lsm1 Search Results


91
Thermo Fisher gene exp lsm1 mm01600253 m1
Gene Exp Lsm1 Mm01600253 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp lsm1 mm01600253 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp lsm1 mm01600253 m1 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

90
OriGene mouse anti lsm1
Mouse Anti Lsm1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse anti lsm1/product/OriGene
Average 90 stars, based on 1 article reviews
mouse anti lsm1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

92
Santa Cruz Biotechnology anti lsm1
Anti Lsm1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti lsm1/product/Santa Cruz Biotechnology
Average 92 stars, based on 1 article reviews
anti lsm1 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

93
OriGene lsm1 sirnas
LSM was significantly overexpressed in breast cancer compared with normal breast tissue. (A) Waterfall plot illustrates the relations between the top 30 genes and the CNV in cancer patients for a specific breast cancer. (B) The mRNA expression levels of <t>LSM1</t> in multiple cancers on ONCOMINE database. Transcriptional expression of LSM1 was significantly high in breast cancer. (C) Volcano plots exhibiting genes associated with alterations in LSM1 CNA frequency. (D) The top 10 genes with the highest alteration frequencies were markedly enriched in the altered group. (E) The distribution and correlation of CNV in breast cancer were marked with red (gain) and green (loss) to visualize the distribution of log 2 ratios
Lsm1 Sirnas, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lsm1 sirnas/product/OriGene
Average 93 stars, based on 1 article reviews
lsm1 sirnas - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp lsm1 hs00205477 m1
LSM was significantly overexpressed in breast cancer compared with normal breast tissue. (A) Waterfall plot illustrates the relations between the top 30 genes and the CNV in cancer patients for a specific breast cancer. (B) The mRNA expression levels of <t>LSM1</t> in multiple cancers on ONCOMINE database. Transcriptional expression of LSM1 was significantly high in breast cancer. (C) Volcano plots exhibiting genes associated with alterations in LSM1 CNA frequency. (D) The top 10 genes with the highest alteration frequencies were markedly enriched in the altered group. (E) The distribution and correlation of CNV in breast cancer were marked with red (gain) and green (loss) to visualize the distribution of log 2 ratios
Gene Exp Lsm1 Hs00205477 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp lsm1 hs00205477 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp lsm1 hs00205477 m1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

90
CHOWDHURY AND CO LUTON LIMITED lsm1–7–pat1 complex
LSM was significantly overexpressed in breast cancer compared with normal breast tissue. (A) Waterfall plot illustrates the relations between the top 30 genes and the CNV in cancer patients for a specific breast cancer. (B) The mRNA expression levels of <t>LSM1</t> in multiple cancers on ONCOMINE database. Transcriptional expression of LSM1 was significantly high in breast cancer. (C) Volcano plots exhibiting genes associated with alterations in LSM1 CNA frequency. (D) The top 10 genes with the highest alteration frequencies were markedly enriched in the altered group. (E) The distribution and correlation of CNV in breast cancer were marked with red (gain) and green (loss) to visualize the distribution of log 2 ratios
Lsm1–7–Pat1 Complex, supplied by CHOWDHURY AND CO LUTON LIMITED, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lsm1–7–pat1 complex/product/CHOWDHURY AND CO LUTON LIMITED
Average 90 stars, based on 1 article reviews
lsm1–7–pat1 complex - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Absolute Biotech Inc lsm1 rabbit
LSM was significantly overexpressed in breast cancer compared with normal breast tissue. (A) Waterfall plot illustrates the relations between the top 30 genes and the CNV in cancer patients for a specific breast cancer. (B) The mRNA expression levels of <t>LSM1</t> in multiple cancers on ONCOMINE database. Transcriptional expression of LSM1 was significantly high in breast cancer. (C) Volcano plots exhibiting genes associated with alterations in LSM1 CNA frequency. (D) The top 10 genes with the highest alteration frequencies were markedly enriched in the altered group. (E) The distribution and correlation of CNV in breast cancer were marked with red (gain) and green (loss) to visualize the distribution of log 2 ratios
Lsm1 Rabbit, supplied by Absolute Biotech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lsm1 rabbit/product/Absolute Biotech Inc
Average 90 stars, based on 1 article reviews
lsm1 rabbit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Carl Zeiss lsm1 confocal microscope
LSM was significantly overexpressed in breast cancer compared with normal breast tissue. (A) Waterfall plot illustrates the relations between the top 30 genes and the CNV in cancer patients for a specific breast cancer. (B) The mRNA expression levels of <t>LSM1</t> in multiple cancers on ONCOMINE database. Transcriptional expression of LSM1 was significantly high in breast cancer. (C) Volcano plots exhibiting genes associated with alterations in LSM1 CNA frequency. (D) The top 10 genes with the highest alteration frequencies were markedly enriched in the altered group. (E) The distribution and correlation of CNV in breast cancer were marked with red (gain) and green (loss) to visualize the distribution of log 2 ratios
Lsm1 Confocal Microscope, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lsm1 confocal microscope/product/Carl Zeiss
Average 90 stars, based on 1 article reviews
lsm1 confocal microscope - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen lsm1 #2

