mapk Search Results


86
Sangon Biotech tctagcagagcacggatgtgtttg3
Tctagcagagcacggatgtgtttg3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/10__1016_slash_j__isci__2025__113396-606-34-35?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
tctagcagagcacggatgtgtttg3 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech n a p38 mapk r
N A P38 Mapk R, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/10__1016_slash_j__isci__2025__113396-606-37-35?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
n a p38 mapk r - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

96
Proteintech mapk8
Validation of the targeting relationship between let-7a-5p and <t>MAPK8.</t> (A) Schematic representation of the predicted complementary binding site between let-7a-5p and the 3′-UTR of MAPK8. (B) Relative mRNA expression level of MAPK8 in macrophages overexpressing let-7a-5p detected by RT-qPCR. (C) WB analysis of MAPK8 protein expression in macrophages overexpressing let-7a-5p. (D) Inhibitory effect of let-7a-5p on MAPK8 expression was assessed via a dual luciferase reporter assay. ( **P < 0.01, ***P < 0.001).
Mapk8, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/pmc12950549-102-22-23?v=Proteintech
Average 96 stars, based on 1 article reviews
mapk8 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Proteintech ab 144p rabbit anti p erk
Validation of the targeting relationship between let-7a-5p and <t>MAPK8.</t> (A) Schematic representation of the predicted complementary binding site between let-7a-5p and the 3′-UTR of MAPK8. (B) Relative mRNA expression level of MAPK8 in macrophages overexpressing let-7a-5p detected by RT-qPCR. (C) WB analysis of MAPK8 protein expression in macrophages overexpressing let-7a-5p. (D) Inhibitory effect of let-7a-5p on MAPK8 expression was assessed via a dual luciferase reporter assay. ( **P < 0.01, ***P < 0.001).
Ab 144p Rabbit Anti P Erk, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/pmc11925418__cm9___138___702___s001-1-40-45?v=Proteintech
Average 96 stars, based on 1 article reviews
ab 144p rabbit anti p erk - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Proteintech erk1 2
AIF-1 siRNA inhibited the phosphorylation of P38, <t>ERK1/2,</t> JNK, PI3K, AKT, and mTOR proteins in corneal tissues following alkali burn. ( A ) WB analysis of p-P38, p-ERK1/2, and p-JNK expression levels in CNV corneas. ( B – D ) Quantitative analysis of the WB bands ( n = 3). ( E ) The protein expression level of p-PI3K, p-AKT, and p-mTOR in CNV corneas. ( F-H ) Quantitative analysis of the WB bands ( n = 3). β-Actin served as an internal control. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Data are presented as the mean ± SEM.
Erk1 2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/pmc12889186-66-56-58?v=Proteintech
Average 96 stars, based on 1 article reviews
erk1 2 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Proteintech p p38
tRNA synthetase inhibition causes persistent ribosome stalls. ( A ) U-2 OS cells expressing GFP-G3BP1 were treated with 20 µM halofuginone (HF) or 0.2% DMSO carrier. Images were collected every 2 h for 16 h and representative images are shown ( n = 3 independent experiments). ( B ) Cells were treated with DMSO (−) or 20 µM HF for 4 or 16 h, and P-eIF2α and total eIF2α were detected by Western blotting. Representative blots with total protein are shown at the left , and the average ± SEM of n = 3 independent experiments is shown at the right . Molecular weights (in kilodaltons) are shown. ( C ) Cells were treated with 20 µM HF for 1 h (black line), 4 h (purple line), or 16 h (green line), and polysome profiling was performed. A representative profile is shown at the left , and the average ± SEM of the polysome:monosome ratio from n = 3 independent replicates is shown at the right . Pink, gray, and green dots represent results from each replicate. ( D ) Cells were treated with either 0.2% DMSO carrier or 20 µM HF in the presence or absence of 250 µM sodium arsenite (As) or 2 µM rocaglamide A (RocA), and GFP-G3BP1 was imaged every 0.5 h for 3 h. Representative images are shown at the left with the average ± SEM. The percentage of cells with SGs from n = 3 independent experiments is shown at the right ; ≥288 cells were counted per treatment across all replicates. ( E ) Cells were treated with 0.2% DMSO (black line), 2 µM RocA (green line), or 2 µM RocA plus 20 µM HF (purple line) for 3 h followed by polysome profiling. Representative profiles are shown at the left , and the average ± SEM from n = 3 independent experiments is shown at the right , with pink, gray, and green dots representing each replicate. ( F ) Cells were untreated (DMSO carrier) or treated for 24, 4, or 1 h with 20 µM anisomycin (ANI) or 20 µM halofuginone, and Western blotting for <t>p-p38</t> and p-JNK was done, with the total protein shown below . A representative blot of n = 2 independent experiments is shown. Scale bars, 10 µm. Significance was assessed with ordinary one-way ANOVAs and Tukey's multiple comparisons tests. (*) P < 0.05, (**) P < 0.01, (***) P < 0.005.
P P38, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/pmc13041551-12-0-3?v=Proteintech
Average 96 stars, based on 1 article reviews
p p38 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

