mef2 Search Results


94
Developmental Studies Hybridoma Bank uas mcd8gfp mef2 mcd8gfp
Uas Mcd8gfp Mef2 Mcd8gfp, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/uas mcd8gfp mef2 mcd8gfp/product/Developmental Studies Hybridoma Bank
Average 94 stars, based on 1 article reviews
uas mcd8gfp mef2 mcd8gfp - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

91
Proteintech mef 2 isoform a d
Mef 2 Isoform A D, supplied by Proteintech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mef 2 isoform a d/product/Proteintech
Average 91 stars, based on 1 article reviews
mef 2 isoform a d - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

93
Proteintech mef 2a
Mef 2a, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mef 2a/product/Proteintech
Average 93 stars, based on 1 article reviews
mef 2a - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Boster Bio antibody against lamp1
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
Antibody Against Lamp1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody against lamp1/product/Boster Bio
Average 93 stars, based on 1 article reviews
antibody against lamp1 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology mef2 antibody
(A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with <t>anti-MEF2</t> antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.
Mef2 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mef2 antibody/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
mef2 antibody - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

86
Santa Cruz Biotechnology gatcgctctaaaaataaccctgtcg 3 sense
(A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with <t>anti-MEF2</t> antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.
Gatcgctctaaaaataaccctgtcg 3 Sense, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gatcgctctaaaaataaccctgtcg 3 sense/product/Santa Cruz Biotechnology
Average 86 stars, based on 1 article reviews
gatcgctctaaaaataaccctgtcg 3 sense - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
Promega mef2-luciferase assay
(A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with <t>anti-MEF2</t> antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.
Mef2 Luciferase Assay, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mef2-luciferase assay/product/Promega
Average 90 stars, based on 1 article reviews
mef2-luciferase assay - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
AECOM International Development s59-mef2-ht d-gal4 (line 10-2a)
(A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with <t>anti-MEF2</t> antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.
S59 Mef2 Ht D Gal4 (Line 10 2a), supplied by AECOM International Development, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/s59-mef2-ht d-gal4 (line 10-2a)/product/AECOM International Development
Average 90 stars, based on 1 article reviews
s59-mef2-ht d-gal4 (line 10-2a) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Verlag GmbH m9 (mef2) binding sites
(A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with <t>anti-MEF2</t> antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.
M9 (Mef2) Binding Sites, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m9 (mef2) binding sites/product/Verlag GmbH
Average 90 stars, based on 1 article reviews
m9 (mef2) binding sites - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Genomatix gmbh predicted mef2 sites
(A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with <t>anti-MEF2</t> antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.
Predicted Mef2 Sites, supplied by Genomatix gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/predicted mef2 sites/product/Genomatix gmbh
Average 90 stars, based on 1 article reviews
predicted mef2 sites - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Lonza cell nucleofection solution mef-2
(A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with <t>anti-MEF2</t> antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.
Cell Nucleofection Solution Mef 2, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cell nucleofection solution mef-2/product/Lonza
Average 90 stars, based on 1 article reviews
cell nucleofection solution mef-2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GeNOsys Inc oligonucleotides containing different cox-2 promoter sites
(A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with <t>anti-MEF2</t> antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.
Oligonucleotides Containing Different Cox 2 Promoter Sites, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotides containing different cox-2 promoter sites/product/GeNOsys Inc
Average 90 stars, based on 1 article reviews
oligonucleotides containing different cox-2 promoter sites - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and Lamp1 in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.

Journal: bioRxiv

Article Title: Fasting reverses PLN R14del-mediated cardiomyopathy through lysosomal reactivation

doi: 10.64898/2026.03.24.713684

Figure Lengend Snippet: A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and Lamp1 in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.

Article Snippet: Sections were then blocked for 5 min with 1% BSA-c/VG and incubated for 1 hour at room temperature with a primary antibody against Lamp1 (1:10, Boster Biological Technology, DZ01398-1).

Techniques: Staining, Two Tailed Test, Variant Assay, Immuno-Electron Microscopy, Ex Vivo, Functional Assay

(A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.

