|
Addgene inc
ceacam1 grnas ![]() Ceacam1 Grnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc12120064-339-16-28?v=Addgene+inc Average 94 stars, based on 1 article reviews
ceacam1 grnas - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Sino Biological
sars cov 2 rbd ![]() Sars Cov 2 Rbd, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc08189090-222-53-74?v=Sino+Biological Average 92 stars, based on 1 article reviews
sars cov 2 rbd - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Sino Biological
sars cov 2 b 1 1 529 spike ![]() Sars Cov 2 B 1 1 529 Spike, supplied by Sino Biological, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc12047470-511-44-55?v=Sino+Biological Average 95 stars, based on 1 article reviews
sars cov 2 b 1 1 529 spike - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Echelon Biosciences
human obestatin ![]() Human Obestatin, supplied by Echelon Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc04868733-56-0-9?v=Echelon+Biosciences Average 90 stars, based on 1 article reviews
human obestatin - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Proteintech
rab12 ![]() Rab12, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pm26740112-42-53-56?v=Proteintech Average 95 stars, based on 1 article reviews
rab12 - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
|
Proteintech
beclin1 ![]() Beclin1, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc07461939-82-16-24?v=Proteintech Average 96 stars, based on 1 article reviews
beclin1 - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
OriGene
mouse hlxb9 ![]() Mouse Hlxb9, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc04646204-238-11-36?v=OriGene Average 90 stars, based on 1 article reviews
mouse hlxb9 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Sino Biological
sars cov nucleoprotein antibody np ![]() Sars Cov Nucleoprotein Antibody Np, supplied by Sino Biological, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc07577700-24-0-5?v=Sino+Biological Average 96 stars, based on 1 article reviews
sars cov nucleoprotein antibody np - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Sino Biological
tacccatacgatgttccagat tacgtct 30 n a human cd111 nectin ![]() Tacccatacgatgttccagat Tacgtct 30 N A Human Cd111 Nectin, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pm38677283-192-182-194?v=Sino+Biological Average 92 stars, based on 1 article reviews
tacccatacgatgttccagat tacgtct 30 n a human cd111 nectin - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Proteintech
anti nrf2 polyclonal antibodies ![]() Anti Nrf2 Polyclonal Antibodies, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc12366163-73-17-29?v=Proteintech Average 96 stars, based on 1 article reviews
anti nrf2 polyclonal antibodies - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Bioss
mouse monoclonal anti sars cov 2 nucleocapsid protein ![]() Mouse Monoclonal Anti Sars Cov 2 Nucleocapsid Protein, supplied by Bioss, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc08751734-2-0-6?v=Bioss Average 91 stars, based on 1 article reviews
mouse monoclonal anti sars cov 2 nucleocapsid protein - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Sino Biological
sars cov 2 s2 ![]() Sars Cov 2 S2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/microscope-related+software/pmc09364789-329-28-32?v=Sino+Biological Average 96 stars, based on 1 article reviews
sars cov 2 s2 - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Nature Communications
Article Title: CEACAM1 as a mediator of B-cell receptor signaling in mantle cell lymphoma
doi: 10.1038/s41467-025-60208-3
Figure Lengend Snippet: a Left panel. Log 2 fold-change of sgRNA counts between days 14 and 0 ( P < 0.01; two-sided permutation test) are plotted against the Z ratio of mRNA expression between MCL and naïve-B cells ( P < 0.05; two-sided t -test). Right panel. Overlap of selected genes depleted at least twofold and overexpressed in MCL with pan-dependent genes and genes associated with poor prognosis . Numbers in green boxes indicate filtering strategy (see text). b Shown are mean values of selected normalized sgRNA counts on days 0 and 14 from two biological replicates. c Immunoblots show CEACAM1 knockout in JEKO-1 cells transduced with control (gNTC) or CEACAM1 gRNAs (gCC1) followed by anti-IgM antibody stimulation (2 μg/ml, 5 min). d JEKO-1 cells were transduced with indicated sgRNAs, and viable, GFP + -transduced cells were monitored over time by FACS. Shown are the means of GFP+ fractions compared to day-2 samples from three biological replicates. Error bars, SD. * P < 0.05 by a two-sided, paired t -test. e Immunoblots show CEACAM1 knockdown by shRNA in JEKO-1 cells. f Indicated cells were transduced with CEACAM1 shRNA and viable, propidium iodide (PI)-negative cells were assessed by FACS over time. Shown are the means of PI-negative fractions compared to day-2 samples from three biological replicates. Error bars, SD. * P < 0.05, ** P < 0.01 by a two-sided, paired t -test. g CEACAM1 is required for MCL survival in vivo. JEKO-1 cells were transduced with control or CEACAM1 shRNA and intravenously transplanted into NSG mice. Shown are weekly bioluminescence images of six mice/group. h Line graphs show the means of bioluminescence signals measuring tumor growth in mice described in ( g ). Error bars, SEM. * P < 0.05 by a one-sided t -test. i Kaplan–Meier survival analysis of mice shown in ( g ). P value, log - rank test. j Top panel, Generation of double SOX11/CCND1 transgenic (DT) and CEACAM1-deficient mice. Middle panel, Representative FACS plots show MCL-like population (CD19 + CD5 + CD23-). Bottom panel, bar graphs show means of %MCL-like cells from the peripheral blood of indicated mice and sample sizes. Error bars, SD. P values, two-sided unpaired t -test. Source data are provided as a Source Data file.
Article Snippet: To validate the screen results, top- and bottom-strand oligos of control (gNTC) or the top three
Techniques: Expressing, Western Blot, Knock-Out, Transduction, Control, Knockdown, shRNA, In Vivo, Transgenic Assay
Journal: Nature Communications
Article Title: CEACAM1 as a mediator of B-cell receptor signaling in mantle cell lymphoma
doi: 10.1038/s41467-025-60208-3
Figure Lengend Snippet: a – c Box plots show CEACAM1 mRNA expression levels in MCL and other cell types from the datasets GSE2350 ( a , b ) and GSE132929 ( c ). The boxes extend from the 25th to 75th percentiles with the center line as median and whiskers drawn from 10th to 90th percentiles. **** P < 0.0001 by a two-sided Mann–Whitney U - test. GC germinal center, Mem memory, Fo follicular, BL Burkitt lymphoma, DLBCL diffuse large B-cell lymphoma, FL follicular lymphoma, PEL primary effusion lymphoma. d Representative immunoblot analysis of CEACAM1 expression in indicated cells from at least three independent experiments. Numbers below bands represent densitometric values of CEACAM1 signals normalized over GAPDH loading controls. e Flow cytom e try analysis of surface CEACAM1 expression in MCL PDXs compared to CEACAM1-negative RAMOS cells from at least two independent experiments. Live cell gating in this experiment and throughout the study is described in Supplementary Fig. . f Representative immunohistochemistry images showing varying CEACAM1 staining levels for indicated formalin-fixed paraffin-embedded tissue microarrays from three independent experiments. In cHL tissue, background plasma cells are also stained positive. cHL classic Hodgkin lymphoma, CLL chronic lymphocytic leukemia. See Table for a summary of CEACAM1 positivity in specific diseases. Source data are provided as a Source Data file.
Article Snippet: To validate the screen results, top- and bottom-strand oligos of control (gNTC) or the top three
Techniques: Expressing, MANN-WHITNEY, Western Blot, Immunohistochemistry, Staining, Formalin-fixed Paraffin-Embedded, Clinical Proteomics
Journal: Nature Communications
Article Title: CEACAM1 as a mediator of B-cell receptor signaling in mantle cell lymphoma
doi: 10.1038/s41467-025-60208-3
Figure Lengend Snippet: a – e Indicated cell lines were transduced with control or CEACAM1 shRNA, followed by stimulation with anti-IgM (1 μg/mL). a Shown are normalized Ca 2+ signals. **** P < 0.0001 by two-way ANOVA. Data were representative of at least three independent experiments. b , c Immunoblots show effects of CEACAM1 knockdown on BCR signaling components. Data were representative of three independent experiments. d , e Immunoblots show CEACAM1 knockdown (top panels) and its effect on Ca 2+ signals (bottom panels). f Top panel, immunoblots of splenocytes from wild type (+/+) or Ceacam1-deficient (−/−) mouse with indicated antibodies. Bottom panel, Ca 2+ signals of indicated splenic B220 + B cells. Data from ( d – f ) are representative of at least two independent experiments. g CEACAM1 mRNA expression levels in CD19+ sorted MCL cells from peripheral blood (PB) or lymph nodes (LN) analyzed from the GSE70910 dataset . Closed circles or squares represent individual patient samples. Horizontal bars from each group indicate mean mRNA expression. P value is from a two-sided unpaired t -test with Welch’s correction. h CEACAM1 expression is correlated with ibrutinib response. Left panels, FACS plots showing surface CEACAM1 expression on indicated MCL and MZL cell lines. Isotype, negative isotype antibody on Z-138 cells. Right panels, Indicated cell lines were treated with indicated doses of ibrutinib for 4 days, and viable propidium iodide (PI)-negative cells were assessed by flow cytometry. Line graphs showing means of normalized PI-negative fractions from three independent experiments. Error bars, SD. Fifty-percent inhibition concentration (IC 50 ) values were calculated by GraphPad Prism v8. i , j ITIM tyrosine residues are required for BCR signaling. JEKO-1 cells transduced with control (gNTC) or CEACAM1 gRNA (gCC1), followed by reintroducing WT CEACAM1 (4 L), CC1-4L-Y493F/Y520F mutant (YY/FF), or short cytoplasmic tail (4S). Controls or reconstituted cell lines were verified for CEACAM1 expression by FACS using B1.1 antibody ( i ) and stimulated with 1 μg/mL of anti-IgM for 5 min, followed by immunoblotting with indicated antibodies, including the CEACAM1 E1 antibody ( j ). Data from ( i , j ) are representative of at least two independent experiments. Source data are provided as a Source Data file.
Article Snippet: To validate the screen results, top- and bottom-strand oligos of control (gNTC) or the top three
Techniques: Transduction, Control, shRNA, Western Blot, Knockdown, Expressing, Flow Cytometry, Inhibition, Concentration Assay, Mutagenesis
Journal: Nature Communications
Article Title: CEACAM1 as a mediator of B-cell receptor signaling in mantle cell lymphoma
doi: 10.1038/s41467-025-60208-3
Figure Lengend Snippet: a Diagram of sucrose-density gradient fractionation of lipid rafts. b Left panels, Immunoblots of fractions indicated in ( a ) from control or CEACAM1-knockout JEKO-1 cells stimulated with control or anti-IgM antibody (1 μg/ml) for 2 min. Right panels, immunoblot signal quantification of fraction I (red dashed-line box) after normalization to Flotillin-1 and unstimulated controls. Shown are the means of fold changes from three independent experiments. Error bars, SD. ** P < 0.01, * P < 0.05 by a two-sided, paired t -test. ns not significant. c Left panels, Control (gNTC) or CEACAM1 knockout (gCC1) JEKO-1 cells were stimulated with 2 μg/ml anti-IgM antibody for 2 min. Shown are representative cells from confocal immunofluorescence images in Supplementary Fig. of control and IgM-stimulated cells co-stained with anti-FLNA (green) and anti-LYN (red) antibodies, followed by nuclear staining with DAPI (blue). Scale bar, 2 μm. Right panels, quantified fluorescent signals for each cell from the samples described. Shown are the sums of intensities in signal-positive areas per cell in arbitrary units from three independent experiments. Horizontal red bars indicate the mean. Approximately 200 cells from each sample were analyzed. **** P < 0.0001 by a two-sided unpaired t -test. ns not significant. d CEACAM1 is required for lipid-raft assembly. Top panels, Control, CEACAM1 knockout (CC1 KO), or CC1 KO + CEACAM1-4L (4 L) JEKO-1 cells were stimulated with 2 μg/ml anti-IgM antibody for 5 min. Shown are representative confocal immunofluorescence images of control and IgM-stimulated cells stained with anti-CEACAM1 antibody (green), GM1 via cholera toxin B (red), p-SRC Y416 antibody (green), or F-actin via Actin-Stain 555 Phalloidin (red) followed by nuclear staining with DAPI (blue). Scale bar, 10 μm. Bottom panels, quantified fluorescent signals from the samples described in the top panels. Shown are the sums of intensities in signal-positive areas per cell in arbitrary units from three independent experiments. Horizontal red bars indicate the mean. Approximately 200 cells from each sample were analyzed. **** P < 0.0001 by a two-sided unpaired t -test. Source data are provided as a Source Data file.
Article Snippet: To validate the screen results, top- and bottom-strand oligos of control (gNTC) or the top three
Techniques: Fractionation, Western Blot, Control, Knock-Out, Immunofluorescence, Staining
Journal: Nature Communications
Article Title: CEACAM1 as a mediator of B-cell receptor signaling in mantle cell lymphoma
doi: 10.1038/s41467-025-60208-3
Figure Lengend Snippet: a , b Top panels, Proximity ligation assay (PLA) showing interactions (visualized as red dots using Airyscan FAST 2D confocal microscope and a 40x/1.2NA water objective) between CEACAM1 (CC1) and the indicated proteins in JEKO-1 and MINO cells stimulated with 2 μg/ml of anti-IgM antibody for the indicated times. Bottom panels, Quantification of PLA signals shown in the top panels for ~200 cells on average from three independent experiments using QuPath 0.3.2 software. **** P < 0.0001, *** P < 0.001 by a two-tailed unpaired t -test. ns not significant. c , d Immunoprecipitation analysis of CEACAM1 interactions. Top panels, JEKO-1 or MINO cells were stimulated with 2 μg/ml of anti-IgM antibody for the indicated times, and CEACAM1 was immunoprecipitated with a CEACAM1-specific antibody or IgG control antibodies, followed by immunoblotting with the indicated antibodies. One percent of the total lysates was used as an input control. Bottom panels, Quantification of indicated co-IP signals shown in the top panels. Bar graphs show the means and individual densitometric values from three independent experiments for each timepoint normalized to the CEACAM1 pull-down signals. Error bars, SD. *** P < 0.001, ** P < 0.01, * P < 0.05 by a two-sided unpaired t -test. ns not significant. Source data are provided as a Source Data file.