Lsm1 #2, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lsm1 #2/product/Qiagen
Average 90 stars, based on 1 article reviews
lsm1 #2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Cytogen Inc lymphocyte separation medium lsm

Lymphocyte Separation Medium Lsm, supplied by Cytogen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lymphocyte separation medium lsm/product/Cytogen Inc
Average 90 stars, based on 1 article reviews
lymphocyte separation medium lsm - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Carl Zeiss lsm 1 700 confocal microscope

Lsm 1 700 Confocal Microscope, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lsm 1 700 confocal microscope/product/Carl Zeiss
Average 90 stars, based on 1 article reviews
lsm 1 700 confocal microscope - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Carl Zeiss lsm1 confocal microscope equipped zen 2011 software set

Lsm1 Confocal Microscope Equipped Zen 2011 Software Set, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lsm1 confocal microscope equipped zen 2011 software set/product/Carl Zeiss
Average 90 stars, based on 1 article reviews
lsm1 confocal microscope equipped zen 2011 software set - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


LSM was significantly overexpressed in breast cancer compared with normal breast tissue. (A) Waterfall plot illustrates the relations between the top 30 genes and the CNV in cancer patients for a specific breast cancer. (B) The mRNA expression levels of LSM1 in multiple cancers on ONCOMINE database. Transcriptional expression of LSM1 was significantly high in breast cancer. (C) Volcano plots exhibiting genes associated with alterations in LSM1 CNA frequency. (D) The top 10 genes with the highest alteration frequencies were markedly enriched in the altered group. (E) The distribution and correlation of CNV in breast cancer were marked with red (gain) and green (loss) to visualize the distribution of log 2 ratios

Journal: Journal of Cellular and Molecular Medicine

Article Title: Integrated analysis of pivotal biomarker of LSM1 , immune cell infiltration and therapeutic drugs in breast cancer

doi: 10.1111/jcmm.17436

Figure Lengend Snippet: LSM was significantly overexpressed in breast cancer compared with normal breast tissue. (A) Waterfall plot illustrates the relations between the top 30 genes and the CNV in cancer patients for a specific breast cancer. (B) The mRNA expression levels of LSM1 in multiple cancers on ONCOMINE database. Transcriptional expression of LSM1 was significantly high in breast cancer. (C) Volcano plots exhibiting genes associated with alterations in LSM1 CNA frequency. (D) The top 10 genes with the highest alteration frequencies were markedly enriched in the altered group. (E) The distribution and correlation of CNV in breast cancer were marked with red (gain) and green (loss) to visualize the distribution of log 2 ratios

Article Snippet: LSM1 siRNAs were purchased from OriGene Co (SR309058).

