matlab version 2015a Search Results


machine learning toolbox  (MathWorks Inc)
96
MathWorks Inc machine learning toolbox
Machine Learning Toolbox, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/Statistics+and+Machine+Learning+Toolbox/10__1117_slash_1__jbo__22__1__016002-118-13-16
Average 96 stars, based on 1 article reviews
machine learning toolbox - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier
2015a  (MathWorks Inc)
96
MathWorks Inc 2015a
2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/Image+Processing+Toolbox/pmc06559352-149-12-11
Average 96 stars, based on 1 article reviews
2015a - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier
sox version 14.4.2  (SourceForge net)
90
SourceForge net sox version 14.4.2
Sox Version 14.4.2, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/sox+version+14+4+2/pmc05729191-61-13-17
Average 90 stars, based on 1 article reviews
sox version 14.4.2 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
matlab environment  (MathWorks Inc)
96
MathWorks Inc matlab environment
Matlab Environment, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/Database+Toolbox/pm32663971-79-18-20
Average 96 stars, based on 1 article reviews
matlab environment - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier
grader xw  (MathWorks Inc)
93
MathWorks Inc grader xw
Grader Xw, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/MATLAB+Grader/bio_rxiv__397570-46-13-22
Average 93 stars, based on 1 article reviews
grader xw - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier
laptop with windows 7 and intel® coretm i5 cpu  (Sony)
90
Sony laptop with windows 7 and intel® coretm i5 cpu
Laptop With Windows 7 And Intel® Coretm I5 Cpu, supplied by Sony, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/laptop+with+windows+7+and+intel++coretm+i5+cpu/pmc06339118-187-18-15
Average 90 stars, based on 1 article reviews
laptop with windows 7 and intel® coretm i5 cpu - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
r version 3.3.2, rstudio interface  (RStudio)
90
RStudio r version 3.3.2, rstudio interface
R Version 3.3.2, Rstudio Interface, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/rstudio+version+1+3+1093/pm31761706-157-26-26
Average 90 stars, based on 1 article reviews
r version 3.3.2, rstudio interface - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
psychophysics toolbox  (MathWorks Inc)
96
MathWorks Inc psychophysics toolbox

Psychophysics Toolbox, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/Partial+Differential+Equation+Toolbox/pmc10931819-177-31-34
Average 96 stars, based on 1 article reviews
psychophysics toolbox - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier
pvm-2541 sony  (Sony)
90
Sony pvm-2541 sony

Pvm 2541 Sony, supplied by Sony, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/oled+screen+pvm+1741/pmc07645227-75-25-26
Average 90 stars, based on 1 article reviews
pvm-2541 sony - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
axopatch 200b patch clamp amplifier  (Molecular Devices LLC)
97
Molecular Devices LLC axopatch 200b patch clamp amplifier

Axopatch 200b Patch Clamp Amplifier, supplied by Molecular Devices LLC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/Axopatch+200B-2+capacitor+feedback+patch+clamp+amplifier/pmc05939932-52-31-31
Average 97 stars, based on 1 article reviews
axopatch 200b patch clamp amplifier - by Bioz Stars, 2026-10
97/100 stars
  Buy from Supplier
estradiol elisa kit  (Arbor Assays)
90
Arbor Assays estradiol elisa kit
KEY RESOURCES TABLE
Estradiol Elisa Kit, supplied by Arbor Assays, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/estradiol+elisa+kit/pmc06876991-519-54-58
Average 90 stars, based on 1 article reviews
estradiol elisa kit - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
creatinine urinary detection kit  (Arbor Assays)
90
Arbor Assays creatinine urinary detection kit
KEY RESOURCES TABLE
Creatinine Urinary Detection Kit, supplied by Arbor Assays, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+version+2015a/detect+x+serum+creatinine+detection+kit/pmc06876991-519-66-69
Average 90 stars, based on 1 article reviews
creatinine urinary detection kit - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


Journal: Current Biology

Article Title: High-level aftereffects reveal the role of statistical features in visual shape encoding

doi: 10.1016/j.cub.2023.12.039

Figure Lengend Snippet:

Article Snippet: All experiments were run with an Eizo ColorEdge CG277 LCD monitor (68 cm display size; 1920 × 1200 resolution) on a Mac Mini 2012 2.3 GHz Intel Core i7 with the Psychophysics toolbox in MATLAB version 2015a.

Techniques: Software

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion

doi: 10.1016/j.celrep.2019.09.045

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and Image Acquisition/Image Processing Toolboxes Release 2015a The MathWorks, Inc. https://www.mathworks.com/products/get-matlab.html?s_tid=gn_getml Leica Application Suite X Leica Microsystems https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo/downloads GraphPad Prism version 8.0.0 GraphPad Software https://www.graphpad.com Open in a separate window KEY RESOURCES TABLE A microglia sublineage derived from Hoxb8-expressing precursors serves unique functions Dysfunction of Hoxb8-lineage microglia causes anxiety symptoms and obsessive compulsion Female sex hormones worsen the pathology caused by Hoxb8-lineage microglia dysfunction

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion

doi: 10.1016/j.celrep.2019.09.045

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and Image Acquisition/Image Processing Toolboxes Release 2015a The MathWorks, Inc. https://www.mathworks.com/products/get-matlab.html?s_tid=gn_getml Leica Application Suite X Leica Microsystems https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo/downloads GraphPad Prism version 8.0.0 GraphPad Software https://www.graphpad.com Open in a separate window KEY RESOURCES TABLE A microglia sublineage derived from Hoxb8-expressing precursors serves unique functions Dysfunction of Hoxb8-lineage microglia causes anxiety symptoms and obsessive compulsion Female sex hormones worsen the pathology caused by Hoxb8-lineage microglia dysfunction

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software