Article Snippet: To validate the screen results, top- and bottom-strand oligos of control (gNTC) or the top three
Techniques: Proximity Ligation Assay, Microscopy, Software, Two Tailed Test, Immunoprecipitation, Control, Western Blot, Co-Immunoprecipitation Assay
Journal: Nature Communications
Article Title: CEACAM1 as a mediator of B-cell receptor signaling in mantle cell lymphoma
doi: 10.1038/s41467-025-60208-3
Figure Lengend Snippet: a Left panel, Immunoprecipitation analysis of CEACAM1 interactions. CEACAM1-knockout JEKO-1 cells were transduced with either full-length (4 L) or N-domain truncated (ΔN) CEACAM1 constructs, stimulated with 2 μg/ml anti-IgM antibody for the indicated times, followed by CEACAM1 immunoprecipitation and immunoblotting with the indicated antibodies. One percent of the total lysates was used as an input control. p-Y, anti-phosphotyrosine antibody clone 4G10. Right panels, Quantification of indicated co-IP signals shown in the left panels. Bar graphs show the means and individual densitometric values from four independent experiments for each timepoint normalized to the CEACAM1 pull-down signals. Error bars, SD. ** P < 0.01, * P < 0.05 by two-way ANOVA. b Proximity ligation assay (PLA) showing interactions (visualized as red dots using Airyscan FAST 2D confocal microscope and a 40x/1.2NA water objective) between 4 L or ΔN and the indicated proteins. c Quantitation of PLA signals shown in ( b ) for 100–300 cells on average from three independent experiments using QuPath 0.3.2 software. Error bars indicate means with S.D. **** P < 0.0001 by two-sided Mann–Whitney U -test. ns not significant. Source data are provided as a Source Data file.
Article Snippet: To validate the screen results, top- and bottom-strand oligos of control (gNTC) or the top three
Techniques: Immunoprecipitation, Knock-Out, Transduction, Construct, Western Blot, Control, Co-Immunoprecipitation Assay, Proximity Ligation Assay, Microscopy, Quantitation Assay, Software, MANN-WHITNEY
Journal: Nature Communications
Article Title: CEACAM1 as a mediator of B-cell receptor signaling in mantle cell lymphoma
doi: 10.1038/s41467-025-60208-3
Figure Lengend Snippet: a Left panel, CEACAM1 suppresses BCR signaling in Z-138 cells. Z-138 cells were transduced with control empty vector (EV), WT CEACAM1 (CC1-4L), or short cytoplasmic tail CEACAM1 (CC1-4S). Transduced cells were stimulated with 2 μg/mL of anti-IgM F(ab’)2 fragments for the indicated times, followed by immunoblot analysis probed with the indicated antibodies. HA, hemagglutinin, a protein tag in-framed with CEACAM1 to detect the 4S isoform. Right panel, Quantification of the immunoblot signals shown in the left panel. Bar graphs show the means of densitometric values from the indicated time points normalized to GAPDH loading controls from two independent experiments. P values, one-sided permutation test. b , c CEACAM1-knockout JEKO-1 cells (gCC1) or Z-138 cells were transduced with either empty vector control or full-length (4 L) CEACAM1 construct, stimulated with 2 μg/ml anti-IgM antibody for the indicated times, followed by CEACAM1 immunoprecipitation and immunoblotting with indicated antibodies. One percent of the total lysates was used as an input control ( b ). The samples shown in ( b ) derive from the same experiment, but different gels for CEACAM1, p-SYK Y352 , SYK, SHP-1, GAPDH, and another for SHP-2 were processed in parallel. Bar graphs show the quantification of the co-IP signals shown in ( c ). Shown are the means of densitometric values from two independent experiments for each timepoint normalized to the CEACAM1 pull-down signals. **** P < 0.0001, *** P < 0.001, ** P < 0.01, * P < 0.05 by two-way ANOVA. d Left panels, Proximity ligation assay (PLA) showing interactions (visualized as red dots using Airyscan FAST 2D confocal microscope and a 40x/1.2NA water objective) between CEACAM1 (CC1) and the indicated proteins in Z-138 cells or Z-138 cells transduced with CEACAM1-4L followed by stimulation with 2 μg/ml of anti-IgM antibody for the indicated times. Right panels, Quantification of PLA signals shown in the right panels for ~200 cells on average from three independent experiments using QuPath 0.3.2 software. **** P < 0.0001 by a two-sided unpaired t -test with Welch’s correction. Source data are provided as a Source Data file.
Article Snippet: To validate the screen results, top- and bottom-strand oligos of control (gNTC) or the top three
Techniques: Transduction, Control, Plasmid Preparation, Western Blot, Knock-Out, Construct, Immunoprecipitation, Co-Immunoprecipitation Assay, Proximity Ligation Assay, Microscopy, Software
Journal: Nature Communications
Article Title: CEACAM1 as a mediator of B-cell receptor signaling in mantle cell lymphoma
doi: 10.1038/s41467-025-60208-3
Figure Lengend Snippet: Following antigen stimulation in B-cell lymphomas with abundant CEACAM1 expression, CEACAM1 binds to FLNA, which anchors to the actin cytoskeleton and lipid rafts, and recruits SYK to the proximity of CD79A/B to enhance BCR activity. In cells with low or no CEACAM1 expression (and potentially low SYK expression), SHP-1 and SHP-2 outcompete for CEACAM1 binding, leading to signal attenuation. Created in BioRender. Ngo, V. (2025) https://BioRender.com/dl16wxh .
Article Snippet: To validate the screen results, top- and bottom-strand oligos of control (gNTC) or the top three
Techniques: Expressing, Activity Assay, Binding Assay
Journal: mAbs
Article Title: A human antibody of potent efficacy against SARS-CoV-2 in rhesus macaques showed strong blocking activity to B.1.351
doi: 10.1080/19420862.2021.1930636
Figure Lengend Snippet: Identification of neutralizing antibodies with a PtY display platform. We first used our preconstructed naïve phage displayed human scFv library to screen binders with biotinylated SARS-CoV-2 RBD protein in the solution phase. After enrichment of phage binders, the scFv DNA from enriched binders was cloned into the yeast display plasmid, resulting in display of scFv on the yeast cell surface. We then performed FACS to isolate potential blocking antibodies that could prevent binding of the SARS-CoV-2 RBD to hACE2. The 0.013% gate contained blocking antibodies with high affinity toward RBD. That is, higher Y axis signal represented higher affinity to labeled RBD, whereas lower X signal represented higher potency in blocking the binding of differently labeled hACE2 to RBD. The potential blocking antibodies were sent for sequencing and transient expression. The purified antibodies were evaluated for affinity, blocking activity, biophysical properties, and virus-neutralizing activity
Article Snippet: The affinity of mAbs for SARS-CoV-2 RBD/S1 and its mutants (SARS-CoV-2 RBD [ACRO, SPD-C52H3], SARS-CoV-2 S1 [ACRO, S1N-C52H4], SARS-CoV-2 RBD [N354D/D364Y] [ACRO, SPD-S52H3], SARS-CoV-2 RBD [V367F] [ACRO, SPD-S52H4], SARS-CoV-2 RBD [N354D] [ACRO, SPD-S52H5], SARS-CoV-2 RBD [W436R] [ACRO, SPD-S52H7],
Techniques: Clone Assay, Plasmid Preparation, Blocking Assay, Binding Assay, Labeling, Sequencing, Expressing, Purification, Activity Assay
Journal: mAbs
Article Title: A human antibody of potent efficacy against SARS-CoV-2 in rhesus macaques showed strong blocking activity to B.1.351
doi: 10.1080/19420862.2021.1930636
Figure Lengend Snippet: Characterization of potential blocking antibodies. (a) Blocking assay was performed by immobilizing 1 µg/ml hACE2 on a plate. Serially diluted antibodies and biotinylated SARS-CoV-2 RBD protein were added for competitive binding to hACE2. IC 50 values were calculated with Prism V8.0 software using a four-parameter logistic curve fitting approach. (b) Epitope binning was carried out by BLI. Biotinylated SARS-CoV-2 RBD was immobilized onto the SA sensor, and a high concentration of the primary antibody was used to saturate its own binding site. Subsequently, a second antibody was applied to compete for the binding site on the SARS-CoV-2 RBD protein. Data were analyzed with Octet Data Analysis HT 11.0 software. (c) Neutralization activities of Ab2001.08 and Ab2001.10 were assessed by live virus assay. Live SARS-CoV-2 and serially diluted (3-fold) antibodies were added to VERO E6 cells. The PRNT 50 values were determined by plotting the plaque number (neutralization percentage) against the log antibody concentration in Prism V8.0 software
Article Snippet: The affinity of mAbs for SARS-CoV-2 RBD/S1 and its mutants (SARS-CoV-2 RBD [ACRO, SPD-C52H3], SARS-CoV-2 S1 [ACRO, S1N-C52H4], SARS-CoV-2 RBD [N354D/D364Y] [ACRO, SPD-S52H3], SARS-CoV-2 RBD [V367F] [ACRO, SPD-S52H4], SARS-CoV-2 RBD [N354D] [ACRO, SPD-S52H5], SARS-CoV-2 RBD [W436R] [ACRO, SPD-S52H7],
Techniques: Blocking Assay, Binding Assay, Software, Concentration Assay, Neutralization
Journal: mAbs
Article Title: A human antibody of potent efficacy against SARS-CoV-2 in rhesus macaques showed strong blocking activity to B.1.351
doi: 10.1080/19420862.2021.1930636
Figure Lengend Snippet: Effects of Fc modification on the ADE activity of JMB2002. (a) Binding of Ab2001.08 and JMB2002 to FcγRs was determined by BLI. His-tagged FcγR was loaded onto the HIS1K sensor, and serially diluted antibodies bound to the receptor on the biosensor. K D values were determined with Octet Data Analysis HT 11.0 software using a 1:1 global fit model. (b-d) ADE activity was measured using a pseudotyped SARS-CoV-2 system containing a luciferase reporter. Pseudotyped viruses were preincubated with serially diluted antibodies for 1 h. The mixture was added to FcγR-expressing cells and incubated at 37°C for 20–28 h. Infection of cells with pseudotyped SARS-CoV-2 was assessed by measuring cell-associated luciferase activity. Trastuzumab was used as the irrelevant IgG control
Article Snippet: The affinity of mAbs for SARS-CoV-2 RBD/S1 and its mutants (SARS-CoV-2 RBD [ACRO, SPD-C52H3], SARS-CoV-2 S1 [ACRO, S1N-C52H4], SARS-CoV-2 RBD [N354D/D364Y] [ACRO, SPD-S52H3], SARS-CoV-2 RBD [V367F] [ACRO, SPD-S52H4], SARS-CoV-2 RBD [N354D] [ACRO, SPD-S52H5], SARS-CoV-2 RBD [W436R] [ACRO, SPD-S52H7],
Techniques: Modification, Activity Assay, Binding Assay, Software, Luciferase, Expressing, Incubation, Infection
Journal: mAbs
Article Title: A human antibody of potent efficacy against SARS-CoV-2 in rhesus macaques showed strong blocking activity to B.1.351
doi: 10.1080/19420862.2021.1930636
Figure Lengend Snippet: Characterization of JMB2002. Binding affinity of JMB2002 for the SARS-CoV-2 RBD (a)/S1 (b) prototype and its variants was determined by BLI. JMB2002 was loaded onto the AHC sensor, and serially diluted antigens were bound to JMB2002 on the biosensor. K D values were determined with Octet Data Analysis HT 11.0 software using a 1:1 global fit model. Blocking activity was assessed using ELISA with hACE2-coated plates. A mixture of biotinylated SARS-CoV-2 RBD (c)/S1 (d) proteins and JMB2002 was added for competitive binding to hACE2. IC 50 values were calculated by Prism V8.0 software using a four-parameter logistic curve fitting approach. Values are displayed as the mean ± standard deviations from three independent experiments. (e) The pseudovirus neutralization activity of JMB2002 was evaluated using a pseudotyped SARS-CoV-2 system, which contained a luciferase reporter. Pseudotyped viruses were preincubated with serially diluted antibodies for 1 h. The mixture was added to hACE2-expressing cells and incubated at 37°C for 20–28 h. Infection of cells with pseudotyped SARS-CoV-2 was assessed by measuring cell-associated luciferase activity. IC 50 values were calculated by plotting the inhibition rate against the log antibody concentration in Prism V8.0 software
Article Snippet: The affinity of mAbs for SARS-CoV-2 RBD/S1 and its mutants (SARS-CoV-2 RBD [ACRO, SPD-C52H3], SARS-CoV-2 S1 [ACRO, S1N-C52H4], SARS-CoV-2 RBD [N354D/D364Y] [ACRO, SPD-S52H3], SARS-CoV-2 RBD [V367F] [ACRO, SPD-S52H4], SARS-CoV-2 RBD [N354D] [ACRO, SPD-S52H5], SARS-CoV-2 RBD [W436R] [ACRO, SPD-S52H7],
Techniques: Binding Assay, Software, Blocking Assay, Activity Assay, Enzyme-linked Immunosorbent Assay, Neutralization, Luciferase, Expressing, Incubation, Infection, Inhibition, Concentration Assay
Journal: mAbs
Article Title: A human antibody of potent efficacy against SARS-CoV-2 in rhesus macaques showed strong blocking activity to B.1.351
doi: 10.1080/19420862.2021.1930636
Figure Lengend Snippet: Prophylactic and therapeutic efficacies of JMB2002 against SARS-CoV-2 infection in rhesus macaques. (a) Schematic representation of the design of the in vivo animal experiment. Five monkeys were divided into three groups: the control group (one animal, C1), prophylactic group (two animals, PA1 and PA2), and therapeutic group (two animals, AC1 and AC2). In the prophylactic group, a single dose of 20 mg/kg JMB2002 was intravenously injected into the animals before SARS-CoV-2 infection. The next day, all monkeys were infected with virus (1 × 10 5 TCID 50 ) via intratracheal inoculation. In the therapeutic group, 50 mg/kg JMB2002 was injected at 1 and 3 dpi, whereas in the control group, a single dose of 20 mg/kg irrelevant IgG control was administered at 1 dpi. (b) The viral load in oropharyngeal swabs was monitored for 7 days by qRT-PCR. The dotted line indicates the copy number detection limit. (c) Histopathological and immunohistochemical characterization of lung tissues. All animals were euthanized and necropsied at 7 dpi. The tissue samples were collected, fixed in 10% formalin solution, embedded in paraffin, sectioned, and stained with hematoxylin and eosin or Masson’s trichrome before observation by light microscopy. Scale bar = 100 μm
Article Snippet: The affinity of mAbs for SARS-CoV-2 RBD/S1 and its mutants (SARS-CoV-2 RBD [ACRO, SPD-C52H3], SARS-CoV-2 S1 [ACRO, S1N-C52H4], SARS-CoV-2 RBD [N354D/D364Y] [ACRO, SPD-S52H3], SARS-CoV-2 RBD [V367F] [ACRO, SPD-S52H4], SARS-CoV-2 RBD [N354D] [ACRO, SPD-S52H5], SARS-CoV-2 RBD [W436R] [ACRO, SPD-S52H7],
Techniques: Infection, In Vivo, Injection, Quantitative RT-PCR, Immunohistochemical staining, Staining, Light Microscopy
Journal: Cell Reports Medicine
Article Title: Modulation of lipid nanoparticle-formulated plasmid DNA drives innate immune activation promoting adaptive immunity
doi: 10.1016/j.xcrm.2025.102035
Figure Lengend Snippet:
Article Snippet: For SARS-CoV-2 spike binding ELISAs in B–7E, assays were performed as above, except for coating with the following proteins where indicated: SARS-CoV-2 wild type spike RBD (Cat# 40592-V08H, Sino Biologicals), SARS-CoV-2 D614G spike (Cat# 40589-V08H8, Sino Biologicals), SARS-CoV-2 B.1.617.2 spike (Cat# 40589-V08H10,
Techniques: Virus, Recombinant, Lysis, Reporter Gene Assay, Cell Stimulation, Electron Microscopy, Luminex, Enzyme-linked Immunospot, Luciferase, Plasmid Preparation, Software, Synthesized
Journal: Oncotarget
Article Title: The role of the obestatin/GPR39 system in human gastric adenocarcinomas
doi: 10.18632/oncotarget.6718
Figure Lengend Snippet: ( A ) Immunocytochemical expression of obestatin and GPR39. 1) Obestatin immunoreactivity was intense and diffuse in the cytoplasm. 2) The preadsorption control was performed applying the primary antibody plus obestatin (10 nmol/mL per control peptide) to positive samples. 3) The expression of GPR39 presented a perinuclear location. 4) The preadsorption control was performed applying the primary antibody plus GPR39 control peptide (10 nmol/mL per control peptide) to positive samples. Images were taken with objective magnification of x20. ( B ) Electron micrograph of obestatin and GPR39 expression. 1) Morphology of the AGS cells in culture. 2) The expression of obestatin in the AGS cells showed a diffuse cytoplasmic pattern. 3) The expression of GPR39 was located in the mature face of the Golgi area. 4) The expression of GPR39 was located in the cell membrane, mainly in the microvilli.
