Journal: Translational Psychiatry

Article Title: Elevation of Il6 is associated with disturbed let-7 biogenesis in a genetic model of depression

doi: 10.1038/tp.2016.136

Figure Lengend Snippet: Gene and miRNA expression levels were measured in the prefrontal cortex of naïve FSL and FRL rats using RT-PCR. ( a ) Increased Il6 and LIN28B, and decreased DROSHA levels in the FSL rats compared to FRL. ( b ) FSL rats exhibited decreased expression of several let-7 family members; Levels of let-7b, let-7c, let-7f, let-7i and miR-98 were significantly reduced. ( c ) RNA immunoprecipitation showed an enrichment of primary let-7 transcripts pri-let-7c-1, pri-let-7i and pri-mir-98 bound to LIN28B in FSL. ( d ) The reduction of mature let-7 was not associated with primary let-7 transcripts changes. Gene expression data are presented as relative quantifications (R.Q.), two reference genes ( Gapdh and Ppia ) were used for normalization of Il6 , Lin28b , Drosha and the primary miRNA genes. Rnu5g was used for normalization of mature miRNAs. Lower panels in a (right) show representative western blot images of LIN28B and DROSHA from the same gel, respectively with β-actin as loading control. RIP data are presented as relative value to FRL. Data are presented as group means±s.e.m. For all figures: n =5–7 animals per group, * P <0.05, ** P <0.01, *** P <0.001. FRL, Flinders Resistant Line; FSL, Flinders Sensitive Line; miRNA, microRNA; RIP, RNA immunoprecipitation; RT-PCR, real-time polymerase chain reaction.

Article Snippet: Immunoblotting was performed overnight at 4 °C with a polyclonal rabbit anti-LIN28B antibody (1:500 dilution; #5422, Cell Signaling Technology, Danvers, MA, USA) or with a polyclonal goat anti-DROSHA antibody (1:1000 dilution; ab58589; Abcam plc, Cambridge, UK) separately, and with a mouse monoclonal anti-β-actin antibody (1:10 000; A5316; Sigma-Aldrich, St Louis, MO, USA).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, RNA Immunoprecipitation, Gene Expression, Western Blot, Control, Real-time Polymerase Chain Reaction

Journal: Translational Psychiatry

Article Title: Elevation of Il6 is associated with disturbed let-7 biogenesis in a genetic model of depression

doi: 10.1038/tp.2016.136

Figure Lengend Snippet: Gene and miRNA expression levels were measured in the prefrontal cortex of FSL with/without access to running wheel (FSL-runners versus FSL-controls) using RT-PCR. ( a ) Physical activity normalized Il6 levels in the FSL-runner group but had no effect on Lin28b and Drosha mRNA levels. ( b ) In line with an Il6 reduction in the FSL rats that were running, let-7i and miR-98 showed significantly increased expression. Specifically, upregulation of let-7i was associated with primary let-7i overexpression ( c ). ( d ) Chromatin immunoprecipitation (ChIP) showed an increased histone H4 acetylation (H4ac) but not histone H3 acetylation (H3ac) within the pri-let-7i promoter of the FSL-runners. Gene expression data were presented as relative quantifications (R.Q.), two reference genes ( Gapdh and Ppia ) were used for normalization of Il6 , Lin28b , Drosha and the primary miRNA genes. Rnu5g was used for normalization of mature miRNAs. ChIP data are presented as percentage of genomic input DNA. Data are presented as group means±s.e.m. For all figures: n =5–7 animals per group, * P <0.05, ** P <0.01, *** P <0.001. FSL, Flinders Sensitive Line; mRNA, messenger RNA; miRNA, microRNA; RT-PCR, real-time polymerase chain reaction.

Article Snippet: Immunoblotting was performed overnight at 4 °C with a polyclonal rabbit anti-LIN28B antibody (1:500 dilution; #5422, Cell Signaling Technology, Danvers, MA, USA) or with a polyclonal goat anti-DROSHA antibody (1:1000 dilution; ab58589; Abcam plc, Cambridge, UK) separately, and with a mouse monoclonal anti-β-actin antibody (1:10 000; A5316; Sigma-Aldrich, St Louis, MO, USA).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Activity Assay, Over Expression, Chromatin Immunoprecipitation, Gene Expression, Real-time Polymerase Chain Reaction

Journal: iScience

Article Title: Identification of a group of 9-amino-acridines that selectively downregulate regulatory T cell functions through FoxP3

doi: 10.1016/j.isci.2025.111931

Figure Lengend Snippet:

Article Snippet: Rabbit (DA1E) mAb IgG Isotype Control (Alexa Fluor 647 Conjugate) , Cell Signaling Technology , Cat# 2985; RRID: AB_1196589.

Techniques: Control, Binding Assay, Staining, Virus, Recombinant, Avidin-Biotin Assay, Cell Isolation, Activation Assay, Amplified Luminescent Proximity Homogenous Assay, cDNA Synthesis, ChIP-qPCR, Software

Journal:

Article Title:

doi:

Figure Lengend Snippet: (A-C) Volcano plots of small RNA-seq-identified mature miRs in control versus RBP knockdown cells. Small RNA-seq data were generated in nontargeting control (quadruplicate) and lentiviral shRNA knockdown of RBPs (duplicate) for LIN28B (A and B) and DKC1 (C). The miR knockdown/control log2(fold change) and padj were calculated based on DESEQ2 analysiswith Benjamini-Hochberg correction. Dotted red line represents padj = 0.05 cutoff. Labeled miRsare known targets of the RBP, and those viewed as browser tracks in (D)-(F) are further denoted by a star ★). miRs are colored as in Figure 1 volcano plots.

Article Snippet: Primary antibodies used were: GAPDH (Abcam ab8245; 1:10,000), α-TUB (Abcam ab7291, 1:5000), ILF3 (Bethyl A303–651A; 1:10,000), LIN28B (Bethyl A303–588A; 1:2,000), PRPF8 (Bethyl A303–921A; 1:10,000), PTBP1 (MBL RN011P; 1:5,000), SF3B4 (Bethyl A303–950A; 1:10,000), DDX3X (Bethyl A300–474A; 1:1000), SLTM (Bethyl A302–834A; 1:1000), LARP7 (Bethyl A303–723A; 1:1000), LARP4 (Bethyl A303–900A; 1:1000), DKC1 (Genetex GTX109000; 1:1000), RBFOX2 (Bethyl A300–864A; 1:1000), BUD13 (Bethyl A303–320A; 1:1000).

Techniques: RNA Sequencing Assay, Generated, shRNA, Labeling

Journal:

Article Title:

doi:

Figure Lengend Snippet: (A) Distribution ofthe numberof miR loci per RBPwith at least one miR locus eCLIP cluster passing the fold enrichment and p-adjusted cutoffs. The histogram is annotated forour positive controls (DGCR8, DKC1, LIN28B, and DROSHA) aswell asthe 10selected candidates (BUD13, DDX3X, ILF3, LARP4, LARP7, PRPF8, PTBP1, RBFOX2, SF3B4, and SLTM). The value in parentheses after each RBP is the number of eCLIP clusters intersecting miR loci.