95
Proteintech mek1
tRNA synthetase inhibition causes persistent ribosome stalls. ( A ) U-2 OS cells expressing GFP-G3BP1 were treated with 20 µM halofuginone (HF) or 0.2% DMSO carrier. Images were collected every 2 h for 16 h and representative images are shown ( n = 3 independent experiments). ( B ) Cells were treated with DMSO (−) or 20 µM HF for 4 or 16 h, and P-eIF2α and total eIF2α were detected by Western blotting. Representative blots with total protein are shown at the left , and the average ± SEM of n = 3 independent experiments is shown at the right . Molecular weights (in kilodaltons) are shown. ( C ) Cells were treated with 20 µM HF for 1 h (black line), 4 h (purple line), or 16 h (green line), and polysome profiling was performed. A representative profile is shown at the left , and the average ± SEM of the polysome:monosome ratio from n = 3 independent replicates is shown at the right . Pink, gray, and green dots represent results from each replicate. ( D ) Cells were treated with either 0.2% DMSO carrier or 20 µM HF in the presence or absence of 250 µM sodium arsenite (As) or 2 µM rocaglamide A (RocA), and GFP-G3BP1 was imaged every 0.5 h for 3 h. Representative images are shown at the left with the average ± SEM. The percentage of cells with SGs from n = 3 independent experiments is shown at the right ; ≥288 cells were counted per treatment across all replicates. ( E ) Cells were treated with 0.2% DMSO (black line), 2 µM RocA (green line), or 2 µM RocA plus 20 µM HF (purple line) for 3 h followed by polysome profiling. Representative profiles are shown at the left , and the average ± SEM from n = 3 independent experiments is shown at the right , with pink, gray, and green dots representing each replicate. ( F ) Cells were untreated (DMSO carrier) or treated for 24, 4, or 1 h with 20 µM anisomycin (ANI) or 20 µM halofuginone, and Western blotting for <t>p-p38</t> and p-JNK was done, with the total protein shown below . A representative blot of n = 2 independent experiments is shown. Scale bars, 10 µm. Significance was assessed with ordinary one-way ANOVAs and Tukey's multiple comparisons tests. (*) P < 0.05, (**) P < 0.01, (***) P < 0.005.
Mek1, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/pmc09008062__41389_2022_390_MOESM1_ESM-4-6-27?v=Proteintech
Average 95 stars, based on 1 article reviews
mek1 - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