Article Snippet:
Techniques: Expressing
Journal: Oncotarget
Article Title: The role of the obestatin/GPR39 system in human gastric adenocarcinomas
doi: 10.18632/oncotarget.6718
Figure Lengend Snippet: ( A ) Mitogenic effect of obestatin in the AGS cells. AGS cells were treated with FBS (10%, v/v), OB (100 nM and 200 nM), OB-Ab (10 μg/mL), OB (100 nM) plus OB-Ab, CM24, CM48, CM24 + OB-Ab and CM48 + OB-Ab, and cell proliferation was evaluated after 48 h by means of BrdU incorporation. The data were expressed as a percentage of the basal proliferation of the untreated cells (Mean ± SEM). The asterisk (*) denotes P < 0.05 when comparing the OB treated group with the control untreated group; the dagger (#) denotes P < 0.05 when comparing the OB or CM plus OB Ab group with the OB or CM treated group. ( B ) Immunocytochemical expression of Ki67 in AGS cells after 24 hour of proliferation. B1) Control without treatment. B2) 10% FBS. B3) 100nM OB. B4) 100nM OB plus OB-Ab (10 μg/mL). B5) CM24. B6) CM24 plus OB-Ab. B7) CM48. B8) CM48 plus OB-Ab. Objective magnification x20. ( C ) Effect of obestatin on the cytoskeleton reorganization in AGS cells. The AGS cells were stimulated with 200 nM OB for 24 h. Cells were stained with Phalloidin CruzFluor-594 (red) to visualize F-actin and DAPI (blue) to visualize the nucleus. Scale bar 20 μm. The image at the right represents a higher magnification view of the obestatin treated cells (scale bar 40 μm). Obestatin treatment induced cellular elongation with the formation of filopodia-like structures (blue arrows), lamellipodia-like structures (green arrows) and the development of stress fibers (pink arrows). Images are representative for at least three independent experiments. ( D ) Obestatin promotes invasion in AGS cells. Sequential confocal microscopy sections scanned every 5-μm from the membrane to the top of the Matrigel in an inverted invasion assay. Obestatin (200 nM) was used as a chemoattractant. ( E ) Mean fluorescence intensity (a.u.) quantified at the indicated sequential confocal sections. Bars, SEM; *** P < 0.001. ( F ) Migration of AGS cells promoted by obestatin. The AGS cells were treated or not with obestatin (200 nM). The wound was calculated by tracing along the border of the scratch using ImageJ64 analysis software and the following equation: %wound closure = [[wound area (0 h)-wound area (x h)] / wound area (0 h)] × 100. The asterisk (***) denotes P < 0.001 when comparing the treated with the untreated control group. ( G ) Immunoblot analysis of the EMT and the pro-angiogenic activation of obestatin in AGS cells. The AGS cells were stimulated with obestatin (200 nM) for 12, 24, and 48 h and the blots were incubated with the corresponding antibodies to N-cadherin, β-catenin, vimentin, VEGF, VEGF-R2 and PEDF. The protein expression was normalized relative to GAPDH. The data were expressed as mean ± SE obtained from intensity scans of six independent experiments. The asterisk (*, **, ***) denotes P < 0.05, P < 0.01 and P < 0.001 when comparing the treated with the untreated control group.
Article Snippet:
Techniques: BrdU Incorporation Assay, Expressing, Staining, Confocal Microscopy, Invasion Assay, Fluorescence, Migration, Software, Western Blot, Activation Assay, Incubation
Journal: Oncotarget
Article Title: The role of the obestatin/GPR39 system in human gastric adenocarcinomas
doi: 10.18632/oncotarget.6718
Figure Lengend Snippet: ( A ) Effect of GPR39 knockdown by siRNA on obestatin-activated pAkt(S473) and pERK1/2(T202/Y204) in AGS cells. The AGS cells were transfected with GPR39 siRNA prior to obestatin treatment (200 nM, 10 min). GPR39 was expressed as a fold of its level to control siRNA-transfected cells ( n = 3). Activation of Akt [pAkt(S473)] and ERK1/2 [pERK1/2(T202/Y204)] was expressed relative to the control siRNA-transfected cells. ( B ) Effect of SiRNA depletion of GPR39 on obestatin-activated Ki67 expression in AGS cells. The AGS cells were transfected with GPR39 siRNA prior to obestatin treatment (200 nM, 24 h). Expression of Ki67 was denoted as a fold of the respective levels in control siRNA-transfected cells ( n = 3). Equal amounts of protein in each sample were used to assess the expression of GPR39 by western blotting. The level of proteins was expressed as fold change relative to the control siRNA-transfected cells (mean ± SE). The protein expression was normalized relative to actin. The data were expressed as mean ± SE obtained from intensity scans of independent experiments. The asterisk (*) denotes P < 0.05 when comparing the treated control siRNA group with the control siRNA group; the dagger (#) denotes P < 0.05 when comparing the GPR39 siRNA group with the control siRNA group. ( C ) Effect of GPR39 knockdown by siRNA on the immunocytochemical expression of obestatin-activated Ki67 in AGS cells. The AGS cells were transfected with GPR39 siRNA prior to obestatin treatment (200 nM, 24 h). 1) siRNA control without treatment. 2) siRNA GPR39 without treatment. 3) siRNA control plus OB. 4) siRNA GPR39 plus OB. Images were taken with objective magnification x20. ( D ) Effect of GPR39 knockdown by siRNA on the cytoskeleton reorganization in AGS cells. The AGS cells were transfected or not with GPR39 siRNA prior to obestatin treatment (200 nM, 24 h). Cells were stained with Phalloidin CruzFluor-594 (red), anti-GPR39 antibody (green), and DAPI (blue). Scale bar 20 μm. Images are representative for at least three independent experiments.
Article Snippet:
Techniques: Transfection, Activation Assay, Expressing, Western Blot, Staining
Journal: Oncotarget
Article Title: The role of the obestatin/GPR39 system in human gastric adenocarcinomas
doi: 10.18632/oncotarget.6718
Figure Lengend Snippet: Immunohistochemical expression of GPR39 and obestatin in normal stomach. ( A ) There was no GPR39 expression in the mucosal cells of the gastric pits. A weak positivity was observed in parietal cells, whereas an intense immunostaining was present in the chief cells (x4). ( B ) Higher magnification view (x10) of the GPR39 immunostaning in the chief cells. ( C ) Obestatin immunoreactivity was only observed in neuroendocrine cells of oxyntic glands (x4). ( D ) At higher magnification, obestatin producing cells were recognized as small round or spindle cells with brownish staining in the cytoplasm (x10).
Article Snippet:
Techniques: Immunohistochemical staining, Expressing, Immunostaining, Staining
Journal: Oncotarget
Article Title: The role of the obestatin/GPR39 system in human gastric adenocarcinomas
doi: 10.18632/oncotarget.6718
Figure Lengend Snippet: Summary of the characteristics and the obestatin, GPR39 and Ki67 immunostain results of the gastric adenocarcinomas studied
Article Snippet:
Techniques:
Journal: Oncotarget
Article Title: The role of the obestatin/GPR39 system in human gastric adenocarcinomas
doi: 10.18632/oncotarget.6718
Figure Lengend Snippet: ( A ) Immunohistochemical expression of obestatin, GPR39, and Ki67 in a well-differentiated gastric adenocarcinoma. 1) Obestatin expression was negative in all of the well-differentiated adenocarcinoma (right), whereas normal gastric mucosa (left) showed immunoreactivity only in the neuroendocrine cells, (x4). 2) Higher magnification view of the intense obestatin positivity in neuroendocrine cells of the normal gastric mucosa (x20). 3) Obestatin expression was negative in the well-differentiated gastric adenocarcinoma (x20). 4) GPR39 expression was positive in the tumor, whereas no immunostaining was found in the normal gastric mucosa (x4). 5) Higher magnification view of GPR39 positivity (x20). 6) Moderate Ki67 expression in this well-differentiated adenocarcinoma. ( B ) Immunohistochemical expression of obestatin and GPR39 in a poorly differentiated gastric adenocarcinoma. 1) Obestatin expression was negative in all of the gastric adenocarcinomas studied. Positivity for obestatin was only observed in neuroendocrine cells of gastric mucosa (x4). 2) Higher magnification view of obestatin positivity in the neuroendocrine cells (x20). 3) Obestatin was negative in the poorly differentiated gastric adenocarcinoma (x20). 4) GPR39 expression was positive in the tumor, whereas no immunostaining was found in the mucosa (x4). 5) Higher magnification view of GPR39 positivity (x20). 6) Moderate Ki67 expression in this poorly differentiated adenocarcinoma (x20). ( C ) Graphical representation of the Ki67 PI in the studied gastric adenocarcinomas. The asterisk (*, **, ***) denotes P < 0.05, P < 0.01 and P < 0.001 when comparing groups. ( D ) Graphical representation of the GPR39 levels of expression in the studied gastric adenocarcinomas. The asterisk (*, **) denotes P < 0.05 and P < 0.01 when comparing groups.
Article Snippet:
Techniques: Immunohistochemical staining, Expressing, Immunostaining
Journal: Oncotarget
Article Title: The role of the obestatin/GPR39 system in human gastric adenocarcinomas
doi: 10.18632/oncotarget.6718
Figure Lengend Snippet: Materials
Article Snippet:
Techniques: Diagnostic Assay
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Rab12 Regulates Retrograde Transport of Mast Cell Secretory Granules by Interacting with the RILP-Dynein Complex.
doi: 10.4049/jimmunol.1500731
Figure Lengend Snippet: FIGURE 2. Rab12 affects the spatial distri- bution of mast cell SGs. RBL cells were tran- siently cotransfected with 20 mg NPY-mRFP and either 30 mg pEGFP (A) or 30 mg pEGF-CA Rab12 (A) or 30 mg pEGFP-wt Rab 12 (B) as indicated. Twenty-four hours later, cells were either left untreated (UT) or triggered with IgE/ Ag or Ion/TPA for 10 min as indicated. Cells were then fixed and visualized by laser confocal microscopy. Nuclei were stained with DAPI (blue). Arrows in (B) point to perinuclear SGs. Insets are enlargements of the boxed areas showing Rab12 and SGs that are located at tips of cell protrusions. Scale bars, 25 mm. Quanti- tative analyses of the incidence of cells that display perinuclear SGs (C) or SGs localized to cell tips (D) were based on the imaging of at least 30 cells derived from three separate ex- periments. *p , 0.05, **p , 0.01, ***p , 0.001.