Article Snippet: Primary antibodies used were: GAPDH (Abcam ab8245; 1:10,000), α-TUB (Abcam ab7291, 1:5000), ILF3 (Bethyl A303–651A; 1:10,000), LIN28B (Bethyl A303–588A; 1:2,000), PRPF8 (Bethyl A303–921A; 1:10,000), PTBP1 (MBL RN011P; 1:5,000), SF3B4 (Bethyl A303–950A; 1:10,000), DDX3X (Bethyl A300–474A; 1:1000), SLTM (Bethyl A302–834A; 1:1000), LARP7 (Bethyl A303–723A; 1:1000), LARP4 (Bethyl A303–900A; 1:1000), DKC1 (Genetex GTX109000; 1:1000), RBFOX2 (Bethyl A300–864A; 1:1000), BUD13 (Bethyl A303–320A; 1:1000).

Techniques:

Journal:

Article Title:

doi:

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Primary antibodies used were: GAPDH (Abcam ab8245; 1:10,000), α-TUB (Abcam ab7291, 1:5000), ILF3 (Bethyl A303–651A; 1:10,000), LIN28B (Bethyl A303–588A; 1:2,000), PRPF8 (Bethyl A303–921A; 1:10,000), PTBP1 (MBL RN011P; 1:5,000), SF3B4 (Bethyl A303–950A; 1:10,000), DDX3X (Bethyl A300–474A; 1:1000), SLTM (Bethyl A302–834A; 1:1000), LARP7 (Bethyl A303–723A; 1:1000), LARP4 (Bethyl A303–900A; 1:1000), DKC1 (Genetex GTX109000; 1:1000), RBFOX2 (Bethyl A300–864A; 1:1000), BUD13 (Bethyl A303–320A; 1:1000).

Techniques: Immunoprecipitation, Recombinant, Protease Inhibitor, SYBR Green Assay, Northern Blot, Software

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B is predominant LIN28 paralog expressed in human placenta. A, B) qPCR analysis of LIN28A and LIN28B mRNA expression in term human placenta (A) and isolated primary DCs, CTs, and STs (B) normalized to GAPDH. C–E) Representative LIN28B immunohistochemistry images in term human placenta of invasive trophoblasts (C), villous trophoblasts (D), and nonimmune rabbit IgG–only control (E). F) In situ protein LIN28B expression in DCs, CTs, and STs of placentas from normotensive pregnancies. Scale bars, 35 μm; n = 10 placental sections (F). Results represent means ± sem. *P < 0.05 vs. LIN28A (A, B) vs. DC (F).

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Expressing, Isolation, Immunohistochemistry, Control, In Situ

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B is decreased in placenta of PE pregnancies. A–D) Representative images of LIN28B immunostaining of invasive trophoblasts (A, C) and villous trophoblasts (B, D) in placentas from normotensive pregnancies (A, B) and in preeclamptic (PE) placental tissues (C, D). Scale bars, 35 μm. E) Representative immunoblot for LIN28B and α-tubulin in term placenta lysates from 4 normotensive pregnancies vs. 4 PE pregnancies (top) and densitometric analysis of immunoblotting results for LIN28B normalized to α-tubulin from tissue lysates from normotensive pregnancies (n = 15) and PE pregnancies (n = 13) (bottom). F) qPCR analysis for LIN28B mRNA expression in placental lysates from normotensive pregnancies (n = 21) and from preeclamptic pregnancies (n = 19). G) Let-7g/LIN28B protein ratio determined by qPCR analysis for let-7g normalized to U18 and LIN28B immunoblot normalized to α-tubulin in placental lysates from normotensive pregnancies and PE pregnancies. Results represent means ± sem. *P < 0.05 vs. normal.

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Immunostaining, Western Blot, Expressing

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B is highly expressed in syncytial sprouts and invasive trophoblasts in first trimester placentas and increases trophoblast migration in vitro. A–C) Representative images of immunohistochemical staining for LIN28B in human first trimester placenta. LIN28B is highly expressed in syncytial sprouts of chorionic villi (black arrows, A). LIN28B expression increases from proximal EVTs (PEVTs) to distal invasive EVTs (DEVTs) in placental cell columns (B). LIN28B expression is lowest in PEVTs and increased in interstitial trophoblasts (black arrows) invading maternal decidua (red arrowheads) in anchoring villi (C). D) Representative serial section of tissue shown in C double immunostained for DC marker vimentin (pink) and trophoblast marker cytokeratin-7 (brown). Red arrowheads and black arrows in D correspond to red arrowheads and black arrows in C. E) Representative results of scratch wound assay at time of scratch application (top) and after 24 h (bottom) from HTR8/SVneo cells transfected with either GFP (control) or LIN28B. F) Quantification of migration after 24 h. Scale bars, 35 mm. Results represent means ± sem. *P < 0.05 vs. control.

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Migration, In Vitro, Immunohistochemical staining, Staining, Expressing, Marker, Scratch Wound Assay Assay, Transfection, Control

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B regulates trophoblast proliferation, differentiation, inflammation, and C19MC miRNA expression. A) Representative immunoblot, densitometric quantification, and qPCR analysis of LIN28B levels 72 h after control or LIN28B shRNA-mediated knockdown in JEG3 cells. B, C) qPCR analysis of indicated gene (B) and miRNA (C), normalized to GAPDH and U18, respectively, after transient transfection of JEG3 cells with control or LIN28B shRNA. D) Representative immunoblot, densitometric quantification, and qPCR analysis of LIN28B levels 72 h after transient overexpression of GFP (control) or LIN28B encoding plasmids in HTR8/SVneo cells. E) qPCR analysis of indicated genes 72 h after transient overexpression of GFP or LIN28B in HTR8/SVneo cells. F) Cell proliferation analysis 72 h after transient knockdown of LIN28B in JEG3 cells or transient overexpression of LIN28B in HTR8/SVneo cells. Results represent means ± sem. *P < 0.05 shLIN28B vs. scrambled (A–C) or LIN28B vs. control (D, E).

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Expressing, Western Blot, Control, shRNA, Knockdown, Transfection, Over Expression

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: Hypoxia reduces expression of LIN28B in JEG3 and BeWo cells. A) Representative immunoblot for LIN28B in JEG3 and BeWo cells cultured in standard culture conditions (21% oxygen) or hypoxia (1% oxygen) for 72 h. B, C) Densitometric quantification of LIN28B protein expression normalized to α-tubulin (B) and qPCR analysis for LIN28B mRNA expression normalized to GAPDH (C) after 72 h of normal culture conditions or hypoxia. D) qPCR analysis for let-7a and let-7g in JEG3 and BeWo cells after culture in standard culture conditions or hypoxia for 72 h. E, F) qPCR analysis for indicated genes expressed by JEG3 cells (E) and BeWo cells (F) after culture in standard culture conditions or hypoxia for 72 h. Results represent means ± sem. *P < 0.05 for 1 vs. 21% oxygen standard culture conditions.