90
ProSci Incorporated p38
Figure 5. Cytoskeleton and VEGF-dependent signaling in cultured endothelial cells isolated from Shb knockout or wild-type liver. A, the cytoskeleton of isolated endothelial cells maintained in tissue culture for 5 to 7 d was visualized by staining with rhodamine-phalloidin, showing a less regular shape with numerous extensions in Shb null cells. B, corresponding wild-type control. No clear cytoskeletal difference between wild-type or knockout cells was noted after stimulation with VEGF-A (C, Shb knockout; D, Shb wild type). Addition of VEGF to the control cells (D) produced changes that made the cells resemble the Shb null cells in the absence of VEGF-A. Horizontal scale bar is shown. Equal amounts of protein from the experimental groups (+/, 20 ng/mL VEGF-A for 2 min) were subjected to Western blot analysis for the phosphorylated proteins indicated. Shb blot shows unstimulated cells only. The blots were subjected to densitometric analysis for phosphorylated FAK, total FAK, phosphorylated <t>p38,</t> total p38, pMLC, phosphorylated ERK, and total ERK in three separate experiments. Quantitation of the relative phosphorylation of FAK, MLC, p38, and ERK is also given. Columns, mean; bars, SE. *, P < 0.05; **, P < 0.01 (paired Students’ t test).
P38, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/10__1158_slash_0008___5472__can___08___3797-119-53-73?v=ProSci+Incorporated
Average 90 stars, based on 1 article reviews
p38 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

96
Proteintech p jnk proteintech 80024 1 rr
Figure 5. Cytoskeleton and VEGF-dependent signaling in cultured endothelial cells isolated from Shb knockout or wild-type liver. A, the cytoskeleton of isolated endothelial cells maintained in tissue culture for 5 to 7 d was visualized by staining with rhodamine-phalloidin, showing a less regular shape with numerous extensions in Shb null cells. B, corresponding wild-type control. No clear cytoskeletal difference between wild-type or knockout cells was noted after stimulation with VEGF-A (C, Shb knockout; D, Shb wild type). Addition of VEGF to the control cells (D) produced changes that made the cells resemble the Shb null cells in the absence of VEGF-A. Horizontal scale bar is shown. Equal amounts of protein from the experimental groups (+/, 20 ng/mL VEGF-A for 2 min) were subjected to Western blot analysis for the phosphorylated proteins indicated. Shb blot shows unstimulated cells only. The blots were subjected to densitometric analysis for phosphorylated FAK, total FAK, phosphorylated <t>p38,</t> total p38, pMLC, phosphorylated ERK, and total ERK in three separate experiments. Quantitation of the relative phosphorylation of FAK, MLC, p38, and ERK is also given. Columns, mean; bars, SE. *, P < 0.05; **, P < 0.01 (paired Students’ t test).
P Jnk Proteintech 80024 1 Rr, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/pmc11161633__41598_2024_63970_MOESM1_ESM-0-58-59?v=Proteintech
Average 96 stars, based on 1 article reviews
p jnk proteintech 80024 1 rr - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