Journal: PLoS ONE

Article Title: Transcriptional Regulation of Mesoderm Genes by MEF2D during Early Xenopus Development

doi: 10.1371/journal.pone.0069693

Figure Lengend Snippet: (A) Quantitative PCR analysis of MEF2A and MEF2D transcripts from fertilization to gastrula stages. Experiment was performed two independent times. (B) 4 cell embryos were analyzed by ISH using probes to mef2a and mef2d . (C) Left panels: Stage 8 embryos were dissected to animal and vegetal halves. RNA and proteins were extracted. RNA was analyzed by RT-PCR reaction and proteins by Western analysis. Right panel: Immunohistochemistry of stage 8 embryos. Animal-vegetal sections were prepared. Sections were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right panel is an enlargement of a segment of the left panel. (D) Left panel: Hemisected stage 9 embryos were analyzed by ISH using probes to mef2a and mef2d . Right panel: Sections of stage 9 embryos were reacted with anti-MEF2 antibodies (orange) and counterstained with hematoxylin. The right end panel is an enlargement of a segment of the left panel. Arrows point at stained nuclei. (E) Left panel: Stage 10.5 embryos were analyzed by in situ hybridization using a probe to mef2d . Right panel: x3 Mef2-Luc reporter (30 pg) was injected to one cell embryo (20 embryos). At early gastrula stage (10.25), DMZ and VMZ explants were isolated and luciferase was measured. Luciferase activity was normalized to the total protein levels. Data are presented as means ± SE of three independent experiments.

Article Snippet: Protein extracts (20 μg) in binding buffer (10% glycerol, 2 mM spermidine, 0.1 mg/ml bovine serum albumin, 2 mM MgCl 2 , 0.02% Nonidet P-40, 0.1 mM EDTA, 50 mM KCl, 10 mM HEPES, pH 7.9) were incubated with unlabeled competitor DNA (500 ng of poly(dI-dC)-poly(dI-dC)) or MEF2 antibody (2 μl, Anti-MEF2, Santa Cruz C21) on ice for [30 min] prior to the addition of the radioactive probe.

Techniques: Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunohistochemistry, Staining, In Situ Hybridization, Injection, Isolation, Luciferase, Activity Assay

(A) Upper panel: Western blot analysis of MEF2D protein extracted from control embryos and MEF2D AMO-injected embryos at different stages from fertilization to late gastrula stages. Lower panel: Embryos were injected with different concentrations of MEF2D-Flag mRNA, without or with AMO to MEF2D. MEF2D-Flag protein was detected by Western blot analysis using anti Flag antibodies (M2, Sigma). (B) Control uninjected embryos, MEF2D AMO-injected embryos and mismatch-AMO injected embryos. Left panel: Stage 12 embryos; MEF2D AMO delays blastopore closure. Right panel; Western blot of endogenous MEF2D from uninjected, MEF2D AMO and mismatch AMO-injected embryos. (C) Stage 26 embryos that were injected with different amounts of MEF2D AMO and mismatch AMO. (D) Transverse sections in the trunk region of stage 26 control uninjected embryo (left panel) and MEF2D AMO-injected embryo (right panel). The scheme at the right shows the position where sections were performed. Abbreviations: Sm-Somite; Nt-Notochord; S.c-Spinal cord.

Journal: PLoS ONE

Article Title: Transcriptional Regulation of Mesoderm Genes by MEF2D during Early Xenopus Development

doi: 10.1371/journal.pone.0069693

Figure Lengend Snippet: (A) Upper panel: Western blot analysis of MEF2D protein extracted from control embryos and MEF2D AMO-injected embryos at different stages from fertilization to late gastrula stages. Lower panel: Embryos were injected with different concentrations of MEF2D-Flag mRNA, without or with AMO to MEF2D. MEF2D-Flag protein was detected by Western blot analysis using anti Flag antibodies (M2, Sigma). (B) Control uninjected embryos, MEF2D AMO-injected embryos and mismatch-AMO injected embryos. Left panel: Stage 12 embryos; MEF2D AMO delays blastopore closure. Right panel; Western blot of endogenous MEF2D from uninjected, MEF2D AMO and mismatch AMO-injected embryos. (C) Stage 26 embryos that were injected with different amounts of MEF2D AMO and mismatch AMO. (D) Transverse sections in the trunk region of stage 26 control uninjected embryo (left panel) and MEF2D AMO-injected embryo (right panel). The scheme at the right shows the position where sections were performed. Abbreviations: Sm-Somite; Nt-Notochord; S.c-Spinal cord.

Article Snippet: Protein extracts (20 μg) in binding buffer (10% glycerol, 2 mM spermidine, 0.1 mg/ml bovine serum albumin, 2 mM MgCl 2 , 0.02% Nonidet P-40, 0.1 mM EDTA, 50 mM KCl, 10 mM HEPES, pH 7.9) were incubated with unlabeled competitor DNA (500 ng of poly(dI-dC)-poly(dI-dC)) or MEF2 antibody (2 μl, Anti-MEF2, Santa Cruz C21) on ice for [30 min] prior to the addition of the radioactive probe.