Article Snippet: HTR8/SVneo cells were transfected with green fluorescent protein (GFP) or pFRT/FLAG/HA-DEST LIN28B plasmid, a gift from T. Tuschl (The Rockefeller University, New York, NY, USA) (43798; Addgene, Cambridge, MA, USA) ( 29 ) using 25 kDa linear polyethylenimine (23966; Polysciences, Philadelphia, PA, USA).

Techniques: Expressing, Western Blot, Cell Culture

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) H&E and IHC of LIN28A and LIN28B of DEN-induced tumor nodules and adjacent tissue from mice treated with DEN for 8 months. Images are representative of 20 individual tumors. Scale bars: 50 μm. ( B ) Histology images show the normal liver architecture of control ( Tp53 fl/fl ), Tp53 -KO ( Albumin-Cre; Tp53 fl/fl ), and Lin28a/Lin28b/Tp53 -TKO ( Albumin-Cre; Tp53 fl/fl ; Lin28a fl/fl ; Lin28b fl/fl ) mice. Scale bar: 100 μm. ( C ) Representative gross images of WT, Tp53 -KO, and Lin28a/Lin28b/Tp53 -TKO livers treated with DEN for 8 months. Scale bar: 1 cm. ( D ) Surface tumor numbers from WT ( n = 14), Tp53 -KO ( n = 14), and Lin28a/Lin28b/Tp53 -TKO mice ( n = 8). Each dot represents 1 mouse. ( E ) This schematic shows DEN/CCl 4 and dox administration. Representative gross images of liver from control ( Cag-rtTA +/– ; Lin28a fl/fl ; Lin28b fl/fl ; n = 9) and Lin28a/Lin28b -DKO mice ( Cag-rtTA +/– ; TRE-Cre +/– ; Lin28a fl/fl ; Lin28b fl/fl ; n = 9) that were subjected to DEN/CCl 4 administration and dox water. Scale bars: 1 cm. All the images can also be found in . ( F and G ) Liver-to-body weight ratios (LW/BW) ( F ) and surface tumor numbers ( G ) of control ( n = 9) and Lin28a/Lin28b -DKO ( n = 9) mice. ( H ) Representative H&E images and LIN28B staining in tumors of control ( n = 9) and Lin28a/Lin28b -DKO mice ( n = 9). NL, normal liver; T1, tumor number 1; T2, tumor number 2. * P < 0.05; ** P < 0.01.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Control, Staining

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) Schematic for HDT of transposons in Tp53 -KO and Lin28a/Lin28b/Tp53 -TKO mice. ( B ) Representative gross images (left) and liver-to-body weight ratios (right) of Tp53 -KO ( n = 14) and Lin28a/Lin28b/Tp53 -TKO ( n = 8) mice receiving transposons carrying NRAS G12V for 7 weeks (P105). Scale bars: 1 cm; 5 mm (right panels). ( C ) IHC shows NRAS and LIN28B expression in early lesions of Tp53 -KO and Lin28a/Lin28b/Tp53 -TKO mice that had NRAS G12V injected 2 weeks prior (P70). Scale bars: 50 μm. ( D ) Representative gross images (left) and liver-to-body weight ratios (right) of Tp53 -KO ( n = 7) and Lin28a/Lin28b/Tp53 -TKO ( n = 3) mice receiving transposons carrying AKT for 7 weeks (P105). Scale bars: 1 cm; 7.5 mm (right panels). ( E ) Representative gross images (left) and liver-to-body weight ratios (right) of Tp53 -KO ( n = 3) and Lin28a/Lin28b/Tp53 -TKO ( n = 3) mice receiving transposons carrying CTNNB1 N90 and YAP S137A for 7 weeks (P105). Scale bars: 1 cm; 5 mm (right panels). ** P < 0.01.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Expressing, Injection

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) Representative gross images of Tp53-KO ( Albumin-Cre; Tp53 fl/fl ; n = 4), Lin28a/Tp53 -DKO ( Albumin-Cre ; Tp53 fl/fl ; Lin28a fl/fl ; n = 5), and Lin28b/Tp53 -DKO ( Albumin-Cre ; p53 fl/fl ; Lin28b fl/fl ; n = 4) mice that received NRAS G12V by HDT for 7 weeks. Scale bars: 1 cm; 5 mm (right panels). ( B ) Liver-to-body weight ratios for A . One-way ANOVA was performed. ( C ) Representative gross images of Lin28a/Lin28b/Tp53 -TKO mice that received NRAS G12V in combination with pT3-eGFP ( n = 5), pT3-LIN28A ( n = 8), or pT3-LIN28B ( n = 3) for 7 weeks. Scale bars: 1 cm; 5 mm (right panels). ( D ) Liver-to-body weight ratios for C . One-way ANOVA was performed. ( E ) Representative gross images of Lin28a/Lin28b/Tp53 -TKO mice that received NRAS G12V combined with pCMV-eGFP ( n = 4) or pCMV-LIN28B ( n = 4) for 7 weeks. Scale bars: 1 cm; 5 mm (right panels). ( F ) Liver-to-body weight ratios for E . ** P < 0.01; *** P < 0.001.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques:

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) Venn diagram shows 15 factors that bind to LIN28 proteins as both proteins and mRNAs. See gene names in . ( B ) WB analysis shows LIN28B expression 48 hours after siRNA treatment in Huh7 cells. SE, short exposure; LE, long exposure. The numbers below the boxes show relative intensity. ( C ) Polysome profiling shows total translational activity in Huh7 cells with LIN28B siRNA knockdown compared with control siRNA–treated cells. The graph shows a representative profile from 3 replicate experiments. ( D ) RT-qPCR analysis of LIN28 targets show the percentage of active translating mRNA fraction in control and LIN28B knockdown Huh7 cells. Data include 3 biological replicates. * P < 0.05; ** P < 0.01.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Expressing, Activity Assay, Knockdown, Control, Quantitative RT-PCR

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) eCLIP data show LIN28B-binding regions on RPS5 mRNA. Red marks under the gene indicate the location of consensus LIN28B-binding motifs (GGAGA). Deletion (Δ) and mutation (MT) of consensus motifs were introduced to prevent LIN28B binding. Exon 1, 2, 3, and 3′ UTR sequences were inserted into the Renilla 3′ UTR region. ( B ) WB analysis of RPS5 and LIN28B in Huh7 and SNU308 cell lines. Numbers below the boxes show relative intensities. ( C ) Renilla luciferase activity promoted by RPS5 exon 1, exon 2, exon 3, and 3′ UTR reporters in LIN28B siRNA knockdown ( n = 3) versus control Huh7 cells ( n = 3). ( D ) Renilla luciferase activity promoted by RPS5 exon 1, exon 2, exon 3, and 3′ UTR reporters in LIN28B overexpression ( n = 3) versus control SNU308 cells ( n = 3). ( E and F ) Renilla luciferase activity promoted by WT RPS5 sequences compared with deletion and mutation containing reporters in control (blue) and LIN28B siRNA knockdown (red) Huh7 cells ( n = 3) ( E ) and in control overexpression (green) and LIN28B overexpression (orange) SNU308 cells ( n = 3) ( F ). One-way ANOVA was performed. ** P < 0.01; *** P < 0.001; **** P < 0.0001.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Binding Assay, Mutagenesis, Luciferase, Activity Assay, Knockdown, Control, Over Expression