94
Proteintech jnk2 rabbit cst 9258s wb
Figure 5. Cytoskeleton and VEGF-dependent signaling in cultured endothelial cells isolated from Shb knockout or wild-type liver. A, the cytoskeleton of isolated endothelial cells maintained in tissue culture for 5 to 7 d was visualized by staining with rhodamine-phalloidin, showing a less regular shape with numerous extensions in Shb null cells. B, corresponding wild-type control. No clear cytoskeletal difference between wild-type or knockout cells was noted after stimulation with VEGF-A (C, Shb knockout; D, Shb wild type). Addition of VEGF to the control cells (D) produced changes that made the cells resemble the Shb null cells in the absence of VEGF-A. Horizontal scale bar is shown. Equal amounts of protein from the experimental groups (+/, 20 ng/mL VEGF-A for 2 min) were subjected to Western blot analysis for the phosphorylated proteins indicated. Shb blot shows unstimulated cells only. The blots were subjected to densitometric analysis for phosphorylated FAK, total FAK, phosphorylated <t>p38,</t> total p38, pMLC, phosphorylated ERK, and total ERK in three separate experiments. Quantitation of the relative phosphorylation of FAK, MLC, p38, and ERK is also given. Columns, mean; bars, SE. *, P < 0.05; **, P < 0.01 (paired Students’ t test).
Jnk2 Rabbit Cst 9258s Wb, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/pmc11997057__41467_2025_56974_MOESM1_ESM-2-183-197?v=Proteintech
Average 94 stars, based on 1 article reviews
jnk2 rabbit cst 9258s wb - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Elabscience Biotechnology p38 mapk polyclonal antibody
Figure 5. Cytoskeleton and VEGF-dependent signaling in cultured endothelial cells isolated from Shb knockout or wild-type liver. A, the cytoskeleton of isolated endothelial cells maintained in tissue culture for 5 to 7 d was visualized by staining with rhodamine-phalloidin, showing a less regular shape with numerous extensions in Shb null cells. B, corresponding wild-type control. No clear cytoskeletal difference between wild-type or knockout cells was noted after stimulation with VEGF-A (C, Shb knockout; D, Shb wild type). Addition of VEGF to the control cells (D) produced changes that made the cells resemble the Shb null cells in the absence of VEGF-A. Horizontal scale bar is shown. Equal amounts of protein from the experimental groups (+/, 20 ng/mL VEGF-A for 2 min) were subjected to Western blot analysis for the phosphorylated proteins indicated. Shb blot shows unstimulated cells only. The blots were subjected to densitometric analysis for phosphorylated FAK, total FAK, phosphorylated <t>p38,</t> total p38, pMLC, phosphorylated ERK, and total ERK in three separate experiments. Quantitation of the relative phosphorylation of FAK, MLC, p38, and ERK is also given. Columns, mean; bars, SE. *, P < 0.05; **, P < 0.01 (paired Students’ t test).
P38 Mapk Polyclonal Antibody, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/pm41638279-75-10-17?v=Elabscience+Biotechnology
Average 96 stars, based on 1 article reviews
p38 mapk polyclonal antibody - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

95
Proteintech p jnk proteintech 24164 1 ap 46 54 rabbit
Figure 5. Cytoskeleton and VEGF-dependent signaling in cultured endothelial cells isolated from Shb knockout or wild-type liver. A, the cytoskeleton of isolated endothelial cells maintained in tissue culture for 5 to 7 d was visualized by staining with rhodamine-phalloidin, showing a less regular shape with numerous extensions in Shb null cells. B, corresponding wild-type control. No clear cytoskeletal difference between wild-type or knockout cells was noted after stimulation with VEGF-A (C, Shb knockout; D, Shb wild type). Addition of VEGF to the control cells (D) produced changes that made the cells resemble the Shb null cells in the absence of VEGF-A. Horizontal scale bar is shown. Equal amounts of protein from the experimental groups (+/, 20 ng/mL VEGF-A for 2 min) were subjected to Western blot analysis for the phosphorylated proteins indicated. Shb blot shows unstimulated cells only. The blots were subjected to densitometric analysis for phosphorylated FAK, total FAK, phosphorylated <t>p38,</t> total p38, pMLC, phosphorylated ERK, and total ERK in three separate experiments. Quantitation of the relative phosphorylation of FAK, MLC, p38, and ERK is also given. Columns, mean; bars, SE. *, P < 0.05; **, P < 0.01 (paired Students’ t test).
P Jnk Proteintech 24164 1 Ap 46 54 Rabbit, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mapk/pm36519207__jf2c05595_si_001-10-67-68?v=Proteintech
Average 95 stars, based on 1 article reviews
p jnk proteintech 24164 1 ap 46 54 rabbit - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

Image Search Results


Validation of the targeting relationship between let-7a-5p and MAPK8. (A) Schematic representation of the predicted complementary binding site between let-7a-5p and the 3′-UTR of MAPK8. (B) Relative mRNA expression level of MAPK8 in macrophages overexpressing let-7a-5p detected by RT-qPCR. (C) WB analysis of MAPK8 protein expression in macrophages overexpressing let-7a-5p. (D) Inhibitory effect of let-7a-5p on MAPK8 expression was assessed via a dual luciferase reporter assay. ( **P < 0.01, ***P < 0.001).

Journal: Frontiers in Immunology

Article Title: Platelet-rich plasma-derived microRNA let-7a-5p alleviates knee osteoarthritis by regulating macrophage polarization and improving inflammatory microenvironment

doi: 10.3389/fimmu.2026.1756467

Figure Lengend Snippet: Validation of the targeting relationship between let-7a-5p and MAPK8. (A) Schematic representation of the predicted complementary binding site between let-7a-5p and the 3′-UTR of MAPK8. (B) Relative mRNA expression level of MAPK8 in macrophages overexpressing let-7a-5p detected by RT-qPCR. (C) WB analysis of MAPK8 protein expression in macrophages overexpressing let-7a-5p. (D) Inhibitory effect of let-7a-5p on MAPK8 expression was assessed via a dual luciferase reporter assay. ( **P < 0.01, ***P < 0.001).

Article Snippet: Subsequently, the tissue sections and cells were incubated overnight at 4°C with primary antibodies against iNOS (Proteintech 22226-1-AP), CD206 (Proteintech 18704-1-AP) and MAPK8 (Proteintech 66210-1-Ig).

Techniques: Biomarker Discovery, Binding Assay, Expressing, Quantitative RT-PCR, Luciferase, Reporter Assay

Effect of PRP on expression of let-7a-5p and MAPK8. (A) Relative mRNA expression levels of let-7a-5p in knee joint sections of each group detected by RT-qPCR. (B) iNOS and CD206 co-immunolabeld with MAPK8 and counter-stained with DAPI in synovial tissues (Scale bar: 50 μm). (C, D) Quantification of iNOS and CD206 expression co-localized with MAPK8. ( **P < 0.01).

Journal: Frontiers in Immunology

Article Title: Platelet-rich plasma-derived microRNA let-7a-5p alleviates knee osteoarthritis by regulating macrophage polarization and improving inflammatory microenvironment

doi: 10.3389/fimmu.2026.1756467

Figure Lengend Snippet: Effect of PRP on expression of let-7a-5p and MAPK8. (A) Relative mRNA expression levels of let-7a-5p in knee joint sections of each group detected by RT-qPCR. (B) iNOS and CD206 co-immunolabeld with MAPK8 and counter-stained with DAPI in synovial tissues (Scale bar: 50 μm). (C, D) Quantification of iNOS and CD206 expression co-localized with MAPK8. ( **P < 0.01).

Article Snippet: Subsequently, the tissue sections and cells were incubated overnight at 4°C with primary antibodies against iNOS (Proteintech 22226-1-AP), CD206 (Proteintech 18704-1-AP) and MAPK8 (Proteintech 66210-1-Ig).

Techniques: Expressing, Quantitative RT-PCR, Staining

The let-7a-5p/MAPK8 axis regulates macrophage polarization and inflammatory cytokine release in vitro . (A) IF staining showing expression of iNOS and CD206 in macrophages (Scale bar: 50 μm). (B) Quantification of iNOS-positive cell rate in transfected macrophages. (C) Quantification of CD206-positive cell rate in transfected macrophages. (D-G) Relative mRNA expression levels of pro-inflammatory cytokine (IL-1β and TNF-α) and anti-inflammatory cytokine (IL-4 and IL-10) in transfected macrophages detected by RT-qPCR. ( *P < 0.05, **P < 0.01, ns no significance).

Journal: Frontiers in Immunology

Article Title: Platelet-rich plasma-derived microRNA let-7a-5p alleviates knee osteoarthritis by regulating macrophage polarization and improving inflammatory microenvironment

doi: 10.3389/fimmu.2026.1756467

Figure Lengend Snippet: The let-7a-5p/MAPK8 axis regulates macrophage polarization and inflammatory cytokine release in vitro . (A) IF staining showing expression of iNOS and CD206 in macrophages (Scale bar: 50 μm). (B) Quantification of iNOS-positive cell rate in transfected macrophages. (C) Quantification of CD206-positive cell rate in transfected macrophages. (D-G) Relative mRNA expression levels of pro-inflammatory cytokine (IL-1β and TNF-α) and anti-inflammatory cytokine (IL-4 and IL-10) in transfected macrophages detected by RT-qPCR. ( *P < 0.05, **P < 0.01, ns no significance).

