|
Sangon Biotech
tctagcagagcacggatgtgtttg3 Tctagcagagcacggatgtgtttg3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/5%E2%80%99tctagcagagcacggatgtgtttg3+f+mapk/10__1016_slash_j__isci__2025__113396-606-34-35 Average 86 stars, based on 1 article reviews
tctagcagagcacggatgtgtttg3 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
n a p38 mapk r N A P38 Mapk R, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/3+5+ggaggcaatgtggacaggaacttc+mapk+p38+r/10__1016_slash_j__isci__2025__113396-606-37-35 Average 86 stars, based on 1 article reviews
n a p38 mapk r - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
phosphospecific anti erk 1 2 ![]() Phosphospecific Anti Erk 1 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/Phospho-p44%2F42+MAPK+(Erk1%2F2)+(Thr202%2FTyr204)+Mouse+mAb/pmc00055377-27-0-8 Average 94 stars, based on 1 article reviews
phosphospecific anti erk 1 2 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
p44 42 mapk ![]() P44 42 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/p44%2F42+MAPK+(Erk1%2F2)+Antibody/ppr0484246-33-10-32 Average 99 stars, based on 1 article reviews
p44 42 mapk - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
p erk ![]() P Erk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/Phospho-p44%2F42+MAPK+(Erk1%2F2)+(Thr202%2FTyr204)+XP+Rabbit+mAb/pm31301290-32-24-30 Average 95 stars, based on 1 article reviews
p erk - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
p38α mapk mouse mab ![]() P38α Mapk Mouse Mab, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/p38alpha+MAPK+Mouse+mAb/pmc12751014-243-33-37 Average 95 stars, based on 1 article reviews
p38α mapk mouse mab - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
p38 ![]() P38, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/p38+MAPK+XP+Rabbit+mAb/pmc09780516-104-61-66 Average 97 stars, based on 1 article reviews
p38 - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
p mapk ![]() P Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/Phospho-p44%2F42+MAPK+(Erk1%2F2)+(Thr202%2FTyr204)+Rabbit+mAb/10__1097_slash_jto__0000000000000234-102-11-17 Average 96 stars, based on 1 article reviews
p mapk - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
mouse anti phospho erk1 2 tyr204 tyr187 igg ![]() Mouse Anti Phospho Erk1 2 Tyr204 Tyr187 Igg, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/Phospho-p44%2F42+MAPK+(Erk1)+(Tyr204)%2F(Erk2)+(Tyr187)+Mouse+mAb/pmc09454685-39-23-27 Average 96 stars, based on 1 article reviews
mouse anti phospho erk1 2 tyr204 tyr187 igg - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
phospho iκbα ![]() Phospho Iκbα, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/PathScan+Phospho-p44%2F42+MAPK+(Thr202%2FTyr204)+Sandwich+ELISA+Antibody+Pair/pm27560715-149-58-59 Average 91 stars, based on 1 article reviews
phospho iκbα - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti p44 42 mapk ![]() Anti P44 42 Mapk, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mapk/p44%2F42+MAPK+(Erk1%2F2)+Rabbit+mAb/pm33465503-96-56-64 Average 99 stars, based on 1 article reviews
anti p44 42 mapk - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal:
Article Title: ATP transduces signals from ASGM1, a glycolipid that functions as a bacterial receptor
doi: 10.1073/pnas.161290898
Figure Lengend Snippet: Ligation of flagellin receptor activates the MAP kinase cascade, which is required for mucin induction. (A) HM3 cells grown in six-well plates were lysed with SDS sample buffer 5 min after the addition of agonist antibody, α-ASGM1. Equal amounts of lysate were run on a 12% SDS gel, transferred to nitrocellulose, immunoblotted with a phospho-specific Erk 1/2 antibody, and visualized by chemiluminescence. Blots were stripped and reprobed with Erk 1/2 antibody to show equal loading. P-Erk Cntrl, positive control from vendor. (B) Effect of MEK 1/2 inhibitor PD98059 (37 μM, 30 min) and dominant negative mutant MEK K97R on MUC 2 promoter activity. (c) Inhibition of Erk phosphorylation by the calcium chelator, BAPTA/AM (30 μM, 45 min). Fold increase expressed as the ratio of phosphorylated Erk to baseline Erk 1/2 as determined by densitometry.