Journal: The Journal of Clinical Investigation

Article Title: Liver cancer initiation requires translational activation by an oncofetal regulon involving LIN28 proteins

doi: 10.1172/JCI165734

Figure Lengend Snippet: ( A ) Representative gross images of Lin28a/Lin28b/Tp53 -TKO mice receiving NRAS G12V in combination with pT3-RBPs ( n > 3), pT3-eGFP ( n = 5), or pT3-Luciferase ( n = 5) for 7 weeks. Scale bars: 1 cm. All the images can also be found in . ( B ) Surface tumor number for A . One-way ANOVA was performed. ( C ) Liver-to-body weight ratios for A . One-way ANOVA was performed. ( D ) WB analysis quantified OP-puro labeling protein in Huh7 cells with Lin28b knockdown plus target overexpression. Number below the box shows relative intensity. ( E ) Representative gross images of Tp53 -KO ( Albumin-Cre; Tp53 fl/fl ; n = 5) and Lin28a/Lin28b/Tp53 -TKO ( Albumin-Cre ; Tp53 fl/fl ; Lin28a fl/fl ; Lin28b fl/fl ) mice that received NRAS G12V by HDT for 7 weeks. TKO mice were subjected to BAZ2A inhibitors ( n = 6) or DMSO ( n = 5) once per week starting 3 days after HDT. Scale bars: 1 cm. One-way ANOVA was performed. ( F ) Schematic shows the importance of LIN28 proteins for tumor initiation. The image was designed and drawn using BioRender. ** P < 0.01; **** P < 0.0001.

Article Snippet: Antibodies used were as follows: NRAS (Abcam, AB77392, IHC), p-ERK (CST, 9101, IHC), LIN28B (Proteintech, 16178-1-AP or CST 5422, IHC and WB), LIN28A (CST, 8641, IHC), c-MYC (MilliporeSigma, M4439, IHC), RPS5 (Abcam, AB210745, WB), IGF2BP1 (Abcam, AB166798, IHC), IGF2BP2 (Abcam, AB124930, IHC), IGF2BP3 (Proteintech, 14642-1-AP, IHC), CK19 (DSHB, TROMA-III, IHC), EpCAM (CST, 14452, IHC), and β-actin (CST 4970, WB).

Techniques: Luciferase, Labeling, Knockdown, Over Expression

Journal: International Journal of Molecular Sciences

Article Title: EGCG Disrupts the LIN28B/Let-7 Interaction and Reduces Neuroblastoma Aggressiveness

doi: 10.3390/ijms25094795

Figure Lengend Snippet: LIN28B downregulation increases let-7 miRNA levels and promotes differentiation in NB cells. ( A ) Representative immunoblot showing MYCN and LIN28B levels in KELLY, SK-N-BE(2), CHP134, and NB69 NB cell lines. β-TUBULIN was used as a loading control. n = 3 biological replicates. ( B ) LIN28B mRNA expression levels analyzed by qPCR in shLIN28B CHP134 and shLIN28B NB69 cell lines. Data were normalized to shCTRL cells. n = 3 biological replicates. Mean ± SD. Unpaired two-tailed Welch’s t -test analysis (* p < 0.05). ( C ) Representative immunoblots showing LIN28B levels in shLIN28B and shCTRL CHP134 and NB69 cell lines. β-TUBULIN was used as a loading control. ( D ) LIN28B protein levels in shLIN28B CHP134 and shLIN28B NB69 cells. Data were normalized to shCTRL cells. n = 3 biological replicates. Mean ± SD. Unpaired two-tailed Welch’s t -test analysis (** p < 0.01; *** p < 0.001). ( E ) Let-7 miRNA expression levels analyzed by qPCR in shLIN28B CHP134 and shLIN28B NB69 cell lines. Expression levels are shown as fold change relative to shCTRL cells (dashed line). Data were normalized to the internal reference gene U6. n = 2 biological replicates, n = 3 technical replicates each. Mean ± SD. Unpaired two-tailed t -test analysis (ns = not significant; * p < 0.05; ** p < 0.01). ( F ) SOX2 , SOX9 , NESTIN , and GAP43 mRNA expression levels analyzed by qPCR in shLIN28B CHP134 and shLIN28B NB69 cell lines. Fold change relative to shCTRL cells is shown (dashed line). SDHA was used as an internal reference gene. n = 3 biological replicates, n = 3 technical replicates each. Mean ± SD. Unpaired two-tailed t -test analysis (ns = not significant; * p < 0.05; ** p < 0.01). ( G ) Representative immunoblot showing LIN28B, MYCN, NESTIN, SOX9, and GAP43 levels in shCTRL and shLIN28B CHP134 cells. GAPDH was used as a loading control. n = 3 biological replicates. ( H ) LIN28B, MYCN, NESTIN, SOX9, and GAP43 protein levels in shLIN28B CHP134 cells. Data were normalized to shCTRL cells (dashed line). n = 3 biological replicates. Mean ± SD. Unpaired two-tailed Welch’s t -test analysis (* p < 0.05; ** p < 0.01; *** p < 0.001).

Article Snippet: The full-length human LIN28B cDNA sequence (NM_001004317.3) was amplified from retro-transcribed RNA of HEK293 cells and inserted into the pCMV6-AC-Myc-His mammalian expression vector (cat. PS100006, Origene Technologies, Rockville, MD, USA) by using the forward (5′ AGTCGCGATCGCATGGCCGAAGGCGGGGC 3′) and reverse (5′ ACGTACGCGTTGTCTTTTTCCTTTTTTGAACTGAAGGCC 3′) primers containing the SgfI and the MluI restriction sites, respectively.