Techniques: Expressing

LSM1‐related transcription factor alternation analysis in breast cancer. (A) LSM1 gene mutation frequencies and types in breast cancer samples. (B) Genetic alterations of LSM1 gene in various cancer types using cBioPortal cancer genomics analysis. (C) Gene mutation frequencies of LSM1 in various carcinoma types. The red bars indicate gene amplifications, blue bars are homozygous deletions, green bars are non‐synonymous mutations, and grey bars indicate multiple alterations. (D) The expression of LSM1 in different types of mutant tumour tissues ( n = 990). *** p < 0.001

Journal: Journal of Cellular and Molecular Medicine

Article Title: Integrated analysis of pivotal biomarker of LSM1 , immune cell infiltration and therapeutic drugs in breast cancer

doi: 10.1111/jcmm.17436

Figure Lengend Snippet: LSM1‐related transcription factor alternation analysis in breast cancer. (A) LSM1 gene mutation frequencies and types in breast cancer samples. (B) Genetic alterations of LSM1 gene in various cancer types using cBioPortal cancer genomics analysis. (C) Gene mutation frequencies of LSM1 in various carcinoma types. The red bars indicate gene amplifications, blue bars are homozygous deletions, green bars are non‐synonymous mutations, and grey bars indicate multiple alterations. (D) The expression of LSM1 in different types of mutant tumour tissues ( n = 990). *** p < 0.001

Article Snippet: LSM1 siRNAs were purchased from OriGene Co (SR309058).

Techniques: Mutagenesis, Expressing

Relative expression and survival of LSM1 in BRCA tissues based on multiple databases. (A) Overall and disease‐free survival estimates for LSM1 mRNA levels from Kaplan–Meier plotter database. (B) Box plot to evaluate LSM1 mRNA expression in BRCA patients based on pathological stage. (C) LSM1 expression in normal, BRCA primary tumour and metastatic tumour ( n = 990). Boxplots (D and G), bar charts (E and H) and violin plots (F and I) of LSM1 gene expression from RNA‐sequencing data and Gene chip data. *** p < 0.001

Journal: Journal of Cellular and Molecular Medicine

Article Title: Integrated analysis of pivotal biomarker of LSM1 , immune cell infiltration and therapeutic drugs in breast cancer

doi: 10.1111/jcmm.17436

Figure Lengend Snippet: Relative expression and survival of LSM1 in BRCA tissues based on multiple databases. (A) Overall and disease‐free survival estimates for LSM1 mRNA levels from Kaplan–Meier plotter database. (B) Box plot to evaluate LSM1 mRNA expression in BRCA patients based on pathological stage. (C) LSM1 expression in normal, BRCA primary tumour and metastatic tumour ( n = 990). Boxplots (D and G), bar charts (E and H) and violin plots (F and I) of LSM1 gene expression from RNA‐sequencing data and Gene chip data. *** p < 0.001

Article Snippet: LSM1 siRNAs were purchased from OriGene Co (SR309058).

Techniques: Expressing, RNA Sequencing Assay

LSM1 promotes tumour progression in breast cancer. (A) Representative images of LSM1 expression in breast cancer tissues at different staining stages. (B) The expression levels of LSM1 in breast cancer were assessed in benign and malignant violin plots. (C) qPCR analysis of LSM1 in 30 paired BRCA and non‐tumour tissues. N and T represent non‐tumour and tumour tissues, respectively. (D) Significance of dependency of LSM1 in 57 BRCA cell lines based on the CRISPR screen. (E) mRNA expression of LSM1 in normal breast cells and multiple breast cancer cells. (F) The qPCR revealed LSM1 expression was significantly decreased in siLSM1 group breast cancer cells. (G and H) Wound healing assays of MCF7 and MDA‐MB‐231 cell lines. (I and J) Transwell assays of MCF7 and MDA‐MB‐231 cell lines were used to determine the invasion of BRCA cells. * p < 0.05, ** p < 0.01, *** p < 0.001. Scale bar = 500 μm