Article Snippet: Subsequently, the tissue sections and cells were incubated overnight at 4°C with primary antibodies against iNOS (Proteintech 22226-1-AP), CD206 (Proteintech 18704-1-AP) and MAPK8 (Proteintech 66210-1-Ig).

Techniques: In Vitro, Staining, Expressing, Transfection, Quantitative RT-PCR

AIF-1 siRNA inhibited the phosphorylation of P38, ERK1/2, JNK, PI3K, AKT, and mTOR proteins in corneal tissues following alkali burn. ( A ) WB analysis of p-P38, p-ERK1/2, and p-JNK expression levels in CNV corneas. ( B – D ) Quantitative analysis of the WB bands ( n = 3). ( E ) The protein expression level of p-PI3K, p-AKT, and p-mTOR in CNV corneas. ( F-H ) Quantitative analysis of the WB bands ( n = 3). β-Actin served as an internal control. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Data are presented as the mean ± SEM.

Journal: Investigative Ophthalmology & Visual Science

Article Title: AIF-1 Drives Corneal Neovascularization by Promoting Inflammatory Macrophage Activation via the MAPK and PI3K/AKT/mTOR Signaling Pathways

doi: 10.1167/iovs.67.2.22

Figure Lengend Snippet: AIF-1 siRNA inhibited the phosphorylation of P38, ERK1/2, JNK, PI3K, AKT, and mTOR proteins in corneal tissues following alkali burn. ( A ) WB analysis of p-P38, p-ERK1/2, and p-JNK expression levels in CNV corneas. ( B – D ) Quantitative analysis of the WB bands ( n = 3). ( E ) The protein expression level of p-PI3K, p-AKT, and p-mTOR in CNV corneas. ( F-H ) Quantitative analysis of the WB bands ( n = 3). β-Actin served as an internal control. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Data are presented as the mean ± SEM.

Article Snippet: The PVDF membrane was incubated overnight at 4°C with primary antibodies, including AIF-1 (1:1000; Abcam, Cambridge, UK), VEGFA (1:1000; CST, Danvers, MA, USA), CD86 (1:1000; Abcam), TNF-α (1:1000; ABclonal, Wuhan, China), IL-1β (1:2000; ABclonal), IL-6 (1:1000; CST), CD31 (1:1000; R&D Systems, Minneapolis, MN, USA), proliferating cell nuclear antigen (PCNA, 1:1000; ABclonal), p-ERK1/2 (1:1500; Proteintech, Wuhan, China), ERK1/2 (1:1500; Proteintech), P38 (1:1000; CST), p-P38 (1:1000; CST), p-JNK (1:1000; CST), JNK (1:1000; CST), p-PI3K (1:500; Affinity Biosciences, Nanjing, China), PI3K (1:1000; Proteintech), p-AKT (1:3000; Proteintech), AKT (1:1000; Proteintech), p-mTOR (1:5000; Proteintech), mTOR (1:1000; Proteintech), and β-actin (1:2000; Elabscience, Wuhan, China).