Techniques: Western Blot, Control, Expressing, Two Tailed Test

Journal: International Journal of Molecular Sciences

Article Title: EGCG Disrupts the LIN28B/Let-7 Interaction and Reduces Neuroblastoma Aggressiveness

doi: 10.3390/ijms25094795

Figure Lengend Snippet: Identification of candidate molecules that interfere with the LIN28B/let-7 interaction: screening and validation. ( A ) Schematic representation of the AlphaScreen technique. ( B ) A dot plot summarizing the screening results expressed as a percentage of the mean of the negative controls. A biotinylated pre-let-7g miRNA was used as a substrate for interaction with the rLIN28B. No drug addition was used as a negative control (highlighted in purple), while a biotinylated pre-let-7g mut miRNA was used instead of the biotinylated pre-let-7g miRNA as a positive control (highlighted in light blue). Compounds that differed by two times the standard deviation from the mean of the negative controls were selected as hits (highlighted in orange). ( C ) Schematic representation of the REMSA. ( D ) Representative REMSA results for the validation of the hits selected by AlphaScreen. The rLIN28B protein plus a Cy3-labelled pre-let-7g miRNA probe was used as a negative control, while the free Cy3-labelled pre-let-7g miRNA probe was used as a positive control. (1) Terbutaline hemisulfate, (2) thioguanine, (3) thioridazine hydrochloride, (4) suramin, (5) diflubenzuron, (6) N -hydroxymethylnicotinamide, (7) salicylanilide, (8) dibutyl phthalate, (9) aminosalicylate sodium, (10) amoxicillin, (11) amphotericin B, (12) anthralin, (13) chloramphenicol, (14) chlorcyclizine hydrochloride, (15) dapsone, (16) ethionamide, (17) telenzepine hydrochloride, (18) medroxyprogesterone acetate, (19) piperazine, (20) procaine hydrochloride, (21) acedapsone, (22) doxorubicin, (23) dehydro (11,12)ursolic acid lactone, (24) coralyne chloride, (25) 2′,5′-dihydroxy-4-methoxychalcone. ( E ) Molecular structures of EGCG, TFMG, GA, and ATA. TFMG was present in the screened library as mixed isomers from black tea. Theaflavin 3-gallate isomer is shown here. The degree of structural similarity between EGCG and TFMG is highlighted in pink.

Article Snippet: The full-length human LIN28B cDNA sequence (NM_001004317.3) was amplified from retro-transcribed RNA of HEK293 cells and inserted into the pCMV6-AC-Myc-His mammalian expression vector (cat. PS100006, Origene Technologies, Rockville, MD, USA) by using the forward (5′ AGTCGCGATCGCATGGCCGAAGGCGGGGC 3′) and reverse (5′ ACGTACGCGTTGTCTTTTTCCTTTTTTGAACTGAAGGCC 3′) primers containing the SgfI and the MluI restriction sites, respectively.

Techniques: Biomarker Discovery, Amplified Luminescent Proximity Homogenous Assay, Negative Control, Positive Control, Standard Deviation

Journal: International Journal of Molecular Sciences

Article Title: EGCG Disrupts the LIN28B/Let-7 Interaction and Reduces Neuroblastoma Aggressiveness

doi: 10.3390/ijms25094795

Figure Lengend Snippet: EGCG disrupts the LIN28B/let-7 interaction by binding to LIN28B. ( A ) Molecular structure of (−)-epigallocatechin 3,5-digallate (EGCDG). The degree of structural similarity with EGCG and TFMG is highlighted in pink. ( B ) Dose-dependent titration experiments performed using the Alpha assay showing the effect of increasing concentrations of EGCG, TFMG, GA, and EGCDG on the interaction between rLIN28B and biotinylated pre-let-7g miRNA. ( C ) Dose-dependent titration experiments performed using the Alpha assay showing the effect of increasing concentrations of EGCG and TFMG on the interaction between HuR and the TNFα AU-rich element. ( D – H ) Molecular modeling studies: the binding conformation of the pre-let-7 miRNA (AGGAGAU) ( D ) and the obtained poses by molecular docking for EGCG ( E ), TFMG (theaflavin 3-gallate) ( F ), EGCDG ( G ), and GA ( H ).

Article Snippet: The full-length human LIN28B cDNA sequence (NM_001004317.3) was amplified from retro-transcribed RNA of HEK293 cells and inserted into the pCMV6-AC-Myc-His mammalian expression vector (cat. PS100006, Origene Technologies, Rockville, MD, USA) by using the forward (5′ AGTCGCGATCGCATGGCCGAAGGCGGGGC 3′) and reverse (5′ ACGTACGCGTTGTCTTTTTCCTTTTTTGAACTGAAGGCC 3′) primers containing the SgfI and the MluI restriction sites, respectively.

Techniques: Binding Assay, Titration

Journal: Journal of Cancer

Article Title: Lin28b is involved in curcumin-reversed paclitaxel chemoresistance and associated with poor prognosis in hepatocellular carcinoma

doi: 10.7150/jca.33421

Figure Lengend Snippet: Increased Lin28B mRNA expression confers poor prognosis in patients with HCC. (A, B) Lin28B levels in the HCC tissues of patients in the GSE41804 and TCGA-LIHC datasets, respectively. Kaplan-Meier survival curve showing the (C) OS and (D) PFS rates in the TCGA-LIHC cohort. * p <0.05.

Article Snippet: The pGL3-IRES-Lin28b-P3 plasmid that contains Lin28B gene promoter fragment was got form Addgene (#64794, Cambridge, MA, USA) .

Techniques: Expressing

Journal: Journal of Cancer

Article Title: Lin28b is involved in curcumin-reversed paclitaxel chemoresistance and associated with poor prognosis in hepatocellular carcinoma

doi: 10.7150/jca.33421

Figure Lengend Snippet: Correlation between Lin28B expression and HCC clinicopathological features in TCGA-LIHC

Article Snippet: The pGL3-IRES-Lin28b-P3 plasmid that contains Lin28B gene promoter fragment was got form Addgene (#64794, Cambridge, MA, USA) .

Techniques: Expressing, Significance Assay

Journal: Journal of Cancer

Article Title: Lin28b is involved in curcumin-reversed paclitaxel chemoresistance and associated with poor prognosis in hepatocellular carcinoma

doi: 10.7150/jca.33421

Figure Lengend Snippet: Univariate and multivariate analysis of prognostic factors in patients included in the TCGA-LIHC

Article Snippet: The pGL3-IRES-Lin28b-P3 plasmid that contains Lin28B gene promoter fragment was got form Addgene (#64794, Cambridge, MA, USA) .

Techniques: Expressing

Journal: Journal of Cancer

Article Title: Lin28b is involved in curcumin-reversed paclitaxel chemoresistance and associated with poor prognosis in hepatocellular carcinoma

doi: 10.7150/jca.33421

Figure Lengend Snippet: Contribution of Lin28B to paclitaxel resistance in HCC cells. (A) Hep3B cells stably overexpressing Lin28B, (B) Hep3B/TAX cells transfected with Lin28B siRNAs for 48h, and (C) HepG2 cells stably overexpressing Lin28B were subjected to qRT-PCR, western blot, and the MTT assay. Left, qRT-PCR and western blot to assess Lin28B expression; middle, representative dose-dependent cell viability curves; right, average resistance indexes (RI, the ratio of IC 50 value of the experimental cells to that of the control cells). Vector, empty vector transfected; Lin28B (+), Lin28B overexpression; si-NC, negative control siRNA; siRNA, Lin28B siRNA; * p <0.05; ** p <0.01.

Article Snippet: The pGL3-IRES-Lin28b-P3 plasmid that contains Lin28B gene promoter fragment was got form Addgene (#64794, Cambridge, MA, USA) .