Article Snippet: Mouse monoclonal antiTGN38 was from BD Biosciences (Franklin Lakes, NJ); Cy3- and Cy5-conjugated donkey anti-mouse IgG and HRP-conjugated goat antirabbit or anti-mouse IgG were from Jackson Immunoresearch Laboratories (West Grove, PA); monoclonal anti-GFP was from Roche Diagnostics (Indianapolis, IN); monoclonal anti-tubulin and polyclonal anti-RILP were from Santa Cruz Biotechnology (Richmond, CA); polyclonal anti
Techniques: Confocal Microscopy, Staining, Imaging, Derivative Assay
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Rab12 Regulates Retrograde Transport of Mast Cell Secretory Granules by Interacting with the RILP-Dynein Complex.
doi: 10.4049/jimmunol.1500731
Figure Lengend Snippet: FIGURE 3. Cellular location of Rab12 depends on its activation state. (A) RBL cells were transiently cotransfected with 20 mg NPY-mRFP and either 30 mg pEGFP-CN Rab12 or 30 mg pEGFP-CA Rab12 as indicated. Cells were fixed and visualized by laser confocal microscopy. Inset is the enlargement of the boxed area. Arrows point to CA Rab12 that surrounds the SGs. Scale bars, 25 mm. (B) RBL cells were transiently cotransfected with 25 mg pEGFP-wt Rab12 and 25 mg pmStr-Dennd3. After 24 h, cells were either left untreated (UT) or triggered with IgE/Ag for 10 min as indicated. Cells were fixed and visualized by laser confocal microscopy. Arrow points to cell tip–localized Rab12. Scale bars, 25 mm.
Article Snippet: Mouse monoclonal antiTGN38 was from BD Biosciences (Franklin Lakes, NJ); Cy3- and Cy5-conjugated donkey anti-mouse IgG and HRP-conjugated goat antirabbit or anti-mouse IgG were from Jackson Immunoresearch Laboratories (West Grove, PA); monoclonal anti-GFP was from Roche Diagnostics (Indianapolis, IN); monoclonal anti-tubulin and polyclonal anti-RILP were from Santa Cruz Biotechnology (Richmond, CA); polyclonal anti
Techniques: Activation Assay, Confocal Microscopy
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Rab12 Regulates Retrograde Transport of Mast Cell Secretory Granules by Interacting with the RILP-Dynein Complex.
doi: 10.4049/jimmunol.1500731
Figure Lengend Snippet: FIGURE 4. Rab12 is activated in a stimulus-dependent fashion. (A) RBL cell lysates (500 mg) derived from cells that were transfected with either 40 mg pEGFP or 40 mg pEGFP-CA Rab12 as indicated, were incubated for 18 h at 4˚C with GST (20 mg) or GST-RILP-L1 (20 mg) that were immobilized on glutathione agarose beads. Bound proteins were eluted by sample buffer, resolved by SDS-PAGE and analyzed by immunoblotting with anti-GFP Abs. Input = 10% of total protein. (B) RBL cell lysates (500 mg) were incubated for 18 h at 4˚C with immobilized GST (20 mg) or immobilized GST-RILP-L1 (20 mg) in the presence of 1 mM GDPbS or 0.5 mM GTPgS as indicated. Bound proteins were analyzed by SDS-PAGE and immunoblotting with Abs directed against Rab12. Input = 10% of total protein. A representative blot is shown. The amount of active endogenous Rab12 in three independent ex- periments was quantified using the ImageJ software. (C) RBL cells were either left untreated (UT), or triggered with Ca2+ ionophore (Ion, 1 mM) and TPA (50 nM) for 10 min, or sensitized with DNP-specific IgE (0.5 mg/ml) followed by 10-min trigger with DNP-HSA (Ag, 50 ng/ml) as indicated. Cell lysates (500 mg) were then incubated for 18 h at 4˚C with immobilized GST (20 mg) or immobilized GST-RILP-L1 (20 mg), and bound proteins were analyzed by SDS-PAGE and immunoblotting with Abs directed against Rab12. Input = 10% of total proteins. A representative blot is shown. The amount of active endogenous Rab12 in three independent experiments was quantified using the ImageJ software. (D) BMMCs were either left untreated (UT) or sensitized with DNP-specific IgE (1 mg/ml) followed by 10-min trigger with DNP-HSA (Ag, 50 ng/ml). Cell lysates (500 mg) were then incubated for 18 h at 4˚C with immobilized GST (20 mg) or immobilized GST-RILP-L1 (20 mg), and bound proteins were analyzed by SDS-PAGE and immunoblotting with Abs directed against Rab12. Input = 10% of total proteins. A representative blot is shown. The amount of active endogenous Rab12 in three independent experiments was quantified using the ImageJ software. *p , 0.05, **p , 0.01.
Article Snippet: Mouse monoclonal antiTGN38 was from BD Biosciences (Franklin Lakes, NJ); Cy3- and Cy5-conjugated donkey anti-mouse IgG and HRP-conjugated goat antirabbit or anti-mouse IgG were from Jackson Immunoresearch Laboratories (West Grove, PA); monoclonal anti-GFP was from Roche Diagnostics (Indianapolis, IN); monoclonal anti-tubulin and polyclonal anti-RILP were from Santa Cruz Biotechnology (Richmond, CA); polyclonal anti
Techniques: Derivative Assay, Transfection, Incubation, SDS Page, Western Blot, Software
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Rab12 Regulates Retrograde Transport of Mast Cell Secretory Granules by Interacting with the RILP-Dynein Complex.
doi: 10.4049/jimmunol.1500731
Figure Lengend Snippet: FIGURE 5. Rab12 promotes perinuclear clustering of the SGs in a dynein-dependent manner. (A) RBL cells were transiently transfected with 40 mg NPY-mRFP and 24 h later, the cells were subjected to a second transfection with either 35 mg pEGFP (control) or 35 mg pEGFP-CA Rab12 as indicated. Twenty-four hours later, cells were fixed and visualized by laser confocal microscopy. Scale bars, 25 mm. (B) RBL cells were cotransfected with 25 mg pmStr-CA Rab12 and either 25 mg pEGFP (control) or 25 mg pEGFP-CC1 (DN-dynein) as indicated. After 24 h, cells were fixed and immunostained with Abs directed against the endogenous SG marker serotonin followed by HiLyte Plus 647-conjugated secondary Abs. Cells were visualized by laser confocal microscopy. Scale bars, 25 mm. Quantification of the incidence of cells with perinuclear SGs is based on images of at least 30 cells from 3 independent experiments. (C) RBL cells were cotransfected with 25 mg pmStr-wt Rab12 and either 25 mg pEGFP (control) or 25 mg pEGFP-CC1 as indicated. After 24 h, cells were fixed and immunostained with Abs directed against serotonin followed by HiLyte Plus 647–conjugated secondary Abs. Cells were visualized by laser confocal microscopy. Scale bars, 25 mm. Inset is the enlargement of the boxed area showing the colocalization of Rab12 and serotonin. The extent of colocalization between pmStr-wt Rab12 and serotonin in control GFP-expressing cells and in cells coexpressing GFP-CC1 (DN-dynein) was quantified by the Imaris software based on images of 27 cells (GFP) and 29 cells (GFP-CC1) from 3 independent experiments. **p , 0.01.
Article Snippet: Mouse monoclonal antiTGN38 was from BD Biosciences (Franklin Lakes, NJ); Cy3- and Cy5-conjugated donkey anti-mouse IgG and HRP-conjugated goat antirabbit or anti-mouse IgG were from Jackson Immunoresearch Laboratories (West Grove, PA); monoclonal anti-GFP was from Roche Diagnostics (Indianapolis, IN); monoclonal anti-tubulin and polyclonal anti-RILP were from Santa Cruz Biotechnology (Richmond, CA); polyclonal anti
Techniques: Transfection, Control, Confocal Microscopy, Marker, Expressing, Software
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Rab12 Regulates Retrograde Transport of Mast Cell Secretory Granules by Interacting with the RILP-Dynein Complex.
doi: 10.4049/jimmunol.1500731
Figure Lengend Snippet: FIGURE 7. Rab12-regulated minus end transport of the SGs is mediated by RILP. RBL cells were transiently cotransfected with 20 mg NPY-mRFP and either 20 mg pSilencer or 20 mg shRILP. Twenty-four hours later, cells were subjected to a second transfection with 35 mg pEGFP-CA Rab12, and 24 h later the relative expression of RILP mRNA (A) and protein (B) in pSilencer and shRILP-expressing cells was determined by real-time PCR and Western blot analyses, respectively. Cells were fixed and visualized by laser confocal micros- copy (C). Quantification of the incidence of cells with perinuclear SGs was based on the images of at least 30 cells from 3 independent experiments. Scale bars, 25 mm. ***p , 0.001.
Article Snippet: Mouse monoclonal antiTGN38 was from BD Biosciences (Franklin Lakes, NJ); Cy3- and Cy5-conjugated donkey anti-mouse IgG and HRP-conjugated goat antirabbit or anti-mouse IgG were from Jackson Immunoresearch Laboratories (West Grove, PA); monoclonal anti-GFP was from Roche Diagnostics (Indianapolis, IN); monoclonal anti-tubulin and polyclonal anti-RILP were from Santa Cruz Biotechnology (Richmond, CA); polyclonal anti
Techniques: Transfection, Expressing, Real-time Polymerase Chain Reaction, Western Blot
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Rab12 Regulates Retrograde Transport of Mast Cell Secretory Granules by Interacting with the RILP-Dynein Complex.
doi: 10.4049/jimmunol.1500731
Figure Lengend Snippet: FIGURE 8. RILP is a novel effector of Rab12. (A) RBL cell lysates (500 mg) derived from cells transfected with either 40 mg pEGFP (control), 40 mg pEGFP-RILP, or 40 mg pEGFP-RILP-L1 were incubated for 18 h at 4˚C with immobilized GST (20 mg) or GST-Rab12 (20 mg), in the presence of 1 mM GDPbS or 0.5 mM GTPgS as indicated. Bound proteins were analyzed by SDS-PAGE and immunoblotting with anti-GFP Abs. Input = 10% of total protein. Representative blots out of three independent experiments are shown. (B) RBL cell lysates derived from cells transfected with 25 mg pmStr-CA Rab12 and either 25 mg pEGFP or 25 mg pEGFP-RILP, as indicated, were subjected to immunoprecipitation with Abs directed against GFP. Immune complexes were then analyzed by SDS-PAGE and immunoblotting with Abs directed against Rab12 and reprobed with anti-GFP Abs. Arrow points to CA Rab12 that was coimmunoprecipitated with RILP. Input = 10% of total protein. Representative blots out of three independent experiments are shown. (C) RBL cells were either left untreated or sensitized with DNP-specific IgE (0.5 mg/ml) followed by 10-min trigger with DNP-HSA (Ag, 50 ng/ml) as in- dicated. Cell lysates (500 mg) were then incubated for 18 h at 4˚C with immobilized GST (20 mg) or immobilized GST-RILP (20 mg), and bound proteins were analyzed by SDS-PAGE and immunoblotting with Abs directed against Rab12. Input = 10% of total proteins. A representative blot is shown. The amount of active endogenous Rab12 in three independent experiments was quantified using ImageJ software. (D) BMMCs were either left untreated or sensitized with DNP-specific IgE (1 mg/ml) followed by 10-min trigger with DNP-HSA (Ag, 50 ng/ml). Cell lysates (500 mg) were then incubated for 18 h at 4˚C with immobilized GST (20 mg) or immobilized GST-RILP (20 mg), and bound proteins were analyzed by SDS-PAGE and immunoblotting with Abs directed against Rab12. Input = 10% of total proteins. A representative blot is shown. The amount of active endogenous Rab12 in three independent experiments was quantified using the ImageJ software. (E) Schematic presentation of the truncated forms of RILP and RILP-L1 that were used. (F) RBL cell lysates (500 mg) were incubated for 18 h at 4˚C in the presence of 0.5 mM GTPgS with 20 mg immobilized GST, or GST-RILP-N, GST-RILP-C, GST- RILP-L1-N, or GST-RILP-L1-C as indicated. Bound proteins were analyzed by SDS-PAGE and immunoblotting with Abs directed against Rab12. Input = 10% of total protein. Representative blots out of three independent experiments are shown. **p , 0.01.
Article Snippet: Mouse monoclonal antiTGN38 was from BD Biosciences (Franklin Lakes, NJ); Cy3- and Cy5-conjugated donkey anti-mouse IgG and HRP-conjugated goat antirabbit or anti-mouse IgG were from Jackson Immunoresearch Laboratories (West Grove, PA); monoclonal anti-GFP was from Roche Diagnostics (Indianapolis, IN); monoclonal anti-tubulin and polyclonal anti-RILP were from Santa Cruz Biotechnology (Richmond, CA); polyclonal anti
Techniques: Derivative Assay, Transfection, Control, Incubation, SDS Page, Western Blot, Immunoprecipitation, Software
Journal: Journal of immunology (Baltimore, Md. : 1950)
Article Title: Rab12 Regulates Retrograde Transport of Mast Cell Secretory Granules by Interacting with the RILP-Dynein Complex.
doi: 10.4049/jimmunol.1500731
Figure Lengend Snippet: FIGURE 9. Model for Rab12-regulated SG transport. According to our proposed model, Rab12 cycles between an inactive (Rab12-GDP), ERC- localized conformation and a Dennd3-activated form (Rab12-GTP) that associates with the SGs. Active Rab12 then recruits the RILP–dynein complex facilitating MT-dependent minus end transport of the SGs. GTP hydrolysis, stimulated by a yet unidentified Rab12 GAP, inactivates Rab12, resulting in the dissociation of the Rab12-RILP–dynein complex from the SGs, and thus allowing a kinesin motor to mediate their plus end transport. Because CA Rab12 remains trapped in its active conformation, the SGs are prevented from moving to the plus direction and therefore accumulate at the perinuclear region.