Techniques: Western Blot, Control, Injection

(A) Chromatin immunoprecipitation (ChIP): Embryos were injected with mRNA encoding MEF2D-Flag and at stage 10, crosslinked sheared chromatin was prepared. Chromatin was immunoprecipitated with anti-Flag (polyclonal, Sigma) or with pre immune serum (control) and was subjected to a qPCR reaction with several pairs of primers (left). Expression of the injected MEF2D-Flag protein was analyzed by Western blot (right). (B) Upper panel: Xnr1 promoter sequence (proximal region) with highlighted putative binding sites of MEF2. PE-proximal element; IE1, 2-Intermediate element 1, 2; DE-distal element; TBX1, 2- T box binding sites (VegT) . Arrows show the two transcription start site and “M” the translation initiation codon. Lower panel: EMSA of each of the MEF2 binding elements coupled with protein extracts of stage 9 control embryos as well as embryos injected with mef2d-flag mRNA. Anti-flag antibody (1 µl, 0.1 µg/µl) was included in some reaction mixtures while unlabeled homologous double stranded oligonucleotides in 100 fold excess over the probe was included in others, as indicated. Unbound probes are not shown. Arrow indicates the MEF2D-DNA complex. Arrowhead indicates the Anti MEF2-MEF2D-DNA complex. (C) 293T HEK cells were transfected as indicated. Thirty six hours later, proteins were extracted and luciferase activity was measured and was normalized to total protein levels. Activity of the reported gene with an empty vector was set to a value of 1 and values of other treatments were standardized accordingly. Means of two independent experiments are presented.

Journal: PLoS ONE

Article Title: Transcriptional Regulation of Mesoderm Genes by MEF2D during Early Xenopus Development

doi: 10.1371/journal.pone.0069693

Figure Lengend Snippet: (A) Chromatin immunoprecipitation (ChIP): Embryos were injected with mRNA encoding MEF2D-Flag and at stage 10, crosslinked sheared chromatin was prepared. Chromatin was immunoprecipitated with anti-Flag (polyclonal, Sigma) or with pre immune serum (control) and was subjected to a qPCR reaction with several pairs of primers (left). Expression of the injected MEF2D-Flag protein was analyzed by Western blot (right). (B) Upper panel: Xnr1 promoter sequence (proximal region) with highlighted putative binding sites of MEF2. PE-proximal element; IE1, 2-Intermediate element 1, 2; DE-distal element; TBX1, 2- T box binding sites (VegT) . Arrows show the two transcription start site and “M” the translation initiation codon. Lower panel: EMSA of each of the MEF2 binding elements coupled with protein extracts of stage 9 control embryos as well as embryos injected with mef2d-flag mRNA. Anti-flag antibody (1 µl, 0.1 µg/µl) was included in some reaction mixtures while unlabeled homologous double stranded oligonucleotides in 100 fold excess over the probe was included in others, as indicated. Unbound probes are not shown. Arrow indicates the MEF2D-DNA complex. Arrowhead indicates the Anti MEF2-MEF2D-DNA complex. (C) 293T HEK cells were transfected as indicated. Thirty six hours later, proteins were extracted and luciferase activity was measured and was normalized to total protein levels. Activity of the reported gene with an empty vector was set to a value of 1 and values of other treatments were standardized accordingly. Means of two independent experiments are presented.

Article Snippet: Protein extracts (20 μg) in binding buffer (10% glycerol, 2 mM spermidine, 0.1 mg/ml bovine serum albumin, 2 mM MgCl 2 , 0.02% Nonidet P-40, 0.1 mM EDTA, 50 mM KCl, 10 mM HEPES, pH 7.9) were incubated with unlabeled competitor DNA (500 ng of poly(dI-dC)-poly(dI-dC)) or MEF2 antibody (2 μl, Anti-MEF2, Santa Cruz C21) on ice for [30 min] prior to the addition of the radioactive probe.