Techniques: Stable Transfection, Transfection, Quantitative RT-PCR, Western Blot, MTT Assay, Expressing, Control, Plasmid Preparation, Over Expression, Negative Control

Journal: Journal of Cancer

Article Title: Lin28b is involved in curcumin-reversed paclitaxel chemoresistance and associated with poor prognosis in hepatocellular carcinoma

doi: 10.7150/jca.33421

Figure Lengend Snippet: Effect of Lin28B on paclitaxel-induced apoptosis. (A) Hep3B/TAX cells transiently transfected with siRNAs for 48h and (B) Hep3B and HepG2 cells stably overexpressing Lin28B were treated with paclitaxel for 48 h and apoptosis was analyzed. (C) Western blot of apoptosis-related proteins (caspase 9, caspase 3, and Bcl-2). Vector, empty vector transfected; Lin28B (+), Lin28B overexpression; si-NC, negative control siRNA; si-Lin28B, Lin28B siRNA; * p <0.05; ** p <0.01.

Article Snippet: The pGL3-IRES-Lin28b-P3 plasmid that contains Lin28B gene promoter fragment was got form Addgene (#64794, Cambridge, MA, USA) .

Techniques: Transfection, Stable Transfection, Western Blot, Plasmid Preparation, Over Expression, Negative Control

Journal: Journal of Cancer

Article Title: Lin28b is involved in curcumin-reversed paclitaxel chemoresistance and associated with poor prognosis in hepatocellular carcinoma

doi: 10.7150/jca.33421

Figure Lengend Snippet: Co-treatment with curcumin and paclitaxel causes cytotoxicity and apoptosis in HCC cells in vivo . (A-B) Analysis of the anti-tumor effects of co-treatment with curcumin (40 mg/kg) and paclitaxel (10 mg/kg). Tumor volume is presented as a growth curve, and the tumor weight is presented as a Cleveland dot plot. (C) Western blot of apoptosis-related proteins (caspase 9, 3, and Bcl-2) and Lin28B expression levels in the tumors of the mice. (D) Representative immunohistochemistry (IHC) images of Ki-67 and Lin28B in tumor tissue samples, Scale bar=50 μm. * p <0.05; ** p <0.01.

Article Snippet: The pGL3-IRES-Lin28b-P3 plasmid that contains Lin28B gene promoter fragment was got form Addgene (#64794, Cambridge, MA, USA) .

Techniques: In Vivo, Western Blot, Expressing, Immunohistochemistry

Journal: Journal of Cancer

Article Title: Lin28b is involved in curcumin-reversed paclitaxel chemoresistance and associated with poor prognosis in hepatocellular carcinoma

doi: 10.7150/jca.33421

Figure Lengend Snippet: The effect of curcumin on paclitaxel-induced Lin28B and NF-κB levels. (A, B) qRT-PCR and western blot showing Lin28B levels in Hep3B/TAX cells treated with curcumin and paclitaxel alone or in combination.(C) IHC showing NF-κB levels in the nuclear fractions of Hep3B/TAX cells treated with curcumin and paclitaxel alone or in combination, Scale bar=50 μm. (D) Hep3B/TAX cells were fixed with 4% paraformaldehyde and permeabilized with 5% Triton X-100. After blocking the slides with 5%BSA, they were stained for NF-κB and mounted using DAPI, and images were captured using a Nikon microscope. (E) NF-κB activity was measured using the NF-κB (p65) Transcription Factor Assay Kit. * p <0.05, ** p <0.01 for the control versus paclitaxel groups. ∆ p <0.05 ∆∆ p <0.01 for paclitaxel versus paclitaxel and curcumin co-treatment groups (Cur, curcumin; PTX, paclitaxel).

Article Snippet: The pGL3-IRES-Lin28b-P3 plasmid that contains Lin28B gene promoter fragment was got form Addgene (#64794, Cambridge, MA, USA) .

Techniques: Quantitative RT-PCR, Western Blot, Blocking Assay, Staining, Microscopy, Activity Assay, Transcription Factor Assay, Control

Journal: Journal of Cancer

Article Title: Lin28b is involved in curcumin-reversed paclitaxel chemoresistance and associated with poor prognosis in hepatocellular carcinoma

doi: 10.7150/jca.33421

Figure Lengend Snippet: Curcumin inhibits the expression of Lin28B through NF-κB. (A) Western bolt analysis of Lin28B and NF-κB (p65) expression levels in Hep3B/TAX cells after treatment with 1.25, 2.5, and 5 μM curcumin for 48 h. (B) Western bolt analysis of Lin28B and NF-κB (p65) expression levels in Hep3B/TAX cells, following stimulation with 10 ng/mL TNF-α and a 48 h curcumin treatment. (C) qRT-PCR analysis of Lin28B in Hep3B/TAX cells stimulated by 10 ng/mL TNF-α after a 48 h curcumin treatment. (D) DNA-binding activity of NF-κB (p65) was measured using the NF-κB (p65) Transcription Factor Assay Kit. (E) Immunofluorescence staining was performed, and images were captured using a Nikon microscope. (F) Schematic representation of the human Lin28B promoter region contain in pGL3-Lin28B-wt or pGL3-Lin28B-mut vector. NF-κB binding motifs were shown as black blocks. The sequences of consensus and mutated NF-κB binding motif were shown. (G) Luciferase activity of pGL3-Lin28B-wt, pGL3-Lin28B-mut, or empty vector in Hep3B/TAX cells which were stimulated with or without 10 ng/mL TNF-α for 4h after a 48 h curcumin treatment. * p <0.05 ** p <0.01 for control versus paclitaxel groups, ∆ p <0.05 ∆∆ p <0.01 for paclitaxel versus paclitaxel and curcumin co-treatment groups, NS: Not significant (Cur, curcumin; PTX, paclitaxel).

Article Snippet: The pGL3-IRES-Lin28b-P3 plasmid that contains Lin28B gene promoter fragment was got form Addgene (#64794, Cambridge, MA, USA) .

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Binding Assay, Activity Assay, Transcription Factor Assay, Immunofluorescence, Staining, Microscopy, Plasmid Preparation, Luciferase, Control

Journal: Journal of Cancer

Article Title: Lin28b is involved in curcumin-reversed paclitaxel chemoresistance and associated with poor prognosis in hepatocellular carcinoma

doi: 10.7150/jca.33421

Figure Lengend Snippet: Schematic of paclitaxel-induced chemoresistance involving Lin28B and the chemosensitizing effect of curcumin in HCC cells. Paclitaxel treatment of HCC cells upregulated Lin28B expression and induced chemoresistance, whereas co-treatment with curcumin and paclitaxel downregulated Lin28B expression by inhibiting the activity of NF-κB.

Article Snippet: The pGL3-IRES-Lin28b-P3 plasmid that contains Lin28B gene promoter fragment was got form Addgene (#64794, Cambridge, MA, USA) .