Article Snippet:
Techniques: Ligation, SDS-Gel, Positive Control, Dominant Negative Mutation, Activity Assay, Inhibition
Journal:
Article Title: ATP transduces signals from ASGM1, a glycolipid that functions as a bacterial receptor
doi: 10.1073/pnas.161290898
Figure Lengend Snippet: Cartoon depicting events in flagellin-triggered host cell signaling. Flagellin binds to asialoGM1, a membrane glycolipid, which causes the extracellular release of ATP, which then binds to a nucleotide receptor. Downstream events include G-protein activation, the cleavage of PIP2 by PLC, the formation of IP3, Ca2+ mobilization, the phosphorylation of MEK 1/2 and Erk 1/2 [via an unknown calcium binding protein (CBP)], and mucin (MUC 2) transcription. Flagellin-induced signaling bifurcates after Ca2+ mobilization, with ≈50% of the response giving rise to downstream events that are Erk dependent whereas the remaining 50% is Erk independent.
Article Snippet:
Techniques: Activation Assay, Binding Assay
Journal: Journal of Medicinal Chemistry
Article Title: Non-Catalytic Inhibitors of the p38/MK2 Interface: Repurposing Approved Drugs to Target Neuroinflammation in Alzheimer’s Disease
doi: 10.1021/acs.jmedchem.5c01425
Figure Lengend Snippet: Structure-guided mapping and peptide validation of the p38/MK2 interaction interface. (A) The cocrystal structure of the p38/MK2 complex (PDB ID: 6TCA ). The molecular surface of p38 is shown in gray. The p38 docking groove is highlighted in yellow. MK2 is shown as green ribbons. (B) The MK2 D345-H400 docking motif bound to the p38 docking groove is colored based on its fragments tested in this study: D345-H400 is colored in green, I370–L393 in blue, and I370-L382 in red. (C) The binding curve from a fluorescence polarization assay showing high-affinity binding of FITC-labeled MK2 370–393 peptide to His-tagged p38 (EC 50 = 26.9 nM). (D) Dose–response curves from TR-FRET inhibition assays demonstrating that both MK2 370–393 and 369–382 peptides disrupt the p38/MK2 complex (IC 50 = 0.42 μM and 4.26 μM, respectively).
Article Snippet: Thirty min incubation in 5% nonfat dry milk (BioRad, catalog no. 170–6404) in TBST buffer (20 mM Tris-base, 150 mM NaCl, and 0.05% Tween 20) at room temperature was used to block membranes.
Techniques: Biomarker Discovery, Binding Assay, Fluorescence, Labeling, Inhibition
Journal: Journal of Medicinal Chemistry
Article Title: Non-Catalytic Inhibitors of the p38/MK2 Interface: Repurposing Approved Drugs to Target Neuroinflammation in Alzheimer’s Disease
doi: 10.1021/acs.jmedchem.5c01425
Figure Lengend Snippet: Virtual screening and molecular dynamics analysis identify nilotinib as a candidate p38/MK2 PPI inhibitor. (A) Distribution of MM-GBSA binding free energies (Δ G bind ) from virtual screening of 1,040 FDA-approved drugs docked to the p38 docking groove. The p38 crystal structure (PDB ID: 6TCA ) was used for the modeling studies. Compounds with Δ G bind values more than two standard deviations below the mean (red bars, <−60.9 kcal/mol) were prioritized for further analysis. (B) Representative binding pose of carvedilol highlighting key interactions with the p38 docking groove, including hydrogen bonds with Val158, Glu160, and His126 (yellow lines), hydrophobic interactions with the nonpolar pocket defined by Ile116, Leu122, Leu130, and Val158, and a pi-pi stacking with His126 (cyan line). (C) Carvedilol’s carbazole moiety binds within the hydrophobic cleft of the p38 docking groove, which is shown as a molecular surface representation colored by electrostatic potential (red = negative, blue = positive). (D) Root-mean-square deviation (RMSD) plots from three 200 ns molecular dynamics simulations of the p38–nilotinib complex. The RMSD of protein backbone atoms is shown in aquamarine, and nilotinib in red. The PDB IDs of the p38 structures used for the modeling are indicated in the lower-left corners. (E) The representative binding pose of nilotinib obtained after 200 ns MD simulation (a final snapshot of one of the MDs), highlighting pi-pi and H-bond interactions with His126, the H-bonding with Glu160, and multiple water-bridged contacts that stabilize ligand orientation within the groove. (F) Structural overlay of the nilotinib–p38 complex with the p38/MK2 cocrystal structure, illustrating displacement of key MK2 anchoring residues Ile372 and Ile375 by nilotinib. P38 is shown as green ribbons, the p38 docking groove as gray molecular surface, and MK2 as red ribbons.