Techniques: Phospho-proteomics, Expressing, Control

tRNA synthetase inhibition causes persistent ribosome stalls. ( A ) U-2 OS cells expressing GFP-G3BP1 were treated with 20 µM halofuginone (HF) or 0.2% DMSO carrier. Images were collected every 2 h for 16 h and representative images are shown ( n = 3 independent experiments). ( B ) Cells were treated with DMSO (−) or 20 µM HF for 4 or 16 h, and P-eIF2α and total eIF2α were detected by Western blotting. Representative blots with total protein are shown at the left , and the average ± SEM of n = 3 independent experiments is shown at the right . Molecular weights (in kilodaltons) are shown. ( C ) Cells were treated with 20 µM HF for 1 h (black line), 4 h (purple line), or 16 h (green line), and polysome profiling was performed. A representative profile is shown at the left , and the average ± SEM of the polysome:monosome ratio from n = 3 independent replicates is shown at the right . Pink, gray, and green dots represent results from each replicate. ( D ) Cells were treated with either 0.2% DMSO carrier or 20 µM HF in the presence or absence of 250 µM sodium arsenite (As) or 2 µM rocaglamide A (RocA), and GFP-G3BP1 was imaged every 0.5 h for 3 h. Representative images are shown at the left with the average ± SEM. The percentage of cells with SGs from n = 3 independent experiments is shown at the right ; ≥288 cells were counted per treatment across all replicates. ( E ) Cells were treated with 0.2% DMSO (black line), 2 µM RocA (green line), or 2 µM RocA plus 20 µM HF (purple line) for 3 h followed by polysome profiling. Representative profiles are shown at the left , and the average ± SEM from n = 3 independent experiments is shown at the right , with pink, gray, and green dots representing each replicate. ( F ) Cells were untreated (DMSO carrier) or treated for 24, 4, or 1 h with 20 µM anisomycin (ANI) or 20 µM halofuginone, and Western blotting for p-p38 and p-JNK was done, with the total protein shown below . A representative blot of n = 2 independent experiments is shown. Scale bars, 10 µm. Significance was assessed with ordinary one-way ANOVAs and Tukey's multiple comparisons tests. (*) P < 0.05, (**) P < 0.01, (***) P < 0.005.

Journal: Genes & Development

Article Title: tRNA synthetase activity is required for stress granule and P-body assembly

doi: 10.1101/gad.353535.125

Figure Lengend Snippet: tRNA synthetase inhibition causes persistent ribosome stalls. ( A ) U-2 OS cells expressing GFP-G3BP1 were treated with 20 µM halofuginone (HF) or 0.2% DMSO carrier. Images were collected every 2 h for 16 h and representative images are shown ( n = 3 independent experiments). ( B ) Cells were treated with DMSO (−) or 20 µM HF for 4 or 16 h, and P-eIF2α and total eIF2α were detected by Western blotting. Representative blots with total protein are shown at the left , and the average ± SEM of n = 3 independent experiments is shown at the right . Molecular weights (in kilodaltons) are shown. ( C ) Cells were treated with 20 µM HF for 1 h (black line), 4 h (purple line), or 16 h (green line), and polysome profiling was performed. A representative profile is shown at the left , and the average ± SEM of the polysome:monosome ratio from n = 3 independent replicates is shown at the right . Pink, gray, and green dots represent results from each replicate. ( D ) Cells were treated with either 0.2% DMSO carrier or 20 µM HF in the presence or absence of 250 µM sodium arsenite (As) or 2 µM rocaglamide A (RocA), and GFP-G3BP1 was imaged every 0.5 h for 3 h. Representative images are shown at the left with the average ± SEM. The percentage of cells with SGs from n = 3 independent experiments is shown at the right ; ≥288 cells were counted per treatment across all replicates. ( E ) Cells were treated with 0.2% DMSO (black line), 2 µM RocA (green line), or 2 µM RocA plus 20 µM HF (purple line) for 3 h followed by polysome profiling. Representative profiles are shown at the left , and the average ± SEM from n = 3 independent experiments is shown at the right , with pink, gray, and green dots representing each replicate. ( F ) Cells were untreated (DMSO carrier) or treated for 24, 4, or 1 h with 20 µM anisomycin (ANI) or 20 µM halofuginone, and Western blotting for p-p38 and p-JNK was done, with the total protein shown below . A representative blot of n = 2 independent experiments is shown. Scale bars, 10 µm. Significance was assessed with ordinary one-way ANOVAs and Tukey's multiple comparisons tests. (*) P < 0.05, (**) P < 0.01, (***) P < 0.005.