Techniques: Expressing, Activity Assay

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B is predominant LIN28 paralog expressed in human placenta. A, B) qPCR analysis of LIN28A and LIN28B mRNA expression in term human placenta (A) and isolated primary DCs, CTs, and STs (B) normalized to GAPDH. C–E) Representative LIN28B immunohistochemistry images in term human placenta of invasive trophoblasts (C), villous trophoblasts (D), and nonimmune rabbit IgG–only control (E). F) In situ protein LIN28B expression in DCs, CTs, and STs of placentas from normotensive pregnancies. Scale bars, 35 μm; n = 10 placental sections (F). Results represent means ± sem. *P < 0.05 vs. LIN28A (A, B) vs. DC (F).

Article Snippet: JEG3 cells were transfected with scrambled short hairpin RNA (shRNA) or an shRNA targeting LIN28B (TG311156; OriGene Technologies, Rockville, MD, USA) using Lipofectamine 2000 according to the manufacturer’s instructions (Thermo Fisher Scientific).

Techniques: Expressing, Isolation, Immunohistochemistry, Control, In Situ

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B is decreased in placenta of PE pregnancies. A–D) Representative images of LIN28B immunostaining of invasive trophoblasts (A, C) and villous trophoblasts (B, D) in placentas from normotensive pregnancies (A, B) and in preeclamptic (PE) placental tissues (C, D). Scale bars, 35 μm. E) Representative immunoblot for LIN28B and α-tubulin in term placenta lysates from 4 normotensive pregnancies vs. 4 PE pregnancies (top) and densitometric analysis of immunoblotting results for LIN28B normalized to α-tubulin from tissue lysates from normotensive pregnancies (n = 15) and PE pregnancies (n = 13) (bottom). F) qPCR analysis for LIN28B mRNA expression in placental lysates from normotensive pregnancies (n = 21) and from preeclamptic pregnancies (n = 19). G) Let-7g/LIN28B protein ratio determined by qPCR analysis for let-7g normalized to U18 and LIN28B immunoblot normalized to α-tubulin in placental lysates from normotensive pregnancies and PE pregnancies. Results represent means ± sem. *P < 0.05 vs. normal.

Article Snippet: JEG3 cells were transfected with scrambled short hairpin RNA (shRNA) or an shRNA targeting LIN28B (TG311156; OriGene Technologies, Rockville, MD, USA) using Lipofectamine 2000 according to the manufacturer’s instructions (Thermo Fisher Scientific).

Techniques: Immunostaining, Western Blot, Expressing

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B is highly expressed in syncytial sprouts and invasive trophoblasts in first trimester placentas and increases trophoblast migration in vitro. A–C) Representative images of immunohistochemical staining for LIN28B in human first trimester placenta. LIN28B is highly expressed in syncytial sprouts of chorionic villi (black arrows, A). LIN28B expression increases from proximal EVTs (PEVTs) to distal invasive EVTs (DEVTs) in placental cell columns (B). LIN28B expression is lowest in PEVTs and increased in interstitial trophoblasts (black arrows) invading maternal decidua (red arrowheads) in anchoring villi (C). D) Representative serial section of tissue shown in C double immunostained for DC marker vimentin (pink) and trophoblast marker cytokeratin-7 (brown). Red arrowheads and black arrows in D correspond to red arrowheads and black arrows in C. E) Representative results of scratch wound assay at time of scratch application (top) and after 24 h (bottom) from HTR8/SVneo cells transfected with either GFP (control) or LIN28B. F) Quantification of migration after 24 h. Scale bars, 35 mm. Results represent means ± sem. *P < 0.05 vs. control.

Article Snippet: JEG3 cells were transfected with scrambled short hairpin RNA (shRNA) or an shRNA targeting LIN28B (TG311156; OriGene Technologies, Rockville, MD, USA) using Lipofectamine 2000 according to the manufacturer’s instructions (Thermo Fisher Scientific).

Techniques: Migration, In Vitro, Immunohistochemical staining, Staining, Expressing, Marker, Scratch Wound Assay Assay, Transfection, Control

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: LIN28B regulates trophoblast proliferation, differentiation, inflammation, and C19MC miRNA expression. A) Representative immunoblot, densitometric quantification, and qPCR analysis of LIN28B levels 72 h after control or LIN28B shRNA-mediated knockdown in JEG3 cells. B, C) qPCR analysis of indicated gene (B) and miRNA (C), normalized to GAPDH and U18, respectively, after transient transfection of JEG3 cells with control or LIN28B shRNA. D) Representative immunoblot, densitometric quantification, and qPCR analysis of LIN28B levels 72 h after transient overexpression of GFP (control) or LIN28B encoding plasmids in HTR8/SVneo cells. E) qPCR analysis of indicated genes 72 h after transient overexpression of GFP or LIN28B in HTR8/SVneo cells. F) Cell proliferation analysis 72 h after transient knockdown of LIN28B in JEG3 cells or transient overexpression of LIN28B in HTR8/SVneo cells. Results represent means ± sem. *P < 0.05 shLIN28B vs. scrambled (A–C) or LIN28B vs. control (D, E).

Article Snippet: JEG3 cells were transfected with scrambled short hairpin RNA (shRNA) or an shRNA targeting LIN28B (TG311156; OriGene Technologies, Rockville, MD, USA) using Lipofectamine 2000 according to the manufacturer’s instructions (Thermo Fisher Scientific).

Techniques: Expressing, Western Blot, Control, shRNA, Knockdown, Transfection, Over Expression

Journal: The FASEB Journal

Article Title: Decreased LIN28B in preeclampsia impairs human trophoblast differentiation and migration

doi: 10.1096/fj.201801163R

Figure Lengend Snippet: Hypoxia reduces expression of LIN28B in JEG3 and BeWo cells. A) Representative immunoblot for LIN28B in JEG3 and BeWo cells cultured in standard culture conditions (21% oxygen) or hypoxia (1% oxygen) for 72 h. B, C) Densitometric quantification of LIN28B protein expression normalized to α-tubulin (B) and qPCR analysis for LIN28B mRNA expression normalized to GAPDH (C) after 72 h of normal culture conditions or hypoxia. D) qPCR analysis for let-7a and let-7g in JEG3 and BeWo cells after culture in standard culture conditions or hypoxia for 72 h. E, F) qPCR analysis for indicated genes expressed by JEG3 cells (E) and BeWo cells (F) after culture in standard culture conditions or hypoxia for 72 h. Results represent means ± sem. *P < 0.05 for 1 vs. 21% oxygen standard culture conditions.

Article Snippet: JEG3 cells were transfected with scrambled short hairpin RNA (shRNA) or an shRNA targeting LIN28B (TG311156; OriGene Technologies, Rockville, MD, USA) using Lipofectamine 2000 according to the manufacturer’s instructions (Thermo Fisher Scientific).