Journal: Journal of Cellular and Molecular Medicine

Article Title: Integrated analysis of pivotal biomarker of LSM1 , immune cell infiltration and therapeutic drugs in breast cancer

doi: 10.1111/jcmm.17436

Figure Lengend Snippet: LSM1 promotes tumour progression in breast cancer. (A) Representative images of LSM1 expression in breast cancer tissues at different staining stages. (B) The expression levels of LSM1 in breast cancer were assessed in benign and malignant violin plots. (C) qPCR analysis of LSM1 in 30 paired BRCA and non‐tumour tissues. N and T represent non‐tumour and tumour tissues, respectively. (D) Significance of dependency of LSM1 in 57 BRCA cell lines based on the CRISPR screen. (E) mRNA expression of LSM1 in normal breast cells and multiple breast cancer cells. (F) The qPCR revealed LSM1 expression was significantly decreased in siLSM1 group breast cancer cells. (G and H) Wound healing assays of MCF7 and MDA‐MB‐231 cell lines. (I and J) Transwell assays of MCF7 and MDA‐MB‐231 cell lines were used to determine the invasion of BRCA cells. * p < 0.05, ** p < 0.01, *** p < 0.001. Scale bar = 500 μm

Article Snippet: LSM1 siRNAs were purchased from OriGene Co (SR309058).

Techniques: Expressing, Staining, CRISPR

Box and whiskers plots and differential expression of in breast cancer patients based on different kinds of classified parameters. LSM1 mRNA levels from (A and E) Sorlie Breast 2 Statistics cohort, (B and F) Perou Breast Statistics cohort, (C and G) Richardson Breast 2 Statistics cohort, (D) Karnoub Breast Statistics cohort, (H) Zhao Breast Statistics cohort in BRCA and normal tissue. Note: p < 0.05 indicates statistical significance; LSM1 was among the top 10% overexpressed genes in all five different datasets of BRCA. (I and J) LSM1 mRNA expression levels were shown in breast cancer patients by bee swarm in DNA microarray datasets and RNA‐sequencing datasets. (ER, oestrogen receptor; PR, progesterone receptor; HER2, human epidermal growth factor receptor 2)

Journal: Journal of Cellular and Molecular Medicine

Article Title: Integrated analysis of pivotal biomarker of LSM1 , immune cell infiltration and therapeutic drugs in breast cancer

doi: 10.1111/jcmm.17436

Figure Lengend Snippet: Box and whiskers plots and differential expression of in breast cancer patients based on different kinds of classified parameters. LSM1 mRNA levels from (A and E) Sorlie Breast 2 Statistics cohort, (B and F) Perou Breast Statistics cohort, (C and G) Richardson Breast 2 Statistics cohort, (D) Karnoub Breast Statistics cohort, (H) Zhao Breast Statistics cohort in BRCA and normal tissue. Note: p < 0.05 indicates statistical significance; LSM1 was among the top 10% overexpressed genes in all five different datasets of BRCA. (I and J) LSM1 mRNA expression levels were shown in breast cancer patients by bee swarm in DNA microarray datasets and RNA‐sequencing datasets. (ER, oestrogen receptor; PR, progesterone receptor; HER2, human epidermal growth factor receptor 2)

Article Snippet: LSM1 siRNAs were purchased from OriGene Co (SR309058).