Article Snippet: p-p38 (Thr180/Tyr182) , Proteintech , 28796 , 1:1000 (Western).

Techniques: Inhibition, Expressing, Western Blot

Figure 5. Cytoskeleton and VEGF-dependent signaling in cultured endothelial cells isolated from Shb knockout or wild-type liver. A, the cytoskeleton of isolated endothelial cells maintained in tissue culture for 5 to 7 d was visualized by staining with rhodamine-phalloidin, showing a less regular shape with numerous extensions in Shb null cells. B, corresponding wild-type control. No clear cytoskeletal difference between wild-type or knockout cells was noted after stimulation with VEGF-A (C, Shb knockout; D, Shb wild type). Addition of VEGF to the control cells (D) produced changes that made the cells resemble the Shb null cells in the absence of VEGF-A. Horizontal scale bar is shown. Equal amounts of protein from the experimental groups (+/, 20 ng/mL VEGF-A for 2 min) were subjected to Western blot analysis for the phosphorylated proteins indicated. Shb blot shows unstimulated cells only. The blots were subjected to densitometric analysis for phosphorylated FAK, total FAK, phosphorylated p38, total p38, pMLC, phosphorylated ERK, and total ERK in three separate experiments. Quantitation of the relative phosphorylation of FAK, MLC, p38, and ERK is also given. Columns, mean; bars, SE. *, P < 0.05; **, P < 0.01 (paired Students’ t test).

Journal: Cancer Research

Article Title: Dysfunctional Microvasculature as a Consequence of Shb Gene Inactivation Causes Impaired Tumor Growth

doi: 10.1158/0008-5472.can-08-3797

Figure Lengend Snippet: Figure 5. Cytoskeleton and VEGF-dependent signaling in cultured endothelial cells isolated from Shb knockout or wild-type liver. A, the cytoskeleton of isolated endothelial cells maintained in tissue culture for 5 to 7 d was visualized by staining with rhodamine-phalloidin, showing a less regular shape with numerous extensions in Shb null cells. B, corresponding wild-type control. No clear cytoskeletal difference between wild-type or knockout cells was noted after stimulation with VEGF-A (C, Shb knockout; D, Shb wild type). Addition of VEGF to the control cells (D) produced changes that made the cells resemble the Shb null cells in the absence of VEGF-A. Horizontal scale bar is shown. Equal amounts of protein from the experimental groups (+/, 20 ng/mL VEGF-A for 2 min) were subjected to Western blot analysis for the phosphorylated proteins indicated. Shb blot shows unstimulated cells only. The blots were subjected to densitometric analysis for phosphorylated FAK, total FAK, phosphorylated p38, total p38, pMLC, phosphorylated ERK, and total ERK in three separate experiments. Quantitation of the relative phosphorylation of FAK, MLC, p38, and ERK is also given. Columns, mean; bars, SE. *, P < 0.05; **, P < 0.01 (paired Students’ t test).

Article Snippet: The samples were electrophoresed on SDS-polyacrylamide gels, protein was transferred on to Hybond-P filters (GE Healthcare), and these were then probed for pY-1175 VEGFR-2, total VEGFR-2, pY-397 FAK, total FAK, phosphorylated extracellular signal-regulated kinase (ERK), total ERK, and phosphorylated Akt, total Akt, phosphorylated myosin light chain (pMLC), pY-658 VE-cadherin, phosphorylated p38, and total p38 (all antibodies were from Cell Signaling, except for total VEGFR-2 from R&D Systems, pY-397 FAK from Biosource, pY-VE-cadherin from ProSci, and pMLC from Santa Cruz Biotechnology) before incubation with secondary antibodies and enhanced chemiluminescence.

Techniques: Cell Culture, Isolation, Knock-Out, Staining, Control, Produced, Western Blot, Quantitation Assay, Phospho-proteomics