Techniques: Expressing, Western Blot, Cell Culture

Journal: PLoS ONE

Article Title: Epithelial to Mesenchymal Transition Is Mechanistically Linked with Stem Cell Signatures in Prostate Cancer Cells

doi: 10.1371/journal.pone.0012445

Figure Lengend Snippet: (A) The expression of genes at the mRNA levels for Oct4, Nanog, Sox family genes and Lin28B in PC3 Neo and PC3 PDGF-D cells were determined by using real time RT-PCR. (B) The results from Western blot showed that the expressions of Oct4 Sox2, Nanog, Stat3 and Lin28B were significantly increased in PC3 PDGF-D cells. (C) Real time RT-PCR was used to quantify the mRNA expression of EED, EZH2 and Suz12a. Relative mRNA levels were normalized to GAPDH. (D) The results from Western blot showed that the expression of EZH2 was significantly increased in PC3 PDGF-D cells. (E) The mRNA levels of Notch signaling factors in PC3 Neo and PC3 PDGF-D cells were determined by using real time RT-PCR. (F) The results from Western blot showed that the expressions of Notch and Notch ligands were significantly increased in PC3 PDGF-D cells. GAPDH was used for protein loading control. (N: PC3 Neo cells, D: PC3 PDGF-D cells,p10: passage 10).

Article Snippet: Cells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO).

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Control

Journal: PLoS ONE

Article Title: Epithelial to Mesenchymal Transition Is Mechanistically Linked with Stem Cell Signatures in Prostate Cancer Cells

doi: 10.1371/journal.pone.0012445

Figure Lengend Snippet: PC3 PDGF-D cells were transfected with pre-miR-200. 3 days after transfection, cells were split and transfected repeatedly with pre-miR-200 every 3–4 days for 14 days. (A) Photographs of cells are shown: transfection of PC3 PDGF-D cells with pre-miR-200 for 14 days, miR-200b and miR-200c reversed EMT cells to MET cell morphology. (B) The cells were collected for generation of prostaspheres after 14-day transfection with pre-miR-200. MiR-200b and miR-200c reduced the number of prostaspheres. (C) Western Blot showing that Notch1, Lin28B and ZEB1 expressions were down-regulated in PC3 PDGF-D cells transfected with miR-200b and miR-200c. (D) The level of miR-200c significantly decreased in ARCaP M by using real time RT-PCR. (E) Transfection of pre-miR-200c after 6 days reduced the prostasphere-forming ability in ARCaP M cells (Bar:100 µm). (F) Western blot showed that re-expression of miR-200c by transfection of pre-miR-200c increased the E-cadherin expression and repressed expression of ZEB1 and Notch1 in ARCaP M cells, which consistent with the change from mesenchymal to epithelial cell morphology (G). *, p<0.05 compared to control; **, p<0.01 compared to control. (Con: control, 200a: pre-miR-200a, 200b: pre-miR-200b, 200c: pre-miR-200c, E-cad: E-cadherin).

Article Snippet: Cells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO).

Techniques: Transfection, Western Blot, Quantitative RT-PCR, Expressing, Control

Journal: PLoS ONE

Article Title: Epithelial to Mesenchymal Transition Is Mechanistically Linked with Stem Cell Signatures in Prostate Cancer Cells

doi: 10.1371/journal.pone.0012445

Figure Lengend Snippet: (A) The levels for let-7 family in PC3 Neo and PC3 PDGF-D cells were determined by using real time RT-PCR. (B) Real time RT-PCR was used to quantify the expression of let-7 in PC3 PDGF-D cells transfected with Lin28B siRNA for 3 days. (C) Photomicrographs showing prostaspheres generated from PC3 PDGF-D cells transfected with pre-let-7 or combination of pre-let-7 and Lin28B siRNA 14 days after transfection (bar:100 µm). (D) The cells were collected for prostasphere-forming assay after 14-day transfection. Let-7a, let-7b, let-7d and combination of Let-7a, let-7b, let-7d as well as co-transfection with let-7 and Lin28B siRNA decreased the number of prostaspheres. (E) The results from Western blot showed the expression of Lin28B, Sox2, Nanog, and Oct4 in PC3 PDGF-D cells transfected with pre-let-7 or co-transfected with pre-let-7 and Lin28B siRNA after 9-day transfection. *, p<0.05 compared to control; **, p<0.01 compared to control. (Con: control, a: pre-let-7a, abd: combination of pre-let-7a, pre-let-7a, pre-let-7d, al: combination of pre-let-7a and Lin28B siRNA, Lin28B-si: Lin28B siRNA, Neo: PC3 Neo cells, PDGF-D: PC3 PDGF-D cells).

Article Snippet: Cells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO).

Techniques: Quantitative RT-PCR, Expressing, Transfection, Generated, Cotransfection, Western Blot, Control

Journal: PLoS ONE

Article Title: Epithelial to Mesenchymal Transition Is Mechanistically Linked with Stem Cell Signatures in Prostate Cancer Cells

doi: 10.1371/journal.pone.0012445

Figure Lengend Snippet: (A) Single cell suspensions of PC3 PDGF-D transfected with Sox2, Nanog, Oct4 and Lin28B siRNA and incubated for 24 h were plated on ultra low adherent wells of 6-well plate at 2000 cells/well. After 3 days, the numbers of prostaspheres were counted under microscope. Transfection of Sox2, Nanog, Oct4 or Lin28B siRNA reduced the prostasphere-forming capacity (B) Prostaspheres were photographed and the size of prostaspheres in diameter was measured using software image analysis program Scion Image. (C). Western blot analysis showed that levels of Sox2, Nanog, Oct4 and Lin28B in PC3 PDGF-D cells transfected with Sox2, Nanog, Oct4 and Lin28B siRNA compared with transfection with control siRNA (*, p <0.05, **, p<0.01 compared to control, Con: control).

Article Snippet: Cells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO).

Techniques: Transfection, Incubation, Microscopy, Software, Western Blot, Control

Journal: PLoS ONE

Article Title: Epithelial to Mesenchymal Transition Is Mechanistically Linked with Stem Cell Signatures in Prostate Cancer Cells

doi: 10.1371/journal.pone.0012445

Figure Lengend Snippet: (A) Tumor growth curve showing that over-expression of PDGF-D could promote tumor growth in SCID mice much faster than PC3 Neo cells. (B) Western blot analysis of tumor lysates showing the expression of EMT and stem cell makers. (C) H&E evaluation of the tumors from both the groups showed high grade carcinoma associated with tumor apoptosis and necrosis. The results from the immunostaining showed much intense staining for vimentin and Notch1 and less intense staining for E-cadherin. (D) Regulatory model showing mechanistic link between EMT and stem cells: EMT induced by different factors characterized by increased expression of ZEB1, which causes loss of miR-200 family. Loss of miR-200b and miR-200c lead to increased ZEB1, Notch1 and Lin28B expression, resulting in decreased expression of let-7. Downregulation of let-7 leads to the up-regulation of Sox2, Nanog and Oct4, which together with Notch1 and Lin28B contribute to stem cell signatures. (*, p <0.05, **, p<0.01 compared to PC3 Neo, E-cad: E-cadherin).

Article Snippet: Cells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO).

Techniques: Over Expression, Western Blot, Expressing, Immunostaining, Staining