Techniques: Chromatin Immunoprecipitation, Injection, Immunoprecipitation, Control, Expressing, Western Blot, Sequencing, Binding Assay, Transfection, Luciferase, Activity Assay, Plasmid Preparation

(A) ISH of stage 9 vegetally-injected embryos (Mef2D-Flag mRNA) using antisense Brachyury probe (left). Arrows point at punctate staining. MEF2D-Flag mRNA was injected marginally to one cell embryos. RNA was extracted from whole embryos (n = 18) at stages 10.5 and the expression levels of the indicated genes was analyzed by semi quantitative RT-PCR (right). (B) mRNA encoding MEF2-VP16 chimera was injected to one cell embryos. Left panel: Stage 10.5 embryos were analyzed by ISH using antisense probe to brachyury . Right panel: Two blastomere embryos were injected unilaterally with MEF2-VP16 and βGAL mRNA and grown to stage 16. ISH with a probe to myod was performed. The injected side was identified by βGAL staining. (C) MEF2-VP16 mRNA was injected marginally to one cell embryos. RNA was extracted from VMZ explants (n = 18) at stages 10.25 (left) and 14 (right) and analyzed by semi quantitative RT-PCR.

Journal: PLoS ONE

Article Title: Transcriptional Regulation of Mesoderm Genes by MEF2D during Early Xenopus Development

doi: 10.1371/journal.pone.0069693

Figure Lengend Snippet: (A) ISH of stage 9 vegetally-injected embryos (Mef2D-Flag mRNA) using antisense Brachyury probe (left). Arrows point at punctate staining. MEF2D-Flag mRNA was injected marginally to one cell embryos. RNA was extracted from whole embryos (n = 18) at stages 10.5 and the expression levels of the indicated genes was analyzed by semi quantitative RT-PCR (right). (B) mRNA encoding MEF2-VP16 chimera was injected to one cell embryos. Left panel: Stage 10.5 embryos were analyzed by ISH using antisense probe to brachyury . Right panel: Two blastomere embryos were injected unilaterally with MEF2-VP16 and βGAL mRNA and grown to stage 16. ISH with a probe to myod was performed. The injected side was identified by βGAL staining. (C) MEF2-VP16 mRNA was injected marginally to one cell embryos. RNA was extracted from VMZ explants (n = 18) at stages 10.25 (left) and 14 (right) and analyzed by semi quantitative RT-PCR.

Article Snippet: Protein extracts (20 μg) in binding buffer (10% glycerol, 2 mM spermidine, 0.1 mg/ml bovine serum albumin, 2 mM MgCl 2 , 0.02% Nonidet P-40, 0.1 mM EDTA, 50 mM KCl, 10 mM HEPES, pH 7.9) were incubated with unlabeled competitor DNA (500 ng of poly(dI-dC)-poly(dI-dC)) or MEF2 antibody (2 μl, Anti-MEF2, Santa Cruz C21) on ice for [30 min] prior to the addition of the radioactive probe.

Techniques: Injection, Staining, Expressing, Quantitative RT-PCR

(A) ISH analysis of hemisected embryos at stage 9 using probes to xnr1 (left) and mef2d (right). (B) Mef2-vp16 encoding mRNA was injected marginally to one cell embryos. Stage 10 embryos were analyzed by ISH using an Xnr1 probe. The animal side is presented. (C) One cell embryos were injected with mRNA encoding Xnr1 , MEF2D-AMO or both. Stage 10.5 embryos were analyzed by ISH using antisense Brachyury probe. (D) Injections were performed as in C (each treatment; 18 embryos). RNA was extracted from stage 10.5 embryos and qPCR was performed. Data are presented as means ± SE of three independent experiments with duplicates.

Journal: PLoS ONE

Article Title: Transcriptional Regulation of Mesoderm Genes by MEF2D during Early Xenopus Development

doi: 10.1371/journal.pone.0069693

Figure Lengend Snippet: (A) ISH analysis of hemisected embryos at stage 9 using probes to xnr1 (left) and mef2d (right). (B) Mef2-vp16 encoding mRNA was injected marginally to one cell embryos. Stage 10 embryos were analyzed by ISH using an Xnr1 probe. The animal side is presented. (C) One cell embryos were injected with mRNA encoding Xnr1 , MEF2D-AMO or both. Stage 10.5 embryos were analyzed by ISH using antisense Brachyury probe. (D) Injections were performed as in C (each treatment; 18 embryos). RNA was extracted from stage 10.5 embryos and qPCR was performed. Data are presented as means ± SE of three independent experiments with duplicates.

Article Snippet: Protein extracts (20 μg) in binding buffer (10% glycerol, 2 mM spermidine, 0.1 mg/ml bovine serum albumin, 2 mM MgCl 2 , 0.02% Nonidet P-40, 0.1 mM EDTA, 50 mM KCl, 10 mM HEPES, pH 7.9) were incubated with unlabeled competitor DNA (500 ng of poly(dI-dC)-poly(dI-dC)) or MEF2 antibody (2 μl, Anti-MEF2, Santa Cruz C21) on ice for [30 min] prior to the addition of the radioactive probe.

Techniques: Injection