Article Snippet: Thirty min incubation in 5% nonfat dry milk (BioRad, catalog no. 170–6404) in TBST buffer (20 mM Tris-base, 150 mM NaCl, and 0.05% Tween 20) at room temperature was used to block membranes.
Techniques: Binding Assay
Journal: Journal of Medicinal Chemistry
Article Title: Non-Catalytic Inhibitors of the p38/MK2 Interface: Repurposing Approved Drugs to Target Neuroinflammation in Alzheimer’s Disease
doi: 10.1021/acs.jmedchem.5c01425
Figure Lengend Snippet: Validation of nilotinib as a p38/MK2 PPI Inhibitor. (A) Thermal shift assay (TSA) showing dose-dependent stabilization of recombinant His-tagged p38 by nilotinib (Δ T max = 8.22 °C), consistent with direct binding. (B) TSA profile for SR318, a type II ATP-competitive p38 inhibitor, used as a positive control (Δ T max = 13.47 °C). (C) Nilotinib competes with His-MK2 346–400 fragment for VF-p38 in a cell lysate-based TR-FRET assay. (D) Quantitative qRT-PCR analysis showing that nilotinib significantly ( p -value <0.05) suppresses LPS-induced TNF-α, IL-6, and IL-1β expression in HMC3 microglial cells. P38 inhibitors SR318 and VX-745 were used as positive controls. (E) Nilotinib disrupts the endogenous p38/MK2 complex in HMC3 cells, as shown by coimmunoprecipitation, correlating with cytokine suppression. (F) qRT-PCR analysis showing that nilotinib suppresses LPS/IFNγ-induced TNF-α expression in the human iPSC-derived microglia (iMGL). (G) TR-FRET assay with recombinant p38 and MK2 proteins purified from E. coli demonstrated direct inhibition of the complex by nilotinib (IC 50 = 2.2 μM). In contrast, ATP-site inhibitors VX-745 and SR318 failed to disrupt the interaction, supporting a non-ATP-competitive mechanism for nilotinib activity. (H) Nilotinib demonstrates a weak inhibition of p38/ATF2 PPI (IC 50 > 30 μM, maximal inhibition ∼ 37%) in a TR-FRET assay with recombinant purified His-p38 and GST-ATF2. The inhibition of His-p38/GST-MK2 PPI by nilotinib was monitored in parallel.
Article Snippet: Thirty min incubation in 5% nonfat dry milk (BioRad, catalog no. 170–6404) in TBST buffer (20 mM Tris-base, 150 mM NaCl, and 0.05% Tween 20) at room temperature was used to block membranes.
Techniques: Biomarker Discovery, Thermal Shift Assay, Recombinant, Binding Assay, Positive Control, Quantitative RT-PCR, Expressing, Derivative Assay, Purification, Inhibition, Activity Assay
Journal: Journal of Medicinal Chemistry
Article Title: Non-Catalytic Inhibitors of the p38/MK2 Interface: Repurposing Approved Drugs to Target Neuroinflammation in Alzheimer’s Disease
doi: 10.1021/acs.jmedchem.5c01425
Figure Lengend Snippet: Chemical structures of nilotinib and ten analogs evaluated for p38/MK2 PPI inhibition using a TR-FRET assay with recombinant purified proteins. IC 50 values are shown for compounds exhibiting measurable activity; compounds with less than 50% inhibition at 30 μM are indicated as not determined (N.D.).
Article Snippet: Thirty min incubation in 5% nonfat dry milk (BioRad, catalog no. 170–6404) in TBST buffer (20 mM Tris-base, 150 mM NaCl, and 0.05% Tween 20) at room temperature was used to block membranes.