Article Snippet: Mouse monoclonal antiTGN38 was from BD Biosciences (Franklin Lakes, NJ); Cy3- and Cy5-conjugated donkey anti-mouse IgG and HRP-conjugated goat antirabbit or anti-mouse IgG were from Jackson Immunoresearch Laboratories (West Grove, PA); monoclonal anti-GFP was from Roche Diagnostics (Indianapolis, IN); monoclonal anti-tubulin and polyclonal anti-RILP were from Santa Cruz Biotechnology (Richmond, CA); polyclonal anti
Techniques:
Journal: Frontiers in Pharmacology
Article Title: NLRC5 Inhibits Inflammation of Secretory Phase Ectopic Endometrial Stromal Cells by Up-Regulating Autophagy in Ovarian Endometriosis
doi: 10.3389/fphar.2020.01281
Figure Lengend Snippet: NLRC5, LC3, Beclin1, p62, IL-6, TNF-α, and β-actin primers for qRT-PCR.
Article Snippet: The primary antibodies recognizing NLRC5 (ab105411, Abcam, Cambridge, MA, USA), LC3 (ab192890, Abcam, Cambridge, MA, USA),
Techniques:
Journal: Frontiers in Pharmacology
Article Title: NLRC5 Inhibits Inflammation of Secretory Phase Ectopic Endometrial Stromal Cells by Up-Regulating Autophagy in Ovarian Endometriosis
doi: 10.3389/fphar.2020.01281
Figure Lengend Snippet: The levels of NLRC5, inflammation, and autophagy in ESCs of patients with endometriosis (n = 5) and patients with leiomyoma (n = 5). (A) Representative image of immunofluorescence staining showing human ESCs displayed long-spindle with positively expressing vimentin and negatively expressing keratin. Photographs were taken at magnifications of 400×. (B , C) Representative western blotting and qRT-PCR showing NLRC5, IL-6, and TNF-α were up-regulated in endometriosis ectopic and eutopic ESCs of patients with endometriosis compared to the ESCs of patients with leiomyoma ( ** P < 0.01 vs. leiomyoma ESCs), and the levels of NLRC5, IL-6, and TNF-α in ectopic ESCs were also significantly higher than in the eutopic ESCs ( ## P < 0.01 vs. eutopic ESCs). Autophagy-related molecules LC3 and Beclin1 were down-regulated in ectopic and eutopic ESCs of patients with endometriosis compared to the ESCs of patients with leiomyoma ( ** P < 0.01 vs. leiomyoma ESCs), and the expression of LC3 and Beclin1 in ectopic ESCs was also significantly lower than in the eutopic ESCs ( ## P < 0.01 vs. eutopic ESCs). (D) Representative ELISA showing IL-6 and TNF-α were up-regulated in endometriosis ectopic and eutopic ESCs of patients with endometriosis compared to the ESCs of patients with leiomyoma ( ** P < 0.01 vs. leiomyoma ESCs), and the levels of IL-6 and TNF-α in ectopic ESCs were also significantly higher than in the eutopic ESCs ( ## P < 0.01 vs. eutopic ESCs). The expression levels of mRNA were normalized with respect to β-actin and were calculated using the 2 -ΔΔCt method. The protein expression levels were quantified by Image J software and normalized to β-actin protein levels. The results are represented as the mean ± SEM from at least three independent experiments.
Article Snippet: The primary antibodies recognizing NLRC5 (ab105411, Abcam, Cambridge, MA, USA), LC3 (ab192890, Abcam, Cambridge, MA, USA),
Techniques: Immunofluorescence, Staining, Expressing, Western Blot, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Software
Journal: Frontiers in Pharmacology
Article Title: NLRC5 Inhibits Inflammation of Secretory Phase Ectopic Endometrial Stromal Cells by Up-Regulating Autophagy in Ovarian Endometriosis
doi: 10.3389/fphar.2020.01281
Figure Lengend Snippet: Effect of NLRC5 over-expression on autophagy in EESCs (n = 7). (A) Representative image of immunofluorescence staining showing NLRC5 and LC3, Beclin1 are present both in the cytoplasm and nucleus, NLRC5 and LC3, Beclin1 were co-located in the nucleus. Photographs were taken at magnifications of 1600×. (B , C) Representative western blotting and qRT-PCR results showing over-expression of NLRC5 by transfection with NLRC5 plasmid significantly promoted NLRC5, LC3 Beclin1 expressions, and inhibited p62 expression when compared with vector group ( ** P < 0.01 vs. vector group). (D) Representative images showing LC3 staining in EESCs infected with GFP-RFP-LC3 adenovirus, over-expression of NLRC5 by transfection with NLRC5 plasmid significantly promoted yellow puncta when compared with vector group. Photographs were taken at magnifications of 1,600×, quantification of mean yellow puncta of 10–15 cells per condition is shown ( ** P < 0.01 vs. vector group). (E) Representative transmission electron microscopy (TEM) showing over-expression of NLRC5 by transfection with NLRC5 plasmid significantly promoted autophagosomes formation when compared with vector group, autophagosomes were highlighted by red arrows (left scale bar: 1μm; right scale bar: 2μm; ** P < 0.01 vs. vector group). The expression levels of mRNA were normalized with respect to β-actin and were calculated using the 2 -ΔΔCt method. The protein expression levels were quantified by Image J software and normalized to β-actin protein levels. The results are represented as the mean ± SEM from at least three independent experiments.
Article Snippet: The primary antibodies recognizing NLRC5 (ab105411, Abcam, Cambridge, MA, USA), LC3 (ab192890, Abcam, Cambridge, MA, USA),
Techniques: Over Expression, Immunofluorescence, Staining, Western Blot, Quantitative RT-PCR, Transfection, Plasmid Preparation, Expressing, Infection, Transmission Assay, Electron Microscopy, Software
Journal: Frontiers in Pharmacology
Article Title: NLRC5 Inhibits Inflammation of Secretory Phase Ectopic Endometrial Stromal Cells by Up-Regulating Autophagy in Ovarian Endometriosis
doi: 10.3389/fphar.2020.01281
Figure Lengend Snippet: Effects of NLRC5 inhibition on autophagy in EESCs (n = 7). (A , B) Representative western blotting and qRT-PCR results showing inhibition of NLRC5 by transfection with siRNA-NLRC5 significantly inhibited NLRC5, LC3 Beclin1 expressions, and promoted p62 expression when compared with those from the scrambled-RNAi group ( ** P < 0.01 vs. scrambled-RNAi group). (C) Representative images showing LC3 staining in EESCs infected with GFP-RFP-LC3 adenovirus; inhibition of NLRC5 by siRNA-NLRC5 transfection significantly inhibited yellow puncta when compared with scrambled-RNAi group. Photographs were taken at magnifications of 1600×, quantification of mean yellow puncta of 10-15 cells per condition is shown ( ** P < 0.01 vs. scrambled-RNAi group). (D) Representative TEM image showing inhibition of NLRC5 by siRNA-NLRC5 transfection significantly inhibited autophagosomes formation when compared with scrambled-RNAi group, autophagosomes were highlighted by red arrows(left scale bar: 1μm; right scale bar: 2μm; ** P < 0.01 vs. scrambled-RNAi group). The expression levels of mRNA were normalized with respect to β-actin and were calculated using the 2 -ΔΔCt method. The protein expression levels were quantified by Image J software and normalized to β-actin protein levels. The results are represented as the mean ± SEM from at least three independent experiments.
Article Snippet: The primary antibodies recognizing NLRC5 (ab105411, Abcam, Cambridge, MA, USA), LC3 (ab192890, Abcam, Cambridge, MA, USA),
Techniques: Inhibition, Western Blot, Quantitative RT-PCR, Transfection, Expressing, Staining, Infection, Software
Journal: The Journal of Biological Chemistry
Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)
doi: 10.1074/jbc.M115.661413
Figure Lengend Snippet: Identification of Nono as a phospho-HLXB9 interacting protein. A, overexpression of HLXB9 shows both its phosphorylated and unphosphorylated isoform. WCE were prepared from MIN6-4N cells transfected with myc-His-tag empty vector (mh-Vector) or plasmids expressing myc-his-tagged HLXB9 (mh-HB9-WT) or the phospho-dead mutant of HLXB9 with alanine substitution at Ser-78 and Ser-80 (mh-HB9-AA). WCE were run on the same gel to generate two Western blots to probe with anti-myc-tag or anti-HB9-PO4 (phospho-HLXB9 antibody). To analyze the bands, the blots were placed side-by-side (indicated by the dotted line). The top band of the doublet in the lane marked mh-HB9-WT corresponds to phospho-HLXB9 because it is not detected with the myc-tag antibody in mh-HB9-AA, and it is detected specifically with anti-HB9-PO4. The bottom band of the doublet corresponds to the unphosphorylated isoform of HLXB9 (HB9-unPO4) because it is not detected with anti-HB9-PO4. β-Actin was used as the loading control. B, large scale co-IP shows the two isoforms of HLXB9 and co-immunoprecipitating proteins. Silver-stained gel of proteins separated on SDS-PAGE after large scale co-IP with a myc-tag antibody using WCE prepared in A. As also seen by Western blot analysis in A, the bands marked SDMS1 and SDMS3 show the doublet in mh-HB9-WT Co-IP (PO4-HB9 and unPO4-HB9) and a single band in mh-HB9-AA corresponding to unPO4-HB9. Bands marked SDMS1, SDMS2, SDMS3, and SDMS4 (that were absent in the mh-Vector lane) were excised from the gel and subjected to mass spectrometry analysis. C, Nono uniquely co-immunoprecipitates with phospho-HLXB9. The number of peptides (total and unique) in the bands excised from the gel shown in B and their corresponding proteins is shown. Several proteins were present in both the mh-HB9-WT and mh-HB9-AA immunoprecipitates. The protein Nono emerged as a phospho-HLXB9-specific partner found only in the co-IP of mh-HB9-WT and not in the co-IP of the phospho-dead mutant of HLXB9 (mh-HB9-AA). D, overexpressed HLXB9 can Co-IP with endogenous Nono. Western blot (WB) probed with anti-myc-tag showing specific co-IP of HLXB9 with Nono using WCE of MIN6-4N cells transfected with mh-HB9-WT. Anti-HA-tag was used as a negative control. Higher exposure (top panel) and lower exposure (bottom panel) of the blot are shown to clearly visualize the input HLXB9 bands. IP, immunoprecipitation. E, endogenous phospho-HLXB9 can co-immunoprecipitate with endogenous Nono. Western blots probed with anti-Nono and anti-HB9 show specific co-IP of endogenous Nono with endogenous phospho-HLXB9 using WCE of MIN6-4N cells. An anti-HA-tag was used as a negative control.
Article Snippet: The following mammalian expression plasmids were used: pcDNA3.1-Myc-His vector (pcDNA3.1-mh) (Invitrogen),
Techniques: Over Expression, Transfection, Plasmid Preparation, Expressing, Mutagenesis, Western Blot, Co-Immunoprecipitation Assay, Staining, SDS Page, Mass Spectrometry, Negative Control, Immunoprecipitation
Journal: The Journal of Biological Chemistry
Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)
doi: 10.1074/jbc.M115.661413
Figure Lengend Snippet: HLXB9 co-localizes with Nono in the nucleus, and co-overexpression of HLXB9 and Nono decreases the overexpression of Nono with translocation of HLXB9 into the cytoplasm. A, endogenous phospho-HLXB9 co-localizes with endogenous Nono in the nucleus. IF images of MIN6-4N cells show endogenous Nono (red) and phospho-HLXB9 (green). DAPI was used to detect the nuclei (blue). A merged image of the red and green IF shows co-localization of Nono and phospho-HLXB9 in subnuclear spots and some regions with phospho-HLXB9 (green) that did not co-localize with Nono. B, overexpression of HLXB9 decreases the level of overexpressed Nono protein. Western blots are shown of WCE and the pellet leftover after WCE preparation from MIN6-4N cells expressing mh-HB9-WT, FLAG-Nono, or both together. Empty vector DNA (Vec) was used to maintain the same amount of DNA in the transfections. The expression of transfected HLXB9 was detected with the anti-myc-tag; Nono was detected with the anti-FLAG-tag and with anti-Nono to detect both endogenous and transfected FLAG-tagged Nono. β-Actin was used as the loading control. Endogenous Nono levels were not affected by HLXB9 overexpression. However, the level of transfected FLAG-Nono was reduced upon HLXB9 overexpression. A similar pattern of bands was seen in the pellet leftover after WCE preparation, indicating that the reduced level of Nono upon HLXB9 overexpression was not due to differential cell lysis in the WCE preparation. C, HLXB9 did not reduce the expression of endogenous Nono protein. Western blot analysis to detect endogenous HLXB9 and Nono using WCE prepared from MIN6-4N cells transfected with control siRNA (siC) or HLXB9 siRNA (siHB9) is shown. p84 was used as the loading control. HLXB9 was significantly knocked down, but that did not affect the level of endogenous Nono. D, co-overexpression of HLXB9 and Nono reduces the level of Nono protein in the nucleus with translocation of HLXB9 to the cytoplasm. Shown is Western blot analysis of subcellular fractionation of CE, NE, and CB/PE from MIN6-4N cells expressing mh-HB9-WT, FLAG-Nono, or both together. Empty vector DNA (Vec) was used to maintain the same amount of DNA in the transfections. The expression of transfected HLXB9 was detected with the anti-myc-tag; Nono was detected with the anti-FLAG-tag; detection of marker proteins (Hsp90 for CE, p84 for NE, and histone H3 for CB/PE) showed minimal cross-contamination of the fractions and also served as loading controls for each fraction. Overexpressed Nono was found in the NE and in the CB/PE, but its level in NE was reduced by HLXB9 overexpression. Overexpressed HLXB9 was mostly located in the CB/PE and with a significant amount in the nucleus, but it was also detected in the CE by Nono overexpression.
Article Snippet: The following mammalian expression plasmids were used: pcDNA3.1-Myc-His vector (pcDNA3.1-mh) (Invitrogen),
Techniques: Over Expression, Translocation Assay, Western Blot, Expressing, Plasmid Preparation, Transfection, FLAG-tag, Lysis, Fractionation, Marker
Journal: The Journal of Biological Chemistry
Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)
doi: 10.1074/jbc.M115.661413
Figure Lengend Snippet: Identification of Cblb as a phospho-HLXB9 target gene. A, the anti-HB9-PO4 antibody specifically recognizes the phosphorylated isoform of HLXB9. WCE and chromatin were prepared from MIN6-4N cells transfected with a plasmid expressing myc-his-tagged HLXB9 (mh-HB9-WT). WCE was used IP with rabbit antibodies anti-myc-tag or anti-HB9-PO4 and detected by Western blot (WB) with mouse anti-myc-tag. Rabbit anti-HA-tag was used as the negative control. The input WCE and anti-myc-tag IP display a doublet corresponding to phospho-HLXB9 and unphosphorylated HLXB9. Anti-HB9-PO4 could specifically immunoprecipitate phospho-HLXB9 corresponding to the top band of the doublet. B, significant enrichment of promoter regions among the anti-HB9-PO4 ChIP-Seq tags. Chromatin prepared from MIN6-4N cells transfected in A was used for ChIP with anti-HB9-PO4. DNA obtained before and after ChIP was used for preparing libraries followed by deep sequencing (ChIP-Seq) and mapping of the anti-HB9-PO4-specific ChIP-Seq tags to the mouse genome. The pie chart shows the percent distribution of tags in the mouse genome (a typical input library, Genomatix) and in the anti-HB9-PO4 ChIP-Seq at the indicated regions; 20% of the anti-HB9-PO4 ChIP-Seq tags were located near promoter regions and selected for further analysis. C, phospho-HLXB9 occupancy is highest at the Arid1b and Cblb gene in cells overexpressing HLXB9. ChIP-quantitative PCR assay for validating the 10 phospho-HLXB9 targets is shown as the percent of input chromatin DNA PCR for each primer pair. Chromatin prepared from MIN6-4N cells expressing mh-HB9-WT was used for anti-HB9-PO4 ChIP. Also shown is a Western blot confirming overexpression of HLXB9 (myc-tag antibody) and β-actin as the loading control. D, endogenous phospho-HLXB9 occupancy is highest at the Cblb gene. ChIP-quantitative PCR assay of the 10 phospho-HLXB9 targets is shown as percent of input chromatin DNA PCR for each primer pair. Chromatin prepared from MIN6-4N cells was used for endogenous anti-HB9-PO4 ChIP. Endogenous phospho-HLXB9 occupancy was only detected at Cblb. E and F, H3K4me3 at Cblb unaffected but reduced H3K27me3 upon HLXB9 knockdown. ChIP-quantitative PCR assay of the 10 phospho-HLXB9 targets is shown as the percent of input chromatin DNA PCR for each primer pair. Chromatin prepared from MIN6-4N cells transfected with control siRNA (siC) or HLXB9 siRNA (siHB9) was used for endogenous anti-H3K4me3 ChIP (E) or H3K27me3 ChIP (F). Also shown is a Western blot confirming knockdown of HLXB9 (HLXB9 antibody) and β-actin as the loading control. In siC versus siHB9, reciprocal H3K4me3 or H3K27me3 at only Cblb was HLXB9 binding-dependent because endogenous phospho-HLXB9 was only found to occupy Cblb (D).
Article Snippet: The following mammalian expression plasmids were used: pcDNA3.1-Myc-His vector (pcDNA3.1-mh) (Invitrogen),
Techniques: Transfection, Plasmid Preparation, Expressing, Western Blot, Negative Control, ChIP-sequencing, Sequencing, Real-time Polymerase Chain Reaction, Over Expression, Binding Assay
Journal: The Journal of Biological Chemistry
Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)
doi: 10.1074/jbc.M115.661413
Figure Lengend Snippet: HLXB9 suppresses the expression of Cblb mRNA by suppressing Cblb promoter activity. A and B, among targets identified by anti-HB9-PO4 ChIP-Seq, the expression of only Arid1b and Cblb was affected by HLXB9. Quantitative RT-PCR is shown of the indicated genes using RNA prepared from MIN6-4N cells transfected with control siRNA (siC) or HLXB9 siRNA (siHB9), empty vector, or mh-HB9-WT. A, Western blot confirming knockdown or overexpression of HLXB9 with anti-HLXB9 or anti-myc-tag, respectively, and β-actin as the loading control. B, HLXB9 knockdown or overexpression regulated the relative mRNA level of only two genes (Arid1b and Cblb). Both were reduced upon HLXB9 overexpression, but only Cblb was increased upon HLXB9 knockdown. Error bar = mean and S.D. from three experiments. * = p < 0.05. C and D, Nono did not regulate the expression of HLXB9 target genes. Shown is quantitative RT-PCR of the indicated genes using RNA prepared from MIN6-4N cells transfected with control shRNA (shC) or Nono shRNA (shNono), FLAG-vector, or FLAG-Nono. A, Western blot confirming knockdown or overexpression of Nono with anti-Nono or anti-FLAG-tag, respectively, and β-actin as the loading control. B, Nono knockdown or overexpression did not regulate the relative mRNA level of any gene. Error bar = mean and S.D. from three experiments. E and F, Cblb promoter activity is suppressed by HLXB9. The promoter region of Cblb (−1078 to +219) located near the sequence identified by anti-HB9-PO4 ChIP-Seq was cloned in the promoter-less luciferase reporter vector PG02 (GeneCopoeia) and analyzed for promoter activity in MIN6-4N cells. RLU for each of the transfections are shown. Compared with the empty vector PG02, the PG02-Cblb plasmid showed significantly high RLU, and co-expression of increasing amounts of HLXB9 suppressed the Cblb promoter activity. Error bar = mean and S.D. from three experiments. * = p < 0.05. A representative Western blot shows the expression of HLXB9 (with anti-myc-tag) in the MIN6-4N cells analyzed for luciferase activity. p84 was used as the loading control. G and H, Cblb expression is down-regulated by the phosphorylated isoform of HLXB9. WCE and RNA were prepared from MIN6-4N cells transfected with control-shRNA (C−) or Men1-shRNA (M−) together with empty vector or mh-HB9-WT. G, Western blot shows the extent of menin knockdown (anti-menin blot) and transfected HLXB9 and increased phospho-HLXB9 in M− (anti-myc-tag blot, top band of the doublet band). H, quantitative RT-PCR shows significantly reduced Cblb mRNA upon menin knockdown in mh-HB9-WT-transfected cells. Error bar = mean and S.D. of a representative experiment performed in triplicate. * = p < 0.05.
Article Snippet: The following mammalian expression plasmids were used: pcDNA3.1-Myc-His vector (pcDNA3.1-mh) (Invitrogen),
Techniques: Expressing, Activity Assay, ChIP-sequencing, Quantitative RT-PCR, Transfection, Plasmid Preparation, Western Blot, Over Expression, shRNA, FLAG-tag, Sequencing, Clone Assay, Luciferase
Journal: The Journal of Biological Chemistry
Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)
doi: 10.1074/jbc.M115.661413
Figure Lengend Snippet: HLXB9 binding motif in the Cblb promoter. A, consensus motif in anti-HB9-PO4 ChIP-Seq tags located at promoter regions. De novo motif analysis from anti-HB9-PO4 ChIP-Seq tag sequences located at promoter regions was performed using Genomatix software. A core sequence ATTTTA was identified that resembles homeodomain-binding consensus (35). B, sequence of the HLXB9 binding motifs in the Cblb promoter. The top line shows the putative HLXB9 binding motifs (red) in the DNA sequence of the Cblb promoter (−741 to −710 region from the transcriptional start site is shown). The bottom line shows nucleotide substitutions (blue) to mutate the motifs by site-directed mutagenesis in the Cblb-promoter construct used in C. C and D, HLXB9 did not suppress the activity of the Cblb promoter containing mutations at the HLXB9 binding motifs. The putative HLXB9 binding motifs shown in B were mutated by site-directed mutagenesis of the PG02-Cblb promoter construct and analyzed for promoter activity in MIN6-4N cells. RLU for each of the transfections are shown. Compared with the empty vector PG02, the PG02-Cblb-SDM2 plasmid showed significantly high RLU and co-expression of increasing amounts of HLXB9 did not suppress the Cblb promoter activity. Error bar = Mean and S.D. from 3 experiments, * = p < 0.05. A representative Western blot shows expression of HLXB9 (with anti-myc-tag) in the MIN6-4N cells analyzed for luciferase activity. p84 was used as the loading control.
Article Snippet: The following mammalian expression plasmids were used: pcDNA3.1-Myc-His vector (pcDNA3.1-mh) (Invitrogen),
Techniques: Binding Assay, ChIP-sequencing, Software, Sequencing, Mutagenesis, Construct, Activity Assay, Transfection, Plasmid Preparation, Expressing, Western Blot, Luciferase
Journal: The Journal of Biological Chemistry
Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)
doi: 10.1074/jbc.M115.661413
Figure Lengend Snippet: Cblb overexpression or HLXB9 knockdown inactivates the oncogenic c-Met pathway. A, overexpression of Cblb or knockdown of HLXB9 decreases c-Met levels. Western blot analysis of the indicated proteins using WCE prepared from MIN6-4N cells transfected (by nucleofection) with empty vector or Cblb expression plasmid, control siRNA (siC), or HLXB9 siRNA (siHB9) and control shRNA (shC) or Nono shRNA (shNono). Cblb overexpression reduced the level of endogenous c-Met. HLXB9 knockdown increased the level of endogenous Cblb and reduced the level of endogenous c-Met. p84 was used as the loading control. The upper band marked pro-c-Met is the glycosylated c-Met precursor form that is cleaved and processed into mature c-Met (lower band) (44). B, reduced cell proliferation from Cblb overexpression but not from HLXB9 or Nono knockdown. An MTT assay assessed cell proliferation of MIN6-4N cells transfected in A. Overexpression of Cblb caused a slight but significant reduction in cell proliferation, but cell proliferation was unaffected upon HLXB9 or Nono knockdown. Note that the Western blots in A were performed using WCE prepared at 96 h post-transfection. Error bar = mean and S.D. from 3 experiments, * = p < 0.05. vec, vector. C, reduced cell migration from Cblb overexpression or HLXB9 knockdown but not from Nono knockdown. Cell migration assay of MIN6-4N cells transfected in A assessed by staining for cells that migrate across a polycarbonate membrane in a Boyden chamber. Stain from the cells was extracted and measured at 560 nm as an index of cell migration. Cblb overexpression or HLXB9 knockdown significantly reduced cell migration. Error bar = mean and S.D. from three experiments. * = p < 0.05. D, soft agar colony formation is unaffected from Cblb overexpression, HLXB9 knockdown, or Nono knockdown. Bright-field microscopy images of colonies (white dots) formed in soft agar by MIN6-4N cells transfected in A. MIN6-4N cells make very small colonies after 4–6 weeks. The number of days to form colonies or the number and size of the colonies was unaffected by Cblb overexpression, HLXB9 knockdown, or Nono knockdown.
Article Snippet: The following mammalian expression plasmids were used: pcDNA3.1-Myc-His vector (pcDNA3.1-mh) (Invitrogen),
Techniques: Over Expression, Western Blot, Transfection, Plasmid Preparation, Expressing, shRNA, MTT Assay, Migration, Cell Migration Assay, Staining, Microscopy
Journal: The Journal of Biological Chemistry
Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)
doi: 10.1074/jbc.M115.661413
Figure Lengend Snippet: Increased phospho-HLXB9, decreased Cblb, and increased c-Met in insulinoma from the conventional mouse model of menin loss (Men1+/−). Shown are images of immunofluorescence for insulin and IHC for the indicated proteins in the pancreas section of an 18-month-old Men1+/− mouse. Insulin staining shows the location of the normal-looking islet (panels on the left) and the large islet tumor that covers the entire viewing field (panels on the right). Compared with a normal-looking insulin-positive islet in the same section, the insulin-positive islet tumor shows increased nuclear staining for HB9 and HB9-PO4 and increased nuclear and cytoplasmic staining for c-Met but almost no staining for Cblb (cytoplasm).
Article Snippet: The following mammalian expression plasmids were used: pcDNA3.1-Myc-His vector (pcDNA3.1-mh) (Invitrogen),
Techniques: Immunofluorescence, Staining
Journal: The Journal of Biological Chemistry
Article Title: Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)
doi: 10.1074/jbc.M115.661413
Figure Lengend Snippet: Increased phospho-HLXB9, decreased Cblb, and increased c-Met in insulinoma from the conditional mouse model of menin loss (RIP-Cre-Men1f/f). Images of immunofluorescence for insulin and IHC for the indicated proteins in pancreas sections from a 12-month-old Men1f/f mouse and RIP-Cre-Men1f/f mouse. Compared with the insulin-positive normal islet (panels on the left), the large insulin-positive islet tumor that covers the entire viewing field (panels on the right) shows increased nuclear staining for HB9 and HB9-PO4, increased nuclear and cytoplasmic staining for c-Met, and decreased staining for Cblb (cytoplasm).
Article Snippet: The following mammalian expression plasmids were used: pcDNA3.1-Myc-His vector (pcDNA3.1-mh) (Invitrogen),
Techniques: Immunofluorescence, Staining
Journal: Cell Stem Cell
Article Title: Three-Dimensional Human Alveolar Stem Cell Culture Models Reveal Infection Response to SARS-CoV-2
doi: 10.1016/j.stem.2020.10.004
Figure Lengend Snippet: SARS-CoV-2 Infectivity in Human 3D Alveolar and Bronchial Cultures (A) Schematic diagram outlining the method for SARS-CoV-2 infection in h3ACs and human 3D bronchial cultures (h3BCs). To infect these models, h3ACs and h3BCs were collected and broken to expose the luminal space. Then, the pieces of h3ACs and h3BCs were incubated with SARS-CoV-2 at multiplicity of infection (MOI) of 0.1 or 1.0 for 2 h. (B) Representative images for plaque assay using SARS-CoV-2 infected cells at 3 dpi. Dilution factors are shown in the right upper corner. Scale bar, 1 cm. (C) Plaque assay showing that SARS-CoV-2 actively replicates in h3ACs at 1 dpi. Data are presented as mean ± SEM (n = 2, two plaque assays at each time point). h3ACs at passages 2–3 from two donors and h3BCs at passage 2 from two donors were used in the plaque assays. (D) qPCR analysis measuring the viral N gene transcripts of SARS-CoV-2 in lysed h3ACs with MOI of 0.1 and 1.0 and in supernatant of h3ACs with MOI of 1.0. Data are presented as mean ± SEM (n = 3, three qPCR assays at each time point). h3ACs at passages 1–3 from three donors and h3BCs at passage 2 from two donors were used in the experiment. (E) The viability of Vero cells remarkably decreases at 2 days after SARS-CoV-2 infection, whereas that of h3ACs does not significantly change. Data are presented as mean ± SEM (n = 2, three measurements of luminescence at each time point). h3ACs at P0 from one donor were used in the experiment.
Article Snippet:
Techniques: Infection, Incubation, Plaque Assay
Journal: Cell Stem Cell
Article Title: Three-Dimensional Human Alveolar Stem Cell Culture Models Reveal Infection Response to SARS-CoV-2
doi: 10.1016/j.stem.2020.10.004
Figure Lengend Snippet: Confocal Imaging of SARS-CoV-2-Infected h3ACs (A) Representative image of IF staining of ACE2 (green) and HTII-280 (red) in h3ACs. All replicates (n = 5 at passage 1–2 from three donors) of control h3ACs express ACE2 and HTII-280. Scale bar, 50 μm. (B) Representative image of IF staining of TMPRSS2 (green) and pro-SFTPC (red) in h3ACs. All replicates (n = 5 at passage 1–2 from three donors) of control h3ACs express TMPRSS2 and pro-SFTPC. Scale bar, 50 μm. (C) Representative images of an infected h3AC at 1 dpi. Viral components (NP or dsRNA; green) are co-stained with pro-SFTPC (red). At 1 dpi, SARS-CoV-2 highly infects h3ACs, which show a punctated pattern of pro-SFTPC. n ≥ 5 replicates of infected h3ACs; P2–P3 from three donors. Scale bar, 50 μm. (D) Representative images of an infected h3AC expressing ACE2 (red). SARS-CoV-2 are identified by viral dsRNA (green) or NP (green). Viral dsRNA appears punctated. n ≥ 5 replicates of infected h3ACs; P2–P3 from three donors. Scale bar, 50 μm.
Article Snippet:
Techniques: Imaging, Infection, Staining, Expressing
Journal: Cell Stem Cell
Article Title: Three-Dimensional Human Alveolar Stem Cell Culture Models Reveal Infection Response to SARS-CoV-2
doi: 10.1016/j.stem.2020.10.004
Figure Lengend Snippet: Transmission Electron Microscopic Imaging Analysis of SARS-CoV-2-Infected h3ACs at 2 Days after Infection (A) Low-magnification representative image of infected h3ACs (n = 10 h3ACs from three donors; P2–P3). Red asterisks, alveolar space; white arrowheads, aggregated viral particles; white dashed line, hAT2 cell membrane. Vc, large pathologic vacuoles; Nu, nucleus. (B) Lamellar bodies (blue arrow) are observed. (C) hAT2 cells with a high density of SARS-CoV-2 particles. Viral particles are dispersed in a cytoplasm of the cell (red arrow). (D) Multiple viral particles included in the vesicular structures (red arrow). (E) Virus particles secreted to the lumen of the h3AC. (F) Partial image of another infected h3AC. (G) Virus particles encapsulated in vesicular structures (red arrow). (H) Virus-containing vesicles aggregated in the vicinity of ER (yellow arrow). (I) Double-membrane vesicles (red arrowhead) located near zippered ER (yellow arrowhead). (J) Viral particles secreted into the lumen of a h3AC (red arrows). Microvilli (black arrow) are shown at the apical side of a hAT2 cell. Scale bars, 1 μm.
Article Snippet:
Techniques: Transmission Assay, Imaging, Infection
Journal: Cell Stem Cell
Article Title: Three-Dimensional Human Alveolar Stem Cell Culture Models Reveal Infection Response to SARS-CoV-2
doi: 10.1016/j.stem.2020.10.004
Figure Lengend Snippet: Single-Cell Transcriptome Analysis of Uninfected and Infected h3ACs (A) Five experimental conditions of the dataset in the UMAP plot. hpi, hours post infection. (B) Unsupervised UMAP clustering of uninfected and infected h3ACs. (C) Normalized levels of SARS-CoV-2 viral UMI counts in each experimental condition. (D) Normalized levels of SARS-CoV-2 viral UMI counts in the UMAP plot. Highly infected cells (viral UMI counts per 10,000 human UMI counts ≥2 9 ) are mostly enriched in cluster 6. (E) Expression of genes showing general features of h3ACs in the dataset.
Article Snippet:
Techniques: Infection, Expressing
Journal: Cell Stem Cell
Article Title: Three-Dimensional Human Alveolar Stem Cell Culture Models Reveal Infection Response to SARS-CoV-2
doi: 10.1016/j.stem.2020.10.004
Figure Lengend Snippet: Gene Markers for Each of the Cluster and Estimation of the Number of Viruses Entering a Host Cell (A) Heatmap showing highly expressed variable genes in each cluster. The most significantly variable genes (≤10) in each cluster are shown. Level_CoV2, l o g 2 level of SARS-CoV-2 UMI counts per 10,000 human UMI counts; normalized read counts ( ( l o g 2 ) ), UMI counts of a certain gene per 10,000 human UMI counts. (B) Expression of genes that are represented in the uninfected hAT2 cluster ( AQP5 ), the acutely infected hAT2 cluster ( HSPA1A ), lowIFN_lowCoV2 and lowIFN_mod.CoV2 clusters ( IFI27 ), and dying hAT2s_highCoV2 ( PPP1R15A ). (C) Distribution of single-base substitution (variant allele fraction [VAF] = 4.3% in original viral particles) in each cell. (D) Maximum likelihood estimation for the proportion of cells infected with a single virus.
Article Snippet:
Techniques: Expressing, Infection, Variant Assay
Journal: Cell Stem Cell
Article Title: Three-Dimensional Human Alveolar Stem Cell Culture Models Reveal Infection Response to SARS-CoV-2
doi: 10.1016/j.stem.2020.10.004
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Lysis, Modification, Electron Microscopy, SYBR Green Assay, Purification, Plasmid Preparation, Viability Assay, Cytotoxicity Assay, RNA Sequencing Assay, Transmission Assay, Software, Microscopy, Sequencing, Infection
Journal: BMC Veterinary Research
Article Title: Isolation and identification of a new porcine astrovirus 5 demonstrated that oxidative stress enhances porcine astrovirus replication
doi: 10.1186/s12917-025-04939-x
Figure Lengend Snippet: Isolation and Characterization of PAstV5-GX2. ( A ) The PAstV5-GX2 strain was inoculated into PK-15 cells, and CPEs were monitored at various time intervals using microscopy, with the PAstV1-GX1 strain serving as a control. ( B ) PK-15 cells were subjected to either mock infection or infection with the PAstV5-GX2 and PAstV1-GX1 strains. The IFA was conducted at 36 hpi utilizing the nsp1a/1, nsp1a/3, and nsp1a/4 polyclonal antibodies as primary antibodies to detect viral replication. ( C ) Multi-step growth curves for the PAstV5-GX2 and PAstV1-GX1 strains were generated in PK-15 cells. ( D ) The morphology of PAstV5-GX2 viral particles was examined using electron microscopy
Article Snippet: Fluorescein (FITC)–conjugated Goat Anti-Rabbit IgG(H + L) (SA00003-2), CoraLite ® Plus 594-Goat Anti-Rabbit IgG(H + L) (RGAR004),
Techniques: Isolation, Microscopy, Control, Infection, Generated, Electron Microscopy
Journal: BMC Veterinary Research
Article Title: Isolation and identification of a new porcine astrovirus 5 demonstrated that oxidative stress enhances porcine astrovirus replication
doi: 10.1186/s12917-025-04939-x
Figure Lengend Snippet: PAstV infection resulted in oxidative stress. ( A ) PK-15 cells were subjected to either mock infection or infection with PAstV5-GX2 and PAstV1-GX1 at a multiplicity of infection (MOI) of 5. Mitochondrial ROS were assessed at 2, 4, 6, 8, and 12 hpi using the MitoSOX Red probe, with H 2 O 2 treatment at 400 µM serving as a positive control. The fluorescence intensity at each time point was quantified using ImageJ software, and statistically significant differences compared to the mock-infected control were determined through three independent experiments. ( B ) PK-15 cells were subjected to either mock infection or infection with PAstV5-GX2 and PAstV1-GX1 at a MOI of 0.1. Cell lysates were collected at 6, 12, 24, and 36 hpi and subsequently analyzed using Western blotting to evaluate the expression levels of Nrf2, HO-1, Nsp1a-4, and β-actin. The relative expression levels of Nrf2 and HO-1, normalized to β-actin, were quantified using ImageJ software for grayscale analysis. Data shown in Graphs are presented as the mean ± SD. n = 3; ns , p > 0.05; * p < 0.05; **** p < 0.0001. These data represent the results of at least three independent experiments
Article Snippet: Fluorescein (FITC)–conjugated Goat Anti-Rabbit IgG(H + L) (SA00003-2), CoraLite ® Plus 594-Goat Anti-Rabbit IgG(H + L) (RGAR004),
Techniques: Infection, Positive Control, Fluorescence, Software, Control, Western Blot, Expressing
Journal: BMC Veterinary Research
Article Title: Isolation and identification of a new porcine astrovirus 5 demonstrated that oxidative stress enhances porcine astrovirus replication
doi: 10.1186/s12917-025-04939-x
Figure Lengend Snippet: NAC treatment effectively prevented the degradation of Nrf2 and HO-1 induced by PAstV infection. PK-15 cells were infected with either PAstV5-GX2 or PAstV1-GX1 at a MOI of 0.1, followed by either no treatment or treatment with 10 mM NAC. Cell lysates were collected at 6, 12, 24, and 36 hpi and analyzed via Western blot to evaluate the expression levels of Nrf2, HO-1, nsp1a-4, and β-actin. The relative expression levels of Nrf2 and HO-1, normalized to β-actin, were quantified using ImageJ software for grayscale analysis. Data shown in Graphs are presented as the mean ± SD. n = 3; ns , p > 0.05; * p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001. These data represent the results of at least three independent experiments
Article Snippet: Fluorescein (FITC)–conjugated Goat Anti-Rabbit IgG(H + L) (SA00003-2), CoraLite ® Plus 594-Goat Anti-Rabbit IgG(H + L) (RGAR004),
Techniques: Infection, Western Blot, Expressing, Software
Journal: BMC Veterinary Research
Article Title: Isolation and identification of a new porcine astrovirus 5 demonstrated that oxidative stress enhances porcine astrovirus replication
doi: 10.1186/s12917-025-04939-x
Figure Lengend Snippet: Oxidative stress enhances PAstV replication. (A)PK-15 cells were pretreated with 10 mM NAC or 50 µM H 2 O 2 for one hour prior to infection with PAstV5-GX2 and PAstV1-GX1 at a MOI of 0.1, respectively. Following infection, NAC and H 2 O 2 were continuously supplemented in the cell culture medium. At 12, 24, and 36 hpi, the cells were analyzed for mtROS using the MitoSOX Red probe, indicated by red fluorescence, or fixed for IFA to evaluate viral protein levels using a polyclonal antibody against nsp1a/4, indicated by green fluorescence. (B)Simultaneously, cells and supernatants from different treatment groups were collected for total RNA extraction, and virus copy numbers of PAstV5-GX2 and PAstV1-GX1 were measured using RT-qPCR. Data shown in Graphs are presented as the mean ± SD. n = 3; ns , p > 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001. These data represent the results of at least three independent experiments
Article Snippet: Fluorescein (FITC)–conjugated Goat Anti-Rabbit IgG(H + L) (SA00003-2), CoraLite ® Plus 594-Goat Anti-Rabbit IgG(H + L) (RGAR004),
Techniques: Infection, Cell Culture, Fluorescence, RNA Extraction, Virus, Quantitative RT-PCR
Journal: Cell Chemical Biology
Article Title: Acriflavine, a clinically approved drug, inhibits SARS-CoV-2 and other betacoronaviruses
doi: 10.1016/j.chembiol.2021.11.006
Figure Lengend Snippet: ACF inhibits SARS-CoV-2 replication in vitro (A) Cytotoxicity of ACF in four cell culture systems employing cell lines (A549 ACE2+ , Vero cells, HCT-8 cells) and primary human skin fibroblasts (HSF). (B) Inhibition of virus replication by ACF in A549 ACE2+ (left) and Vero (right) cells. The figure shows qRT-PCR analysis of cell culture supernatants infected with SARS-CoV-2 at 1,600 TCID 50 /mL 24 h post-infection. (C) Time-of-addition study. The inhibition of virus replication in A549 ACE2+ cells (left) or Vero cells (right) by ACF added at different times post-infection (time denoted on the x axis). The figure shows qRT-PCR analysis of cell culture supernatants infected with SARS-CoV-2 at 1,600 TCID 50 /mL) 24 h post-infection. All experiments were performed in at least three biological repetitions, each in triplicate. The results are presented as average values with standard deviations (error bars). ∗Significantly different from the control (p < 0.05).
Article Snippet:
Techniques: In Vitro, Cell Culture, Inhibition, Quantitative RT-PCR, Infection
Journal: Cell Chemical Biology
Article Title: Acriflavine, a clinically approved drug, inhibits SARS-CoV-2 and other betacoronaviruses
doi: 10.1016/j.chembiol.2021.11.006
Figure Lengend Snippet: ACF blocks SARS-CoV-2 replication in vitro and ex vivo (A) Inhibition of virus replication by ACF in A549 ACE2+ cells visualized with confocal microscopy. Cells were infected with SARS-CoV-2 in the presence of 500 nM ACF, 10 μM remdesivir (REM), or vehicle control (control) for 24 and 48 h. Cell nuclei are denoted in blue, actin is denoted in red, and SARS-CoV-2 N protein is denoted in green. Each image represents maximum projection of a 5 μm section. Scale bar, 20 μm. (B) Antiviral activity of ACF against SARS-CoV-2 in human airway epithelium (MucilAir). The figure shows qRT-PCR analysis of HAE culture supernatants infected with SARS-CoV-2. REM and PBS were used as controls. The assay was performed at least in duplicate, and median values with range are presented. Two-way ANOVA with Dunnett’s post hoc test indicated that ACF and REM significantly inhibited virus yields during infection course compared with untreated control. (C) Confocal analysis of infected HAE cultures. Cells were infected with SARS-CoV-2 in the presence of 500 nM ACF, 10 μM REM, or vehicle control (control). Mock images illustrate non-infected cells. On day 6 post-infection, cells were fixed and immunostained. Cell nuclei are denoted in blue, actin is denoted in red, and SARS-CoV-2 N protein is denoted in green. Each image represents maximum projection of a 3 μm section. Scale bar, 10 μm.
Article Snippet:
Techniques: In Vitro, Ex Vivo, Inhibition, Confocal Microscopy, Infection, Activity Assay, Quantitative RT-PCR
Journal: Cell Chemical Biology
Article Title: Acriflavine, a clinically approved drug, inhibits SARS-CoV-2 and other betacoronaviruses
doi: 10.1016/j.chembiol.2021.11.006
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Empire Assay, Viability Assay, Isolation, Crystallization Assay, Transgenic Assay, Plasmid Preparation, Construct, Software, Cell Culture
Journal: Journal of Virology
Article Title: Acquisition of Furin Cleavage Site and Further SARS-CoV-2 Evolution Change the Mechanisms of Viral Entry, Infection Spread, and Cell Signaling
doi: 10.1128/jvi.00753-22
Figure Lengend Snippet: Cell lines and SARS-CoV-2 variants used in the study. (A) The levels of hACE2 and hTMPRSS2 expression in Vero cells and their KI derivatives were determined by Western blotting (WB) using antibodies against ACE2 and corresponding secondary fluorescent antibodies. Membranes were scanned on a LI-COR imager. Relative levels of proteins were determined using Empiria Studio software (LI-COR) and normalized to the levels of tubulin-β3. “ns” indicates a nonspecific band. (B) Amino acid sequences of the S protein fragments containing furin cleavage site (FCS). The FCS sequences are underlined. Mutations are indicated in red and blue, and the deletion is shown by dashes. Arrow indicates the position of cleavage in the wild-type S protein.
Article Snippet: After electrophoresis in NuPAGE 4 to 12% gels (Invitrogen), proteins were transferred to nitrocellulose membranes which were processed with the following antibodies: SARS-CoV-2 S1 (no. 40591-T62, Sino Biological),
Techniques: Expressing, Western Blot, Software
Journal: Journal of Virology
Article Title: Acquisition of Furin Cleavage Site and Further SARS-CoV-2 Evolution Change the Mechanisms of Viral Entry, Infection Spread, and Cell Signaling
doi: 10.1128/jvi.00753-22
Figure Lengend Snippet: Four lineages of SARS-CoV-2 infect Vero cell derivatives with different efficiencies. (A) Viral samples were simultaneously titrated by plaque assay on Vero/ACE2 and Vero/dKI-high cells and used in RT-qPCR to determine viral concentrations in genome equivalents per mL (GE/mL). Means and standard deviations (SDs) are presented. Dashed line shows the limit of viral detection in plaque assay. “n.d.” indicates that plaques were not detectable. (B and C) Ratios of viral particle concentrations in the samples, determined in GE/mL, to viral infectious titers, determined in PFU/mL on Vero/ACE2 and Vero/dKI-high cell lines. Significant differences, as shown in panels (A, B, and C) were determined by one-way analysis of variance (ANOVA) Dunnett’s test (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; n = 3). “NA” indicates that statistical analysis is not applicable.
Article Snippet: After electrophoresis in NuPAGE 4 to 12% gels (Invitrogen), proteins were transferred to nitrocellulose membranes which were processed with the following antibodies: SARS-CoV-2 S1 (no. 40591-T62, Sino Biological),
Techniques: Plaque Assay, Quantitative RT-PCR
Journal: Journal of Virology
Article Title: Acquisition of Furin Cleavage Site and Further SARS-CoV-2 Evolution Change the Mechanisms of Viral Entry, Infection Spread, and Cell Signaling
doi: 10.1128/jvi.00753-22
Figure Lengend Snippet: Cell culture-adapted variants of SARS-CoV-2 with mutated FCS replicate more efficiently and to higher titers in Vero/dKI-high cells. Vero/dKI-high cells in 6-well Costar plates were infected with the indicated cell culture-adapted viruses and the corresponding parental isolates at a multiplicity of infection (MOI) of 0.1 PFU/cell. At the indicated times postinfection (p.i.), media were replaced, and viral titers were determined by plaque assay on Vero/dKI-high cells. Significance of differences was determined by two-way ANOVA Tukey’s tests (***, P < 0.001; ****, P < 0.0001; n = 3).
Article Snippet: After electrophoresis in NuPAGE 4 to 12% gels (Invitrogen), proteins were transferred to nitrocellulose membranes which were processed with the following antibodies: SARS-CoV-2 S1 (no. 40591-T62, Sino Biological),
Techniques: Cell Culture, Infection, Plaque Assay
Journal: Journal of Virology
Article Title: Acquisition of Furin Cleavage Site and Further SARS-CoV-2 Evolution Change the Mechanisms of Viral Entry, Infection Spread, and Cell Signaling
doi: 10.1128/jvi.00753-22
Figure Lengend Snippet: All SARS-CoV-2 isolates with intact FCS efficiently formed syncytia in Vero/dKI-cells. Cells were seeded into 6-well Costar plates and infected with the indicated viruses at an MOI of 0.01 PFU/cell. Images were acquired at 18 hours p.i. on an EVOS inverted microscope. Syncytia are indicated by red arrowheads.
Article Snippet: After electrophoresis in NuPAGE 4 to 12% gels (Invitrogen), proteins were transferred to nitrocellulose membranes which were processed with the following antibodies: SARS-CoV-2 S1 (no. 40591-T62, Sino Biological),
Techniques: Infection, Inverted Microscopy
Journal: Journal of Virology
Article Title: Acquisition of Furin Cleavage Site and Further SARS-CoV-2 Evolution Change the Mechanisms of Viral Entry, Infection Spread, and Cell Signaling
doi: 10.1128/jvi.00753-22
Figure Lengend Snippet: Highly potent human neutralizing monoclonal antibody (MAb) and immune serum do not affect syncytium formation by CoV-2/α. Vero/dKI-high cells in 6-well Costar plates were infected with ~100 PFU of CoV-2/α. They were then incubated in Dulbecco’s modified Eagle medium (DMEM) supplemented with 3% fetal bovine serum (FBS) and containing either hMAbs 1213H7 or immune serum 7,000 at concentrations of 4 μg/mL and 1:100 dilution, respectively. At 2 days p.i., cells were fixed with 4% paraformaldehyde (PFA) and stained for plaques with crystal violet. The control mock-treated, virus-infected cells were covered by agarose as in the plaque assay (see Materials and Methods). Data were normalized to the number of plaques formed in mock-treated, infected cells under agarose cover. Means and SDs are presented. Significance of differences was determined by one-way ANOVA Dunnett’s test (ns, P > 0.05; n = 3).
Article Snippet: After electrophoresis in NuPAGE 4 to 12% gels (Invitrogen), proteins were transferred to nitrocellulose membranes which were processed with the following antibodies: SARS-CoV-2 S1 (no. 40591-T62, Sino Biological),
Techniques: Infection, Incubation, Modification, Staining, Plaque Assay
Journal: Journal of Virology
Article Title: Acquisition of Furin Cleavage Site and Further SARS-CoV-2 Evolution Change the Mechanisms of Viral Entry, Infection Spread, and Cell Signaling
doi: 10.1128/jvi.00753-22
Figure Lengend Snippet: Expression of SARS-CoV-2 S protein that lacks FCS induces syncytium formation only in the ACE2-expressing Vero cells, which also overproduce TMPRSS2. (A) Schematic presentation of the VEErep/SΔFCS replicon and aa sequence of the protein fragment with deleted FCS. (B) Packaged replicon was titrated in parallel in 6-well Costar plates on the indicated cell lines. After incubation for 18 h in liquid media, cells were fixed and stained with crystal violet. Wells infected with the same viral dilution are presented.
Article Snippet: After electrophoresis in NuPAGE 4 to 12% gels (Invitrogen), proteins were transferred to nitrocellulose membranes which were processed with the following antibodies: SARS-CoV-2 S1 (no. 40591-T62, Sino Biological),
Techniques: Expressing, Sequencing, Incubation, Staining, Infection
Journal: Journal of Virology
Article Title: Acquisition of Furin Cleavage Site and Further SARS-CoV-2 Evolution Change the Mechanisms of Viral Entry, Infection Spread, and Cell Signaling
doi: 10.1128/jvi.00753-22
Figure Lengend Snippet: Overexpression of TMPRSS2 leads to aberrant processing of the S protein. The indicated cell lines were infected with CoV-2/D614G at an MOI of 1 PFU/cell. They were incubated in serum-free media for 16 h, and then media and cells were harvested. After UV inactivation, virions were pelleted by ultracentrifugation. Supernatants, pelleted virions, and cell lysates were analyzed by WB as described in Materials and Methods.
Article Snippet: After electrophoresis in NuPAGE 4 to 12% gels (Invitrogen), proteins were transferred to nitrocellulose membranes which were processed with the following antibodies: SARS-CoV-2 S1 (no. 40591-T62, Sino Biological),
Techniques: Over Expression, Infection, Incubation
Journal: Journal of Virology
Article Title: Acquisition of Furin Cleavage Site and Further SARS-CoV-2 Evolution Change the Mechanisms of Viral Entry, Infection Spread, and Cell Signaling
doi: 10.1128/jvi.00753-22
Figure Lengend Snippet: Replication of SARS-CoV-2 variants with intact FCS results in secretion of the S1 subunit. (A) Vero/ACE2 cells were infected with the indicated viruses having either intact or mutated FCS. After incubation of infected cells in serum-free medium for 18 h, the presence of S, S1, S2, and N was analyzed in the cell lysates, medium, and supernatants and pellets after UV inactivation and ultracentrifugation. (B) Vero/dKI-low cells were infected with indicated viruses at an MOI of 1 PFU/cell. After incubation in serum-free medium, the presence of S, S1, S2, and N was analyzed in the cell lysates, medium, and supernatants and pellets after UV inactivation and ultracentrifugation (see Materials and Methods).
Article Snippet: After electrophoresis in NuPAGE 4 to 12% gels (Invitrogen), proteins were transferred to nitrocellulose membranes which were processed with the following antibodies: SARS-CoV-2 S1 (no. 40591-T62, Sino Biological),
Techniques: Infection, Incubation
Journal: Journal of Virology
Article Title: Acquisition of Furin Cleavage Site and Further SARS-CoV-2 Evolution Change the Mechanisms of Viral Entry, Infection Spread, and Cell Signaling
doi: 10.1128/jvi.00753-22
Figure Lengend Snippet: Secreted S1 activates TLR4 receptor. (A) HEK293-Blue TLR4 cells were stimulated by S1 (~1 μg/mL) produced by CoV-2/D614G-infected cells (after inactivation with UV) or by VEErep/S-infected cells (without UV inactivation). Lipopolysaccharide (20 ng/mL) and concentrated media from VEErep/GFP-infected cells were used as positive and negative controls, respectively. Signals were read at 20 h post-stimulation. (B) HEK293-Blue TLR4 cells were stimulated by S1 produced by cells infected with VEEV replicons encoding indicated variants of the S protein. Signals were read at 20 h post-stimulation. Significance of differences was determined by one-way ANOVA Dunnett’s test (****, P < 0.0001; n = 3) (C) HEK293-Blue TLR4 cells were stimulated by S1 (~2.5 μg/mL) produced by VEErep/S-infected cells. The levels of activation of cytokine-specific genes were assessed by qPCR as described in Materials and Methods.
Article Snippet: After electrophoresis in NuPAGE 4 to 12% gels (Invitrogen), proteins were transferred to nitrocellulose membranes which were processed with the following antibodies: SARS-CoV-2 S1 (no. 40591-T62, Sino Biological),
Techniques: Produced, Infection, Activation Assay