Techniques: Expressing, Microarray, RNA Sequencing Assay

Functional prediction and enrichment analysis of LSM1 expression in breast cancer. The predictability and descriptiveness between mRNA expression and shRNA (A) and sgRNA (B) functions are plotted with breast cancer cell lines. (C) Genes with shRNA/sgRNA overlap are identified in the positive correlation and negative correlation Venn diagram analysis. (D) Volcano plot showing Pearson's test analysis of differential gene expression associated with LSM1 in BRCA. (E) Functional enrichment analysis of LSM1 in BRCA

Journal: Journal of Cellular and Molecular Medicine

Article Title: Integrated analysis of pivotal biomarker of LSM1 , immune cell infiltration and therapeutic drugs in breast cancer

doi: 10.1111/jcmm.17436

Figure Lengend Snippet: Functional prediction and enrichment analysis of LSM1 expression in breast cancer. The predictability and descriptiveness between mRNA expression and shRNA (A) and sgRNA (B) functions are plotted with breast cancer cell lines. (C) Genes with shRNA/sgRNA overlap are identified in the positive correlation and negative correlation Venn diagram analysis. (D) Volcano plot showing Pearson's test analysis of differential gene expression associated with LSM1 in BRCA. (E) Functional enrichment analysis of LSM1 in BRCA

Article Snippet: LSM1 siRNAs were purchased from OriGene Co (SR309058).

Techniques: Functional Assay, Expressing, shRNA

Correlations between the CNV of LSM1, immune cell infiltration, and prognosis in BRCA. (A) Immune cell bars show the expression of the LSM1 gene. (B) LSM1 copy number variable (CNV) affects infiltration levels of CD8 + T cells, macrophages, neutrophils and dendritic cells in BRCA. (C) Heatmap showing the correlation between LSM1 expression and immune infiltration in BRCA. (D) Correlation between the tumour‐immune microenvironment and LSM1 expression. * p < 0.05

Journal: Journal of Cellular and Molecular Medicine

Article Title: Integrated analysis of pivotal biomarker of LSM1 , immune cell infiltration and therapeutic drugs in breast cancer

doi: 10.1111/jcmm.17436

Figure Lengend Snippet: Correlations between the CNV of LSM1, immune cell infiltration, and prognosis in BRCA. (A) Immune cell bars show the expression of the LSM1 gene. (B) LSM1 copy number variable (CNV) affects infiltration levels of CD8 + T cells, macrophages, neutrophils and dendritic cells in BRCA. (C) Heatmap showing the correlation between LSM1 expression and immune infiltration in BRCA. (D) Correlation between the tumour‐immune microenvironment and LSM1 expression. * p < 0.05

Article Snippet: LSM1 siRNAs were purchased from OriGene Co (SR309058).

Techniques: Expressing

Drug sensitivity and cytotoxicity analysis in breast cancer cells. (A) Use of the database to query LSM1 gene signatures and screen for potential drugs. (B and C) Drug sensitivity of sgLSM1 gene to refametinib and trametinib in BRCA cell lines. (D and F) LSM1 efficacy of refametinib and trametinib in inhibiting breast cancer cells. (E and G) Drug sensitivity of different doses of refametinib and Trametinib in treating different breast cancer cells

Journal: Journal of Cellular and Molecular Medicine

Article Title: Integrated analysis of pivotal biomarker of LSM1 , immune cell infiltration and therapeutic drugs in breast cancer

doi: 10.1111/jcmm.17436

Figure Lengend Snippet: Drug sensitivity and cytotoxicity analysis in breast cancer cells. (A) Use of the database to query LSM1 gene signatures and screen for potential drugs. (B and C) Drug sensitivity of sgLSM1 gene to refametinib and trametinib in BRCA cell lines. (D and F) LSM1 efficacy of refametinib and trametinib in inhibiting breast cancer cells. (E and G) Drug sensitivity of different doses of refametinib and Trametinib in treating different breast cancer cells

Article Snippet: LSM1 siRNAs were purchased from OriGene Co (SR309058).

Techniques:

Journal: EMBO Reports

Article Title: CCR4‐NOT differentially controls host versus virus poly(a)‐tail length and regulates HCMV infection

doi: 10.15252/embr.202256327

Figure Lengend Snippet:

Article Snippet: LSM1 #2 , CAGCCTCATCGAGGACATTGA , Qiagen.

Techniques: Virus, Sequencing, Control, SYBR Green Assay, Software, Purification