Techniques: Inhibition, Recombinant, Purification, Activity Assay
Journal: Journal of Medicinal Chemistry
Article Title: Non-Catalytic Inhibitors of the p38/MK2 Interface: Repurposing Approved Drugs to Target Neuroinflammation in Alzheimer’s Disease
doi: 10.1021/acs.jmedchem.5c01425
Figure Lengend Snippet: Field-based QSAR maps illustrating physicochemical features of nilotinib analogs associated with p38/MK2 PPI inhibition. (A) Compounds 1–6 (white) and 7–10 (orange) docked into the p38 binding groove. The molecular surface of the binding groove is colored based on the electrostatic potential, ranging from the most positive (blue) to the most negative (red) charge. (B) Steric field map showing regions where steric bulk is favorable (green). The pyridine–pyrimidine system is positioned within favorable steric zones, supporting its critical role in activity. (C) Hydrophobic field map with yellow-green and gray surfaces representing positive and negative hydrophobic contributions, respectively. (D) Electrostatic field map colored by potential (red - negative, blue - positive). (E) Hydrogen bond acceptor field map. Red contours indicate favorable contributions of H-bond acceptors, while the magenta contour indicates unfavorable contributions of H-bond acceptors. (F) Hydrogen bond donor field map. The blue-violet contour indicates the region favorable for H-bond donors. The cyan field map indicates the area unfavorable for the H-bond donors.
Article Snippet: Thirty min incubation in 5% nonfat dry milk (BioRad, catalog no. 170–6404) in TBST buffer (20 mM Tris-base, 150 mM NaCl, and 0.05% Tween 20) at room temperature was used to block membranes.
Techniques: Inhibition, Binding Assay, Activity Assay
Journal: Journal of Medicinal Chemistry
Article Title: Non-Catalytic Inhibitors of the p38/MK2 Interface: Repurposing Approved Drugs to Target Neuroinflammation in Alzheimer’s Disease
doi: 10.1021/acs.jmedchem.5c01425
Figure Lengend Snippet: Development of a lysate-based TR-FRET platform for high-throughput screening of p38/MK2 PPI inhibitors. (A) The preferential binding of MK2 to p38α and p38β isoforms was determined by Flag-immunoprecipitation in HEK293T cells. (B) Isoform selectivity of MK2 binding was validated by TR-FRET using lysates coexpressing GST-tagged MK2 and Venus-Flag (VF)-tagged p38 isoforms. Robust signal was observed for p38α and p38β, with negligible interaction detected for p38γ and p38δ. (C) TR-FRET assay shows stable signal over 48 h postantibody addition, indicating excellent temporal stability. (D) The platform tolerates up to 10% DMSO without signal degradation, supporting its suitability for screening applications. (E) Pilot screen of 2036 compounds from the Emory Enriched Library (EEL) in 1536-well format identified 48 compounds that inhibited the p38/MK2 interaction by ≥ 50% relative to vehicle control. Gray dots indicate fluorescence assay-interfering compounds.
Article Snippet: Thirty min incubation in 5% nonfat dry milk (BioRad, catalog no. 170–6404) in TBST buffer (20 mM Tris-base, 150 mM NaCl, and 0.05% Tween 20) at room temperature was used to block membranes.
Techniques: High Throughput Screening Assay, Binding Assay, Immunoprecipitation, Control, Fluorescence
Journal: Journal of Medicinal Chemistry
Article Title: Non-Catalytic Inhibitors of the p38/MK2 Interface: Repurposing Approved Drugs to Target Neuroinflammation in Alzheimer’s Disease
doi: 10.1021/acs.jmedchem.5c01425
Figure Lengend Snippet: α 1 -Adrenergic antagonists disrupt the p38/MK2 interface and suppress cytokine production in microglial cells. (A) Chemical structures of doxazosin, terazosin, and alfuzosin, three α 1 -adrenergic receptor antagonists identified from the high-throughput screen. (B) Dose–response TR-FRET assays using recombinant purified p38 and MK2 proteins demonstrate that all three compounds inhibit the p38/MK2 protein–protein interaction, with IC 50 values of 4.4 μM (doxazosin), 6.2 μM (terazosin), and 6.9 μM (alfuzosin). (C) The compound activity was confirmed in a cell lysate-based TR-FRET format, showing a moderate reduction in potency relative to the recombinant protein assay. (D) In a complementary TR-FRET assay using HEK293T lysates coexpressing VF-tagged p8 and a His-tagged MK2 346–400 docking peptide, all three α 1 -antagonists and nilotinib dose-dependently disrupted peptide binding to p38, consistent with direct competition at the docking interface. (E) qRT-PCR analysis in HMC3 microglial cells shows that all three compounds significantly ( p -values <0.05) suppressed LPS-induced expression of TNF-α, IL-6, and IL-1β, similarly to known p38 inhibitors SR318 and VX745, demonstrating effective functional inhibition of p38/MK2 signaling in a disease-relevant context.
Article Snippet: Thirty min incubation in 5% nonfat dry milk (BioRad, catalog no. 170–6404) in TBST buffer (20 mM Tris-base, 150 mM NaCl, and 0.05% Tween 20) at room temperature was used to block membranes.
Techniques: High Throughput Screening Assay, Recombinant, Purification, Activity Assay, Binding Assay, Quantitative RT-PCR, Expressing, Functional Assay, Inhibition
Journal: Experimental and Therapeutic Medicine
Article Title: Proliferation, apoptosis and invasion of human lung cancer cells are associated with NFATc1
doi: 10.3892/etm.2022.11748
Figure Lengend Snippet: Knockdown of NFATc1 expression induces cell apoptosis whilst inhibiting the MAPK and epithelial-to-mesenchymal transition signaling pathways in lung cancer cells. (A) Protein expression levels of Bax, cleaved caspase-3, CDK4 and c-Myc in both cell lines were examined by western blot analysis. GAPDH was used as the loading control. (B) Protein expression levels of E-cadherin and N-cadherin were examined by western blotting. GAPDH was used as the loading control. (C) Protein expression levels of ERK and p38, along with their corresponding phosphorylation levels were detected by western blotting. GAPDH was used as the loading control. * P<0.05, ** P<0.01 and *** P<0.001 vs. shCtrl. Ctrl, control; NFATc1, nuclear factor of activated T cells c1; p-, phosphorylated; sh, short hairpin RNA.
Article Snippet: The blots were blocked in 5% skimmed milk for 1 h at room temperature, followed by incubation with primary antibodies against ERK (cat. no. 9107; 1:2,000; Cell Signaling Technology, Inc.), E-cadherin (cat. no. 14472; 1:500; Cell Signaling Technology, Inc.), phosphorylated (p)-ERK (cat. no. 4376; 1:1,000; Cell Signaling Technology, Inc.), N-cadherin (cat. no. ab18203; 1:500; Abcam), Bax (cat. no. ab32503; 1:2,000; Abcam),
Techniques: Knockdown, Expressing, Protein-Protein interactions, Western Blot, Control, Phospho-proteomics, shRNA
Journal: The journal of pain
Article Title: Serotonin Plays a Key Role in the Development of Opioid-Induced Hyperalgesia in Mice.
doi: 10.1016/j.jpain.2020.12.008
Figure Lengend Snippet: Figure 5. Phosphorylation of ERK2 (p42-MAPK) in the spinal dorsal horn is enhanced following repetitive administering of mor- phine and is reversed by serotonin deprivation via the administering of PCPA. (A−D) Representative immunohistochemistry against pERK and GFAP in the spinal dorsal horns of experimental group mice. (A) Naive group, (B) morphine group, (C) morphine + OND 2.0 mg/kg group and (D) PCPA 150 mg/kg for 8 days + morphine group. White arrows indicate the expression of p-ERK in the spinal dorsal horn. Scale bar: 50 mm in large figures and 20 mm in insets. (E) Western blot analysis. Relative phosphorylation ratios of (F) ERK1 (p44-MAPK) and (G) ERK2 (p42-MAPK). OND (2.0 mg/kg) tended to reduce the phosphorylation ratio of ERK2, although not to a significant level. Neither OND nor serotonin deprivation affected the phosphorylation ratio of ERK1. Saline (control) group: n = 11; morphine group: n = 11; morphine + OND (2.0 mg/kg) group: n = 6; PCPA (150 mg/kg) for 8 days + morphine group: n = 7, respectively.
Article Snippet: The membranes were washed with TBS-T for 5 minutes and incubated overnight at 4°C with the following primary antibodies: anti-human glial fibrillary acidic protein (GFAP; 1:300; Cat. #; M 0761, Dako A/S, Glostrup, Denmark), anti-b-actin (1:5000; Cat. #; A5441, SigmaAldrich, Inc., MO), anti-phospho-p44/42 MAPK (p-ERK 1/ 2) (1:1000, Cat. #;9101, Cell Signaling Technology, Danvers, MA), and
Techniques: Phospho-proteomics, Immunohistochemistry, Expressing, Western Blot, Saline, Control