymphoblastic Leukemia

doi: 10.3390/ijms19102858

Figure Lengend Snippet: RefFinder comprehensive ranking score of miRNA expression stability.

Article Snippet: hsa-miR-26a-5p , 477995_mir , −3.558 , 0.997 , 91.

Techniques: Expressing

Journal: Scientific Reports

Article Title: TGF-β1 increases viral burden and promotes HIV-1 latency in primary differentiated human bronchial epithelial cells

doi: 10.1038/s41598-019-49056-6

Figure Lengend Snippet: TGF-β1 upregulates BLIMP-1 by suppressing miR-9-5p. NHBE ALI cultures were treated with recombinant TGF-β1 (or vehicle as control). ( a ) TGF-β1 completely abolishes miR-9-5p expression in NHBE ALI cultures compared vehicle treated control. n = NHBE ALI cultures from three different lungs. ( b ) BEAS-2B airway epithelial cells were transfected with miR-9-5p mimic (20 nM) using lipofectamine RNAiMAX according to manufacturer’s instructions. 48 hours post-transfection, total RNA was isolated and quantitated for BLIMP-1 expression. The miR-9-5p mimic suppress BLIMP-1 mRNA compared to lipofectamine RNAiMAX alone treated cells. n = 3 different experiments using BEAS-2B cells. ( c ) BEAS-2B airway epithelial were transfected with miR-9-5p mimic (20 nM) using lipofectamine RNAiMAX (or lipofectamine RNAiMAX as control). 24 hours following transfection, cells were treated with recombinant TGF-β1. 16 hours following TGF-β1 treatment, total RNA was isolated and quantitated for BLIMP-1 expression. The TGF-β1 increases BLIMP-1 expression and this increase is reversed in cells transfected with miR-9-5p mimic. n = 3 different experiments using BEAS2B cells. *significant (p < 0.05).

Article Snippet: Following 16 hours total RNA was isolated from control and TGF-β treated with NHBE ALI cultures by using the Qiagen RNeasy mini kit (Cat # 74104) and cDNA was reverse transcribed by the Applied Biosystems TaqMan™ Advanced miRNA cDNA synthesis kit (Life Technologies/Applied Biosystems, Cat # A28007) according to the manufacturer’s instruction. qRT-PCR was done using TaqMan™ fast advanced master mix (Life Technologies/Applied Biosystems, Cat # 4444557) in combination with validated TaqMan probes (Life Technologies/Applied Biosystems, hsa-miR-9-5p, Cat # A25576, 478214_mir) according to the manufacturer’s directions. qRT-PCR results are represented as relative quantification normalized against internal control (GAPDH).

Techniques: Recombinant, Expressing, Transfection, Isolation

Journal: Scientific Reports

Article Title: TGF-β1 increases viral burden and promotes HIV-1 latency in primary differentiated human bronchial epithelial cells

doi: 10.1038/s41598-019-49056-6

Figure Lengend Snippet: TGF-β1 increases HIV reservoir load in the bronchial epithelium. Schematic representation of the effects of TGF-β1 on host restriction factors to promote the HIV-1 reservoir load in human bronchial epithelial cells. TGF-β1 increases levels of canonical HIV receptor CCR5. This increases infection of bronchial epithelium by R5-tropic HIV leading to an increased number of integrated HIV DNA. TGF-β1 also suppresses miR-9-5p with a consequent upregulation of its target transcriptional repressor BLIMP-1. Together this leads to increased infection events and latency thereby increasing the viral load in the airway.

Article Snippet: Following 16 hours total RNA was isolated from control and TGF-β treated with NHBE ALI cultures by using the Qiagen RNeasy mini kit (Cat # 74104) and cDNA was reverse transcribed by the Applied Biosystems TaqMan™ Advanced miRNA cDNA synthesis kit (Life Technologies/Applied Biosystems, Cat # A28007) according to the manufacturer’s instruction. qRT-PCR was done using TaqMan™ fast advanced master mix (Life Technologies/Applied Biosystems, Cat # 4444557) in combination with validated TaqMan probes (Life Technologies/Applied Biosystems, hsa-miR-9-5p, Cat # A25576, 478214_mir) according to the manufacturer’s directions. qRT-PCR results are represented as relative quantification normalized against internal control (GAPDH).

Techniques: Infection

Journal: BMC Genomics

Article Title: Oviductal extracellular vesicles miRNA cargo varies in response to embryos and their quality

doi: 10.1186/s12864-024-10429-5

Figure Lengend Snippet: MicroRNA sequences and corresponding assays used for validation experiments by qPCR

Article Snippet: bta-miR-184 , Assay ID 477938_mir , TGGACGGAGAACTGATAAGGGT , 22 , EVs and embryos.

Techniques: Biomarker Discovery, Sequencing

Journal: BMC Genomics

Article Title: Oviductal extracellular vesicles miRNA cargo varies in response to embryos and their quality

doi: 10.1186/s12864-024-10429-5

Figure Lengend Snippet: Differentially abundant miRNAs in embryos related to embryo quality and interactions with BOEC

Article Snippet: bta-miR-184 , Assay ID 477938_mir , TGGACGGAGAACTGATAAGGGT , 22 , EVs and embryos.

Techniques: