Journal: Cell reports

Article Title: RGS6 mediates effects of voluntary running on adult hippocampal neurogenesis

doi: 10.1016/j.celrep.2020.107997

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-RGS6 antibodies-online Inc #ABIN634403 Mouse anti-HA.11 Biolegend # MMS-101R Rabbit anti-MCM2 Cell Signaling Technology #4007 Goat anti-DCX Santa Cruz Biotechnology # SC-8066 Rabbit anti-GFAP DAKO #Z0334 Rabbit anti-NeuN Cell Signaling Technology #4007 Rabbit anti-DsRed Takara #632496 Donkey anti-mouse 488 Invitrogen A21202 Donkey anti-mouse 568 Invitrogen A10037 Donkey anti-rabbit 488 Invitrogen A21206 Donkey anti-rabbit 647 Invitrogen {"type":"entrez-protein","attrs":{"text":"A31573","term_id":"87384","term_text":"pir||A31573"}} A31573 Donkey anti-goat 568 Invitrogen A11057 Goat anti-mouse 488 Invitrogen A11029 Goat anti-rabbit 568 Invitrogen A11036 Goat anti-rabbit 568 Invitrogen A11011 Bacterial and Virus Strains Lentivirus-STOP-RGS6-GFP This paper N/A Lentivirus-STOP-GFP This paper N/A Retrovirus- shRgs6 -GFP This paper N/A Retrovirus- shNC -GFP ( Guo et al., 2015 ) N/A Deposited Data Source data associated with RiboTag sequencing This paper GEO: {"type":"entrez-geo","attrs":{"text":"GSE142678","term_id":"142678"}} GSE142678 Experimental Models: Organisms/Strains Mouse: C57BL/6J Jackson Laboratory RRID:IMSR_JAX:000664 Mouse: Tg(Nestin-cre/ERT2) Jackson Laboratory RRID:IMSR_JAX:016261 Mouse: RPL22 HA/WT Jackson Laboratory RRID:IMSR_JAX:029977 Mouse: Ascl1tm1(Cre/ERT2)Jejo/J Jackson Laboratory RRID:IMSR_JAX:012882 Mouse: B6;129S6-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J Jackson Laboratory RRID:IMSR_JAX:007914 Mouse: Nestin-GFP Yamaguchi et al., 2000 ) ( Yamaguchi et al., 2000 ) Oligonucleotides Rgs6 Forward: GGATCGCTGATCCAGAAGAG This study N/A Rgs6 Reverse: GGGGATTTTGGAGAGAAAGC This study N/A Pgk1Forward: CTCCGCTTTCATGTAGAGGAAG This study N/A Pgk1Reverse: GACATCTCCTAGTTTGGACAGTG This study N/A Recombinant DNA Retro-CAG-GFP-shRgs6 This study N/A Retro-shNC ( Gao et al., 2015 ) N/A Retro-CAG-RFP ( Zhao et al., 2006 ) N/A Lenti-GFP-Control This study N/A Lenti-GFP-RGS6 This study N/A Software and Algorithms Prism GraphPad https://www.graphpad.com ; RRID:SCR_002798 ImageJ National Institute of Health https://imagej.nih.gov/ij/docs/guide/user-guide.pdf ANYmaze Stoelting https://www.stoeltingco.com/anymaze.html RStudio https://rstudio.com/ WGCNA ( Langfelder and Horvath, 2008 ) g:Profiler https://biit.cs.ut.ee/gprofiler/gost Monocle ( Trapnell et al., 2014 ) Open in a separate window KEY RESOURCES TABLE

Techniques: Virus, Sequencing, Recombinant, Software

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression