lectin Search Results


fluorescein conjugated wisteria floribunda agglutinin  (Vector Laboratories)
95
Vector Laboratories fluorescein conjugated wisteria floribunda agglutinin
Fluorescein Conjugated Wisteria Floribunda Agglutinin, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fluorescein conjugated wisteria floribunda agglutinin/product/Vector Laboratories
Average 95 stars, based on 1 article reviews
fluorescein conjugated wisteria floribunda agglutinin - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier
lentil lectin sepharose 4b beads  (Cytiva Europe)
90
Cytiva Europe lentil lectin sepharose 4b beads
Site-directed mutagenesis and <t>lectin</t> affinity purification analyses reveal α 1D -AR is dually glycosylated at N65 and N82. ( A ) Lysate from HEK293 cells expressing WT SNAP-α 1D ( input ) was incubated with lentil lectin <t>sepharose</t> beads to isolate glycosylated proteins. Bound protein was eluted with methyl-α-D-mannopyranoside ( bound ), and analyzed using PAGE NIR. SNAP-α 1D monomers (►) and higher order oligomers, as well as the previously described N-terminal cleavage product, are present in the elutant. ( B ) Schematic and ( C ) PAGE NIR of HEK293 cell lysate expressing WT, single glycosylation mutants (N65Q and N82Q), and double glycosylation mutant (NQQ) SNAP-α 1D species. ( D ) HEK293 cells expressing WT SNAP-α 1D were incubated for 16 hr with vehicle (−) or tunicamycin (TUN, +), and analyzed with PAGE NIR. A signal at 43 kDa was observed in the tunicamycin treated samples (○). ( E ) PAGE NIR of HEK293 cell lysate transfected with N-terminal SNAP-epitope ( λ = 800 nm, green ) and C-terminal CLIP-epitope ( λ = 700 nm, red ) dual tagged WT (S-WT-C) and NQQ (S-NQQ-C) α 1D -AR constructs. ( F,I ) PAGE NIR of HEK293 cell lysate expressing S-WT-C or ( G,J ) S-NQQ-C following 24 hr bortezomib (BTZ) ( F,G ) or protease inhibitor (PI) treatment ( I,J ). ( H ) Quantitation of signals from F and G normalized to vehicle. ( K ) Quantitation of fluorescent signals from I and J normalized to vehicle. All gels are representative images from n = 3 experiments. For F and G, data are represented as mean ± SEM; Unpaired t tests, ***p < 0.001.
Lentil Lectin Sepharose 4b Beads, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentil lectin sepharose 4b beads/product/Cytiva Europe
Average 90 stars, based on 1 article reviews
lentil lectin sepharose 4b beads - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
rsv a2 virus  (Rockland Immunochemicals)
93
Rockland Immunochemicals rsv a2 virus
Site-directed mutagenesis and <t>lectin</t> affinity purification analyses reveal α 1D -AR is dually glycosylated at N65 and N82. ( A ) Lysate from HEK293 cells expressing WT SNAP-α 1D ( input ) was incubated with lentil lectin <t>sepharose</t> beads to isolate glycosylated proteins. Bound protein was eluted with methyl-α-D-mannopyranoside ( bound ), and analyzed using PAGE NIR. SNAP-α 1D monomers (►) and higher order oligomers, as well as the previously described N-terminal cleavage product, are present in the elutant. ( B ) Schematic and ( C ) PAGE NIR of HEK293 cell lysate expressing WT, single glycosylation mutants (N65Q and N82Q), and double glycosylation mutant (NQQ) SNAP-α 1D species. ( D ) HEK293 cells expressing WT SNAP-α 1D were incubated for 16 hr with vehicle (−) or tunicamycin (TUN, +), and analyzed with PAGE NIR. A signal at 43 kDa was observed in the tunicamycin treated samples (○). ( E ) PAGE NIR of HEK293 cell lysate transfected with N-terminal SNAP-epitope ( λ = 800 nm, green ) and C-terminal CLIP-epitope ( λ = 700 nm, red ) dual tagged WT (S-WT-C) and NQQ (S-NQQ-C) α 1D -AR constructs. ( F,I ) PAGE NIR of HEK293 cell lysate expressing S-WT-C or ( G,J ) S-NQQ-C following 24 hr bortezomib (BTZ) ( F,G ) or protease inhibitor (PI) treatment ( I,J ). ( H ) Quantitation of signals from F and G normalized to vehicle. ( K ) Quantitation of fluorescent signals from I and J normalized to vehicle. All gels are representative images from n = 3 experiments. For F and G, data are represented as mean ± SEM; Unpaired t tests, ***p < 0.001.
Rsv A2 Virus, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rsv a2 virus/product/Rockland Immunochemicals
Average 93 stars, based on 1 article reviews
rsv a2 virus - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier
pha standard  (Aladdin Scientific Corporation)
90
Aladdin Scientific Corporation pha standard
Site-directed mutagenesis and <t>lectin</t> affinity purification analyses reveal α 1D -AR is dually glycosylated at N65 and N82. ( A ) Lysate from HEK293 cells expressing WT SNAP-α 1D ( input ) was incubated with lentil lectin <t>sepharose</t> beads to isolate glycosylated proteins. Bound protein was eluted with methyl-α-D-mannopyranoside ( bound ), and analyzed using PAGE NIR. SNAP-α 1D monomers (►) and higher order oligomers, as well as the previously described N-terminal cleavage product, are present in the elutant. ( B ) Schematic and ( C ) PAGE NIR of HEK293 cell lysate expressing WT, single glycosylation mutants (N65Q and N82Q), and double glycosylation mutant (NQQ) SNAP-α 1D species. ( D ) HEK293 cells expressing WT SNAP-α 1D were incubated for 16 hr with vehicle (−) or tunicamycin (TUN, +), and analyzed with PAGE NIR. A signal at 43 kDa was observed in the tunicamycin treated samples (○). ( E ) PAGE NIR of HEK293 cell lysate transfected with N-terminal SNAP-epitope ( λ = 800 nm, green ) and C-terminal CLIP-epitope ( λ = 700 nm, red ) dual tagged WT (S-WT-C) and NQQ (S-NQQ-C) α 1D -AR constructs. ( F,I ) PAGE NIR of HEK293 cell lysate expressing S-WT-C or ( G,J ) S-NQQ-C following 24 hr bortezomib (BTZ) ( F,G ) or protease inhibitor (PI) treatment ( I,J ). ( H ) Quantitation of signals from F and G normalized to vehicle. ( K ) Quantitation of fluorescent signals from I and J normalized to vehicle. All gels are representative images from n = 3 experiments. For F and G, data are represented as mean ± SEM; Unpaired t tests, ***p < 0.001.
Pha Standard, supplied by Aladdin Scientific Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pha standard/product/Aladdin Scientific Corporation
Average 90 stars, based on 1 article reviews
pha standard - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
marker isolectin b4  (Vector Laboratories)
95
Vector Laboratories marker isolectin b4
Site-directed mutagenesis and <t>lectin</t> affinity purification analyses reveal α 1D -AR is dually glycosylated at N65 and N82. ( A ) Lysate from HEK293 cells expressing WT SNAP-α 1D ( input ) was incubated with lentil lectin <t>sepharose</t> beads to isolate glycosylated proteins. Bound protein was eluted with methyl-α-D-mannopyranoside ( bound ), and analyzed using PAGE NIR. SNAP-α 1D monomers (►) and higher order oligomers, as well as the previously described N-terminal cleavage product, are present in the elutant. ( B ) Schematic and ( C ) PAGE NIR of HEK293 cell lysate expressing WT, single glycosylation mutants (N65Q and N82Q), and double glycosylation mutant (NQQ) SNAP-α 1D species. ( D ) HEK293 cells expressing WT SNAP-α 1D were incubated for 16 hr with vehicle (−) or tunicamycin (TUN, +), and analyzed with PAGE NIR. A signal at 43 kDa was observed in the tunicamycin treated samples (○). ( E ) PAGE NIR of HEK293 cell lysate transfected with N-terminal SNAP-epitope ( λ = 800 nm, green ) and C-terminal CLIP-epitope ( λ = 700 nm, red ) dual tagged WT (S-WT-C) and NQQ (S-NQQ-C) α 1D -AR constructs. ( F,I ) PAGE NIR of HEK293 cell lysate expressing S-WT-C or ( G,J ) S-NQQ-C following 24 hr bortezomib (BTZ) ( F,G ) or protease inhibitor (PI) treatment ( I,J ). ( H ) Quantitation of signals from F and G normalized to vehicle. ( K ) Quantitation of fluorescent signals from I and J normalized to vehicle. All gels are representative images from n = 3 experiments. For F and G, data are represented as mean ± SEM; Unpaired t tests, ***p < 0.001.
Marker Isolectin B4, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/marker isolectin b4/product/Vector Laboratories
Average 95 stars, based on 1 article reviews
marker isolectin b4 - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier
anti galectin antibody  (Proteintech)
94
Proteintech anti galectin antibody
Site-directed mutagenesis and <t>lectin</t> affinity purification analyses reveal α 1D -AR is dually glycosylated at N65 and N82. ( A ) Lysate from HEK293 cells expressing WT SNAP-α 1D ( input ) was incubated with lentil lectin <t>sepharose</t> beads to isolate glycosylated proteins. Bound protein was eluted with methyl-α-D-mannopyranoside ( bound ), and analyzed using PAGE NIR. SNAP-α 1D monomers (►) and higher order oligomers, as well as the previously described N-terminal cleavage product, are present in the elutant. ( B ) Schematic and ( C ) PAGE NIR of HEK293 cell lysate expressing WT, single glycosylation mutants (N65Q and N82Q), and double glycosylation mutant (NQQ) SNAP-α 1D species. ( D ) HEK293 cells expressing WT SNAP-α 1D were incubated for 16 hr with vehicle (−) or tunicamycin (TUN, +), and analyzed with PAGE NIR. A signal at 43 kDa was observed in the tunicamycin treated samples (○). ( E ) PAGE NIR of HEK293 cell lysate transfected with N-terminal SNAP-epitope ( λ = 800 nm, green ) and C-terminal CLIP-epitope ( λ = 700 nm, red ) dual tagged WT (S-WT-C) and NQQ (S-NQQ-C) α 1D -AR constructs. ( F,I ) PAGE NIR of HEK293 cell lysate expressing S-WT-C or ( G,J ) S-NQQ-C following 24 hr bortezomib (BTZ) ( F,G ) or protease inhibitor (PI) treatment ( I,J ). ( H ) Quantitation of signals from F and G normalized to vehicle. ( K ) Quantitation of fluorescent signals from I and J normalized to vehicle. All gels are representative images from n = 3 experiments. For F and G, data are represented as mean ± SEM; Unpaired t tests, ***p < 0.001.
Anti Galectin Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti galectin antibody/product/Proteintech
Average 94 stars, based on 1 article reviews
anti galectin antibody - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier
agaacgaccaccatcaactc asgr2  (Proteintech)
90
Proteintech agaacgaccaccatcaactc asgr2
Site-directed mutagenesis and <t>lectin</t> affinity purification analyses reveal α 1D -AR is dually glycosylated at N65 and N82. ( A ) Lysate from HEK293 cells expressing WT SNAP-α 1D ( input ) was incubated with lentil lectin <t>sepharose</t> beads to isolate glycosylated proteins. Bound protein was eluted with methyl-α-D-mannopyranoside ( bound ), and analyzed using PAGE NIR. SNAP-α 1D monomers (►) and higher order oligomers, as well as the previously described N-terminal cleavage product, are present in the elutant. ( B ) Schematic and ( C ) PAGE NIR of HEK293 cell lysate expressing WT, single glycosylation mutants (N65Q and N82Q), and double glycosylation mutant (NQQ) SNAP-α 1D species. ( D ) HEK293 cells expressing WT SNAP-α 1D were incubated for 16 hr with vehicle (−) or tunicamycin (TUN, +), and analyzed with PAGE NIR. A signal at 43 kDa was observed in the tunicamycin treated samples (○). ( E ) PAGE NIR of HEK293 cell lysate transfected with N-terminal SNAP-epitope ( λ = 800 nm, green ) and C-terminal CLIP-epitope ( λ = 700 nm, red ) dual tagged WT (S-WT-C) and NQQ (S-NQQ-C) α 1D -AR constructs. ( F,I ) PAGE NIR of HEK293 cell lysate expressing S-WT-C or ( G,J ) S-NQQ-C following 24 hr bortezomib (BTZ) ( F,G ) or protease inhibitor (PI) treatment ( I,J ). ( H ) Quantitation of signals from F and G normalized to vehicle. ( K ) Quantitation of fluorescent signals from I and J normalized to vehicle. All gels are representative images from n = 3 experiments. For F and G, data are represented as mean ± SEM; Unpaired t tests, ***p < 0.001.
Agaacgaccaccatcaactc Asgr2, supplied by Proteintech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agaacgaccaccatcaactc asgr2/product/Proteintech
Average 90 stars, based on 1 article reviews
agaacgaccaccatcaactc asgr2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
cd169 pe  (Miltenyi Biotec)
92
Miltenyi Biotec cd169 pe
A . Left , Representative immunostaining of macrophages in the splenic marginal zone expressing <t>CD169</t> (red) and Tim4 (green); DAPI nuclear staining (blue). Right , FACS contour plots for CD169 and Tim4 expression in splenic CD45 + CD11b low F4/80 low cells and quantitation of Tim4 expression in CD169 + MMMs; n=4. B . Top Left , FACS pseudocolor plots of circulating Ly6C monocytes with histograms identifying CD169 + and CD169 − populations within Ly6C low monocytes, and corresponding cell quantitation; NTM, normalized to mode. Top Right , principal component analysis of top 500 differentially expressed genes (DEGs) from bulk RNAseq of sorted Ly6C low CD169 − and Ly6C low CD169 + cells, and heat maps with dendrograms for 334 DEGs (q<0.05) between the same sub-populations. Bottom , FACS pseudocolor plots of circulating Ly6C low CD169 + Tim4 + macrophages in naïve and spx mice blood with flow histograms identifying CD64 and MHCII surface expression (in black), together with quantitation of frequency or absolute number of the populations shown; n=5-7, statistics: unpaired t test. C. Top, Representative blood FACS dot plots and quantitation of tdTomato (Tdt) expression in blood Ly6C + monocytes from CX3CR1 CreERT ; Rosa26 tdTomato mice after a tamoxifen (TAM) pulse to induce Cre recombination. Shown are data from several time points after TAM and 14 d after splenectomy (Spx) performed at 26 d post-TAM; *p<0.05, n=3, statistics: unpaired t-test. Bottom , representative FACS plots showing CD169 expression in Tdt+ cells 26 d post-TAM pulse and overlay of the CD169 + Tdt + cells (green) on blood Ly6C + monocytes. D . Top , UMAP plots derived from single cell RNA sequencing of blood leukocytes from 3 naïve mice (∼400K total cells, 11 identified cell clusters), heat map demonstrating CD169 ( Siglec1 ) expression primarily in the monocyte cluster, and quantitative expression of select macrophage genes in cells with and without CD169 expression (adjusted FDR p values are shown). E . Left, FACS plots identifying CD169 + Tim4 + cardiac macrophages in intact and Spx mice, overlay of these macrophages on contour plots of CCR2 and LYVE1 expression (in intact mice), and quantitation of overall LYVE1 and CCR2 expression (n=6). Right , quantitation of frequency and number of cardiac CD169 + Tim4 + LYVE1 low macrophages naïve and Spx C57BL/6 mice; n=5-7/group, statistics: unpaired t test.
Cd169 Pe, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cd169 pe/product/Miltenyi Biotec
Average 92 stars, based on 1 article reviews
cd169 pe - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier
guinea pig complement  (Rockland Immunochemicals)
93
Rockland Immunochemicals guinea pig complement
A . Left , Representative immunostaining of macrophages in the splenic marginal zone expressing <t>CD169</t> (red) and Tim4 (green); DAPI nuclear staining (blue). Right , FACS contour plots for CD169 and Tim4 expression in splenic CD45 + CD11b low F4/80 low cells and quantitation of Tim4 expression in CD169 + MMMs; n=4. B . Top Left , FACS pseudocolor plots of circulating Ly6C monocytes with histograms identifying CD169 + and CD169 − populations within Ly6C low monocytes, and corresponding cell quantitation; NTM, normalized to mode. Top Right , principal component analysis of top 500 differentially expressed genes (DEGs) from bulk RNAseq of sorted Ly6C low CD169 − and Ly6C low CD169 + cells, and heat maps with dendrograms for 334 DEGs (q<0.05) between the same sub-populations. Bottom , FACS pseudocolor plots of circulating Ly6C low CD169 + Tim4 + macrophages in naïve and spx mice blood with flow histograms identifying CD64 and MHCII surface expression (in black), together with quantitation of frequency or absolute number of the populations shown; n=5-7, statistics: unpaired t test. C. Top, Representative blood FACS dot plots and quantitation of tdTomato (Tdt) expression in blood Ly6C + monocytes from CX3CR1 CreERT ; Rosa26 tdTomato mice after a tamoxifen (TAM) pulse to induce Cre recombination. Shown are data from several time points after TAM and 14 d after splenectomy (Spx) performed at 26 d post-TAM; *p<0.05, n=3, statistics: unpaired t-test. Bottom , representative FACS plots showing CD169 expression in Tdt+ cells 26 d post-TAM pulse and overlay of the CD169 + Tdt + cells (green) on blood Ly6C + monocytes. D . Top , UMAP plots derived from single cell RNA sequencing of blood leukocytes from 3 naïve mice (∼400K total cells, 11 identified cell clusters), heat map demonstrating CD169 ( Siglec1 ) expression primarily in the monocyte cluster, and quantitative expression of select macrophage genes in cells with and without CD169 expression (adjusted FDR p values are shown). E . Left, FACS plots identifying CD169 + Tim4 + cardiac macrophages in intact and Spx mice, overlay of these macrophages on contour plots of CCR2 and LYVE1 expression (in intact mice), and quantitation of overall LYVE1 and CCR2 expression (n=6). Right , quantitation of frequency and number of cardiac CD169 + Tim4 + LYVE1 low macrophages naïve and Spx C57BL/6 mice; n=5-7/group, statistics: unpaired t test.
Guinea Pig Complement, supplied by Rockland Immunochemicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guinea pig complement/product/Rockland Immunochemicals
Average 93 stars, based on 1 article reviews
guinea pig complement - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier
dylight 488 vector labs cat  (Vector Laboratories)
96
Vector Laboratories dylight 488 vector labs cat
A . Left , Representative immunostaining of macrophages in the splenic marginal zone expressing <t>CD169</t> (red) and Tim4 (green); DAPI nuclear staining (blue). Right , FACS contour plots for CD169 and Tim4 expression in splenic CD45 + CD11b low F4/80 low cells and quantitation of Tim4 expression in CD169 + MMMs; n=4. B . Top Left , FACS pseudocolor plots of circulating Ly6C monocytes with histograms identifying CD169 + and CD169 − populations within Ly6C low monocytes, and corresponding cell quantitation; NTM, normalized to mode. Top Right , principal component analysis of top 500 differentially expressed genes (DEGs) from bulk RNAseq of sorted Ly6C low CD169 − and Ly6C low CD169 + cells, and heat maps with dendrograms for 334 DEGs (q<0.05) between the same sub-populations. Bottom , FACS pseudocolor plots of circulating Ly6C low CD169 + Tim4 + macrophages in naïve and spx mice blood with flow histograms identifying CD64 and MHCII surface expression (in black), together with quantitation of frequency or absolute number of the populations shown; n=5-7, statistics: unpaired t test. C. Top, Representative blood FACS dot plots and quantitation of tdTomato (Tdt) expression in blood Ly6C + monocytes from CX3CR1 CreERT ; Rosa26 tdTomato mice after a tamoxifen (TAM) pulse to induce Cre recombination. Shown are data from several time points after TAM and 14 d after splenectomy (Spx) performed at 26 d post-TAM; *p<0.05, n=3, statistics: unpaired t-test. Bottom , representative FACS plots showing CD169 expression in Tdt+ cells 26 d post-TAM pulse and overlay of the CD169 + Tdt + cells (green) on blood Ly6C + monocytes. D . Top , UMAP plots derived from single cell RNA sequencing of blood leukocytes from 3 naïve mice (∼400K total cells, 11 identified cell clusters), heat map demonstrating CD169 ( Siglec1 ) expression primarily in the monocyte cluster, and quantitative expression of select macrophage genes in cells with and without CD169 expression (adjusted FDR p values are shown). E . Left, FACS plots identifying CD169 + Tim4 + cardiac macrophages in intact and Spx mice, overlay of these macrophages on contour plots of CCR2 and LYVE1 expression (in intact mice), and quantitation of overall LYVE1 and CCR2 expression (n=6). Right , quantitation of frequency and number of cardiac CD169 + Tim4 + LYVE1 low macrophages naïve and Spx C57BL/6 mice; n=5-7/group, statistics: unpaired t test.
Dylight 488 Vector Labs Cat, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dylight 488 vector labs cat/product/Vector Laboratories
Average 96 stars, based on 1 article reviews
dylight 488 vector labs cat - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier
lycopersicon esculentum tomato lectin  (Vector Laboratories)
96
Vector Laboratories lycopersicon esculentum tomato lectin
Overview of the experimental workflow (A–D) Animal is anesthetized (A), followed by retro-orbital <t>lectin</t> injection (B). Animals then undergo transcardiac perfusion (C), followed by leg dissection and skin removal (D). (E–H) (E) Leg samples undergo fixation, decalcification, delipidation methods, and RI matching (tissue clearing) to render them transparent, as shown in (F). Cleared leg samples were imaged on a light-sheet fluorescence microscope (G) to view the vasculature, as shown in (H).
Lycopersicon Esculentum Tomato Lectin, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lycopersicon esculentum tomato lectin/product/Vector Laboratories
Average 96 stars, based on 1 article reviews
lycopersicon esculentum tomato lectin - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier
biotin mal ii  (Vector Laboratories)
96
Vector Laboratories biotin mal ii
α2,3-sialylation is required for BCG-induced osteoclast differentiation and activity (A) Comparison of differentially expressed genes (DEGs) between BCG-infected osteoclasts (RB) and uninfected controls (R). (n = 3 biological replicates per group, differential expression was defined as |FoldChange| > 2 and padj <0.05). (B) Volcano plot of DEGs highlighting genes related to sialic acid biosynthesis. (C) KEGG pathway enrichment analysis of upregulated DEGs in RB cells. (D,E) Immunofluorescence staining of α2,3-SA in mouse calvarial sections <t>using</t> <t>MAL</t> <t>II</t> lectin, with quantification of α2,3-SA fluorescence intensity (n = 5). Intensity density was normalized to the PBS group mean. (F) In vitro osteoclasts subjected to MAL II lectin staining and TRAP staining, with or without sialidase treatment to enzymatically remove α2,3-SA. (G) Quantification of α2,3-SA fluorescence intensity in cultured osteoclasts (n = 5). Intensity density was measured in cellular ROIs after background subtraction and normalized to the RANKL group mean. (H) Quantification of TRAP + multinucleated cells (≥3 nuclei) per field (randomly selected fields, fixed magnification) in vitro (n = 5). (I) mRNA expression levels of osteoclast differentiation markers ( Fos, Mmp9, Nfatc1, and Ocstamp ) in osteoclasts (n = 3). Data are presented as mean ± SD. Statistical significance was determined by two-tailed unpaired Student’s t-test for two-group comparisons (E) and one-way ANOVA followed by Tukey’s post hoc test for three-group comparisons (G–I) .
Biotin Mal Ii, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotin mal ii/product/Vector Laboratories
Average 96 stars, based on 1 article reviews
biotin mal ii - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

Image Search Results


Site-directed mutagenesis and lectin affinity purification analyses reveal α 1D -AR is dually glycosylated at N65 and N82. ( A ) Lysate from HEK293 cells expressing WT SNAP-α 1D ( input ) was incubated with lentil lectin sepharose beads to isolate glycosylated proteins. Bound protein was eluted with methyl-α-D-mannopyranoside ( bound ), and analyzed using PAGE NIR. SNAP-α 1D monomers (►) and higher order oligomers, as well as the previously described N-terminal cleavage product, are present in the elutant. ( B ) Schematic and ( C ) PAGE NIR of HEK293 cell lysate expressing WT, single glycosylation mutants (N65Q and N82Q), and double glycosylation mutant (NQQ) SNAP-α 1D species. ( D ) HEK293 cells expressing WT SNAP-α 1D were incubated for 16 hr with vehicle (−) or tunicamycin (TUN, +), and analyzed with PAGE NIR. A signal at 43 kDa was observed in the tunicamycin treated samples (○). ( E ) PAGE NIR of HEK293 cell lysate transfected with N-terminal SNAP-epitope ( λ = 800 nm, green ) and C-terminal CLIP-epitope ( λ = 700 nm, red ) dual tagged WT (S-WT-C) and NQQ (S-NQQ-C) α 1D -AR constructs. ( F,I ) PAGE NIR of HEK293 cell lysate expressing S-WT-C or ( G,J ) S-NQQ-C following 24 hr bortezomib (BTZ) ( F,G ) or protease inhibitor (PI) treatment ( I,J ). ( H ) Quantitation of signals from F and G normalized to vehicle. ( K ) Quantitation of fluorescent signals from I and J normalized to vehicle. All gels are representative images from n = 3 experiments. For F and G, data are represented as mean ± SEM; Unpaired t tests, ***p < 0.001.

Journal: Scientific Reports

Article Title: N- glycosylation of α 1D -adrenergic receptor N-terminal domain is required for correct trafficking, function, and biogenesis

doi: 10.1038/s41598-020-64102-4

Figure Lengend Snippet: Site-directed mutagenesis and lectin affinity purification analyses reveal α 1D -AR is dually glycosylated at N65 and N82. ( A ) Lysate from HEK293 cells expressing WT SNAP-α 1D ( input ) was incubated with lentil lectin sepharose beads to isolate glycosylated proteins. Bound protein was eluted with methyl-α-D-mannopyranoside ( bound ), and analyzed using PAGE NIR. SNAP-α 1D monomers (►) and higher order oligomers, as well as the previously described N-terminal cleavage product, are present in the elutant. ( B ) Schematic and ( C ) PAGE NIR of HEK293 cell lysate expressing WT, single glycosylation mutants (N65Q and N82Q), and double glycosylation mutant (NQQ) SNAP-α 1D species. ( D ) HEK293 cells expressing WT SNAP-α 1D were incubated for 16 hr with vehicle (−) or tunicamycin (TUN, +), and analyzed with PAGE NIR. A signal at 43 kDa was observed in the tunicamycin treated samples (○). ( E ) PAGE NIR of HEK293 cell lysate transfected with N-terminal SNAP-epitope ( λ = 800 nm, green ) and C-terminal CLIP-epitope ( λ = 700 nm, red ) dual tagged WT (S-WT-C) and NQQ (S-NQQ-C) α 1D -AR constructs. ( F,I ) PAGE NIR of HEK293 cell lysate expressing S-WT-C or ( G,J ) S-NQQ-C following 24 hr bortezomib (BTZ) ( F,G ) or protease inhibitor (PI) treatment ( I,J ). ( H ) Quantitation of signals from F and G normalized to vehicle. ( K ) Quantitation of fluorescent signals from I and J normalized to vehicle. All gels are representative images from n = 3 experiments. For F and G, data are represented as mean ± SEM; Unpaired t tests, ***p < 0.001.

Article Snippet: The soluble fraction was incubated with Lentil Lectin Sepharose 4B beads (GE Healthcare, Chicago, IL) and 1 μL of 25 μL BG-782 for 1 hr at room temperature.

Techniques: Mutagenesis, Affinity Purification, Expressing, Incubation, Glycoproteomics, Transfection, Construct, Protease Inhibitor, Quantitation Assay

A . Left , Representative immunostaining of macrophages in the splenic marginal zone expressing CD169 (red) and Tim4 (green); DAPI nuclear staining (blue). Right , FACS contour plots for CD169 and Tim4 expression in splenic CD45 + CD11b low F4/80 low cells and quantitation of Tim4 expression in CD169 + MMMs; n=4. B . Top Left , FACS pseudocolor plots of circulating Ly6C monocytes with histograms identifying CD169 + and CD169 − populations within Ly6C low monocytes, and corresponding cell quantitation; NTM, normalized to mode. Top Right , principal component analysis of top 500 differentially expressed genes (DEGs) from bulk RNAseq of sorted Ly6C low CD169 − and Ly6C low CD169 + cells, and heat maps with dendrograms for 334 DEGs (q<0.05) between the same sub-populations. Bottom , FACS pseudocolor plots of circulating Ly6C low CD169 + Tim4 + macrophages in naïve and spx mice blood with flow histograms identifying CD64 and MHCII surface expression (in black), together with quantitation of frequency or absolute number of the populations shown; n=5-7, statistics: unpaired t test. C. Top, Representative blood FACS dot plots and quantitation of tdTomato (Tdt) expression in blood Ly6C + monocytes from CX3CR1 CreERT ; Rosa26 tdTomato mice after a tamoxifen (TAM) pulse to induce Cre recombination. Shown are data from several time points after TAM and 14 d after splenectomy (Spx) performed at 26 d post-TAM; *p<0.05, n=3, statistics: unpaired t-test. Bottom , representative FACS plots showing CD169 expression in Tdt+ cells 26 d post-TAM pulse and overlay of the CD169 + Tdt + cells (green) on blood Ly6C + monocytes. D . Top , UMAP plots derived from single cell RNA sequencing of blood leukocytes from 3 naïve mice (∼400K total cells, 11 identified cell clusters), heat map demonstrating CD169 ( Siglec1 ) expression primarily in the monocyte cluster, and quantitative expression of select macrophage genes in cells with and without CD169 expression (adjusted FDR p values are shown). E . Left, FACS plots identifying CD169 + Tim4 + cardiac macrophages in intact and Spx mice, overlay of these macrophages on contour plots of CCR2 and LYVE1 expression (in intact mice), and quantitation of overall LYVE1 and CCR2 expression (n=6). Right , quantitation of frequency and number of cardiac CD169 + Tim4 + LYVE1 low macrophages naïve and Spx C57BL/6 mice; n=5-7/group, statistics: unpaired t test.

Journal: medRxiv

Article Title: Splenic CD169 + Tim4 + Marginal Metallophilic Macrophages Are Essential for Wound Healing After Myocardial Infarction

doi: 10.1101/2024.08.09.24311769

Figure Lengend Snippet: A . Left , Representative immunostaining of macrophages in the splenic marginal zone expressing CD169 (red) and Tim4 (green); DAPI nuclear staining (blue). Right , FACS contour plots for CD169 and Tim4 expression in splenic CD45 + CD11b low F4/80 low cells and quantitation of Tim4 expression in CD169 + MMMs; n=4. B . Top Left , FACS pseudocolor plots of circulating Ly6C monocytes with histograms identifying CD169 + and CD169 − populations within Ly6C low monocytes, and corresponding cell quantitation; NTM, normalized to mode. Top Right , principal component analysis of top 500 differentially expressed genes (DEGs) from bulk RNAseq of sorted Ly6C low CD169 − and Ly6C low CD169 + cells, and heat maps with dendrograms for 334 DEGs (q<0.05) between the same sub-populations. Bottom , FACS pseudocolor plots of circulating Ly6C low CD169 + Tim4 + macrophages in naïve and spx mice blood with flow histograms identifying CD64 and MHCII surface expression (in black), together with quantitation of frequency or absolute number of the populations shown; n=5-7, statistics: unpaired t test. C. Top, Representative blood FACS dot plots and quantitation of tdTomato (Tdt) expression in blood Ly6C + monocytes from CX3CR1 CreERT ; Rosa26 tdTomato mice after a tamoxifen (TAM) pulse to induce Cre recombination. Shown are data from several time points after TAM and 14 d after splenectomy (Spx) performed at 26 d post-TAM; *p<0.05, n=3, statistics: unpaired t-test. Bottom , representative FACS plots showing CD169 expression in Tdt+ cells 26 d post-TAM pulse and overlay of the CD169 + Tdt + cells (green) on blood Ly6C + monocytes. D . Top , UMAP plots derived from single cell RNA sequencing of blood leukocytes from 3 naïve mice (∼400K total cells, 11 identified cell clusters), heat map demonstrating CD169 ( Siglec1 ) expression primarily in the monocyte cluster, and quantitative expression of select macrophage genes in cells with and without CD169 expression (adjusted FDR p values are shown). E . Left, FACS plots identifying CD169 + Tim4 + cardiac macrophages in intact and Spx mice, overlay of these macrophages on contour plots of CCR2 and LYVE1 expression (in intact mice), and quantitation of overall LYVE1 and CCR2 expression (n=6). Right , quantitation of frequency and number of cardiac CD169 + Tim4 + LYVE1 low macrophages naïve and Spx C57BL/6 mice; n=5-7/group, statistics: unpaired t test.

Article Snippet: Cell suspensions were incubated with anti-mouse CD16/32 (clone 93, BioLegend) for 10 min at 4°C to block Fcγ receptors, and then stained for 60 minutes in staining buffer with anti-mouse fluorochrome-conjugated antibodies in panel appropriate combinations for specific experiments as follows: Ly6C-PE-Cy7 (HK1.4, eBioscience), Ly6C-PE Vio770 (1G7.G10, Miltenyi Biotec), CD45.1-FITC (A20, Miltenyi Biotec), CD45.2-PE (104, BD Biosciences), CD169-PE (REA197, Miltenyi Biotec; and 3D6.112, BioLegend), CD11b-Alexa Fluor 700 (M1/70, eBioscience), Tim4-Alexa Fluor 647 (RMT4-54, BioLegend), Gr1/Ly6G-eFluor 450 (RB6-8C5, eBioscience), F4/80-PerCP-Cy5.5 (BM8, eBioscience), MARCO-FITC (ED31, Novus Biologicals), CD45-600 Super Bright (30-F11, eBioscience), CD45-PE-Cy7 (30-F11, BD Biosciences), LYVE1 Alexa Fluor 488 (ALY7, eBioscience), CD45-605 NC (30-F11, eBioscience), CD54(ICAM-1)-PE (eBioKat-1, eBioscience), MHCII (I-A/I-E)-APC-eFluor780 (M5/114.15.2, eBioscience), TGFβ1-APC (TW7-16B4, BioLegend), CD54-FITC (YN1/1.7.4, BioLegend), CD169-PerCP/Cy5.5 (3D6.112, BioLegend), CD169-PE (3D6.112, BioLegend), CD64-Brilliant Violet 605 (X54-5/7.1, BioLegend), CD206-FITC (MR5D3, AbD Serotech), CD45-eVolve 605 (30-F11, eBioscience), CD206-Alexa Fluor 647 (MR5D3, Bio-Rad), IL17A-Alexa Fluor 700 (TC11-18H10.1, BioLegend), CD34-Alexa Fluor 647 (SA376A4, BioLegend), CD117(c-kit)-PE/Cy7 (ACK2, BioLegend), NOS2-TRITC (N-20, Santa Cruz Biotechnology), and CD16/32-PE (93, BioLegend, without pre-Fcγ receptor blocking).

Techniques: Immunostaining, Expressing, Staining, Quantitation Assay, Derivative Assay, RNA Sequencing

A . FACS plots and group quantitation for circulating Ly6C low CD169 + Tim4 + macrophages in sham-operated and MI wild type (WT) C57BL/6 mice 1 d post-MI; n=4/group, statistics: unpaired t test. B. Left , Flow histograms demonstrating surface expression of CCR3 and CCR4 in Ly6C low CD169 + Tim4 + macrophages from the same groups; statistics: unpaired t test, NTM, normalized to mode, y-axis represents cell counts. Right , chemokine gene expression by RT-PCR (normalized to 18s) in the myocardial border zone (BZ) 1 d after MI or sham operation; n=4-5/group, statistics: unpaired t test. *p<0.05, **p<0.01, ***p<0.001 versus sham. C . Left , Circulating Ly6C low CD169 + Tim4 + cell frequency prior to and 1 d after MI in Spx mice; n=9, statistics: paired t test. NS, not significant. D. FACS density plots, histograms, and quantitation of cardiac Ly6C low CD169 + Tim4 + macrophages in WT and Spx mice 1 d post-MI or sham operation; n=4-7/group, statistics: unpaired t test. E . Immunostains and FACS dot plots of splenic CD169 + MMMs (red) 24 h after MI or sham operation, and quantitation of MMM frequency by FACS and spleen weight (Wt); n=5-7/group, statistics: unpaired t test. TL, tibia length. F . Left , FACS dot plots and histograms, and corresponding quantitation, of blood and heart Ly6C low CD169 + Tim4 + Bioparticle + cells from sham and MI mice given 10 mg/kg Texas Red-conjugated bioparticles i.v. 3 h before sacrifice; n=3-4/group, statistics: unpaired t test for blood and non-parametric Mann-Whitney U test for heart (non-normal distribution). Right, quantitation of splenic BioParticle + MMMs in the same experimental mouse groups; statistics: unpaired t test.

Journal: medRxiv

Article Title: Splenic CD169 + Tim4 + Marginal Metallophilic Macrophages Are Essential for Wound Healing After Myocardial Infarction

doi: 10.1101/2024.08.09.24311769

Figure Lengend Snippet: A . FACS plots and group quantitation for circulating Ly6C low CD169 + Tim4 + macrophages in sham-operated and MI wild type (WT) C57BL/6 mice 1 d post-MI; n=4/group, statistics: unpaired t test. B. Left , Flow histograms demonstrating surface expression of CCR3 and CCR4 in Ly6C low CD169 + Tim4 + macrophages from the same groups; statistics: unpaired t test, NTM, normalized to mode, y-axis represents cell counts. Right , chemokine gene expression by RT-PCR (normalized to 18s) in the myocardial border zone (BZ) 1 d after MI or sham operation; n=4-5/group, statistics: unpaired t test. *p<0.05, **p<0.01, ***p<0.001 versus sham. C . Left , Circulating Ly6C low CD169 + Tim4 + cell frequency prior to and 1 d after MI in Spx mice; n=9, statistics: paired t test. NS, not significant. D. FACS density plots, histograms, and quantitation of cardiac Ly6C low CD169 + Tim4 + macrophages in WT and Spx mice 1 d post-MI or sham operation; n=4-7/group, statistics: unpaired t test. E . Immunostains and FACS dot plots of splenic CD169 + MMMs (red) 24 h after MI or sham operation, and quantitation of MMM frequency by FACS and spleen weight (Wt); n=5-7/group, statistics: unpaired t test. TL, tibia length. F . Left , FACS dot plots and histograms, and corresponding quantitation, of blood and heart Ly6C low CD169 + Tim4 + Bioparticle + cells from sham and MI mice given 10 mg/kg Texas Red-conjugated bioparticles i.v. 3 h before sacrifice; n=3-4/group, statistics: unpaired t test for blood and non-parametric Mann-Whitney U test for heart (non-normal distribution). Right, quantitation of splenic BioParticle + MMMs in the same experimental mouse groups; statistics: unpaired t test.

Article Snippet: Cell suspensions were incubated with anti-mouse CD16/32 (clone 93, BioLegend) for 10 min at 4°C to block Fcγ receptors, and then stained for 60 minutes in staining buffer with anti-mouse fluorochrome-conjugated antibodies in panel appropriate combinations for specific experiments as follows: Ly6C-PE-Cy7 (HK1.4, eBioscience), Ly6C-PE Vio770 (1G7.G10, Miltenyi Biotec), CD45.1-FITC (A20, Miltenyi Biotec), CD45.2-PE (104, BD Biosciences), CD169-PE (REA197, Miltenyi Biotec; and 3D6.112, BioLegend), CD11b-Alexa Fluor 700 (M1/70, eBioscience), Tim4-Alexa Fluor 647 (RMT4-54, BioLegend), Gr1/Ly6G-eFluor 450 (RB6-8C5, eBioscience), F4/80-PerCP-Cy5.5 (BM8, eBioscience), MARCO-FITC (ED31, Novus Biologicals), CD45-600 Super Bright (30-F11, eBioscience), CD45-PE-Cy7 (30-F11, BD Biosciences), LYVE1 Alexa Fluor 488 (ALY7, eBioscience), CD45-605 NC (30-F11, eBioscience), CD54(ICAM-1)-PE (eBioKat-1, eBioscience), MHCII (I-A/I-E)-APC-eFluor780 (M5/114.15.2, eBioscience), TGFβ1-APC (TW7-16B4, BioLegend), CD54-FITC (YN1/1.7.4, BioLegend), CD169-PerCP/Cy5.5 (3D6.112, BioLegend), CD169-PE (3D6.112, BioLegend), CD64-Brilliant Violet 605 (X54-5/7.1, BioLegend), CD206-FITC (MR5D3, AbD Serotech), CD45-eVolve 605 (30-F11, eBioscience), CD206-Alexa Fluor 647 (MR5D3, Bio-Rad), IL17A-Alexa Fluor 700 (TC11-18H10.1, BioLegend), CD34-Alexa Fluor 647 (SA376A4, BioLegend), CD117(c-kit)-PE/Cy7 (ACK2, BioLegend), NOS2-TRITC (N-20, Santa Cruz Biotechnology), and CD16/32-PE (93, BioLegend, without pre-Fcγ receptor blocking).

Techniques: Quantitation Assay, Expressing, Gene Expression, Reverse Transcription Polymerase Chain Reaction, MANN-WHITNEY

A Left , Parabiosis schema joining CD45 isotype-mismatched host (spleen-intact or after splenectomy [Spx]) and donor parabiont mice, with MI induced in the host. Middle and Right , FACS plots and quantitation of donor chimerism in host mouse blood (total CD45 + leukocytes) and heart (Ly6C low CD169 + macrophages) in spleen-intact and Spx host mice 48 h after MI. n=4-7/group, statistics: unpaired t-test. B Top Left , Parabiosis schema joining CD169 DTR host and donor parabiont MaFIA mice, with host mice given either vehicle or diphtheria toxin (DT) at the time of MI. Right , Representative FACS dot plots of donor GFP + CD169 + macrophages in 48 h post MI hearts from host mice and flow histograms of CD169 expression in GFP + CD64 + MHCII + Tim4 + cells delineated as NTM or cell counts. Bottom Left , quantitation of GFP + frequency in host cardiac CD169 + Tim4 + macrophages and total CD169 + Tim4 + cells as a percentage of all autofluorescent(Auto) + macrophages in vehicle and DT treated host MI mice; n=3-4/group, statistics: unpaired t test. C. Left , Parabiosis schema joining CD169 DTR host mice and either spleen-intact or Spx MaFIA donor parabionts, with host mice given DT at the time of MI to deplete CD169 + macrophages. Right , Example FACS dot plots and quantitation of donor CD45 + Auto + CD64 + MHCII + GFP + CD169 + Tim4 + macrophages in the host MI heart 48 h post MI; n=3-4/group, statistics: unpaired t test.

Journal: medRxiv

Article Title: Splenic CD169 + Tim4 + Marginal Metallophilic Macrophages Are Essential for Wound Healing After Myocardial Infarction

doi: 10.1101/2024.08.09.24311769

Figure Lengend Snippet: A Left , Parabiosis schema joining CD45 isotype-mismatched host (spleen-intact or after splenectomy [Spx]) and donor parabiont mice, with MI induced in the host. Middle and Right , FACS plots and quantitation of donor chimerism in host mouse blood (total CD45 + leukocytes) and heart (Ly6C low CD169 + macrophages) in spleen-intact and Spx host mice 48 h after MI. n=4-7/group, statistics: unpaired t-test. B Top Left , Parabiosis schema joining CD169 DTR host and donor parabiont MaFIA mice, with host mice given either vehicle or diphtheria toxin (DT) at the time of MI. Right , Representative FACS dot plots of donor GFP + CD169 + macrophages in 48 h post MI hearts from host mice and flow histograms of CD169 expression in GFP + CD64 + MHCII + Tim4 + cells delineated as NTM or cell counts. Bottom Left , quantitation of GFP + frequency in host cardiac CD169 + Tim4 + macrophages and total CD169 + Tim4 + cells as a percentage of all autofluorescent(Auto) + macrophages in vehicle and DT treated host MI mice; n=3-4/group, statistics: unpaired t test. C. Left , Parabiosis schema joining CD169 DTR host mice and either spleen-intact or Spx MaFIA donor parabionts, with host mice given DT at the time of MI to deplete CD169 + macrophages. Right , Example FACS dot plots and quantitation of donor CD45 + Auto + CD64 + MHCII + GFP + CD169 + Tim4 + macrophages in the host MI heart 48 h post MI; n=3-4/group, statistics: unpaired t test.

Article Snippet: Cell suspensions were incubated with anti-mouse CD16/32 (clone 93, BioLegend) for 10 min at 4°C to block Fcγ receptors, and then stained for 60 minutes in staining buffer with anti-mouse fluorochrome-conjugated antibodies in panel appropriate combinations for specific experiments as follows: Ly6C-PE-Cy7 (HK1.4, eBioscience), Ly6C-PE Vio770 (1G7.G10, Miltenyi Biotec), CD45.1-FITC (A20, Miltenyi Biotec), CD45.2-PE (104, BD Biosciences), CD169-PE (REA197, Miltenyi Biotec; and 3D6.112, BioLegend), CD11b-Alexa Fluor 700 (M1/70, eBioscience), Tim4-Alexa Fluor 647 (RMT4-54, BioLegend), Gr1/Ly6G-eFluor 450 (RB6-8C5, eBioscience), F4/80-PerCP-Cy5.5 (BM8, eBioscience), MARCO-FITC (ED31, Novus Biologicals), CD45-600 Super Bright (30-F11, eBioscience), CD45-PE-Cy7 (30-F11, BD Biosciences), LYVE1 Alexa Fluor 488 (ALY7, eBioscience), CD45-605 NC (30-F11, eBioscience), CD54(ICAM-1)-PE (eBioKat-1, eBioscience), MHCII (I-A/I-E)-APC-eFluor780 (M5/114.15.2, eBioscience), TGFβ1-APC (TW7-16B4, BioLegend), CD54-FITC (YN1/1.7.4, BioLegend), CD169-PerCP/Cy5.5 (3D6.112, BioLegend), CD169-PE (3D6.112, BioLegend), CD64-Brilliant Violet 605 (X54-5/7.1, BioLegend), CD206-FITC (MR5D3, AbD Serotech), CD45-eVolve 605 (30-F11, eBioscience), CD206-Alexa Fluor 647 (MR5D3, Bio-Rad), IL17A-Alexa Fluor 700 (TC11-18H10.1, BioLegend), CD34-Alexa Fluor 647 (SA376A4, BioLegend), CD117(c-kit)-PE/Cy7 (ACK2, BioLegend), NOS2-TRITC (N-20, Santa Cruz Biotechnology), and CD16/32-PE (93, BioLegend, without pre-Fcγ receptor blocking).

Techniques: Quantitation Assay, Expressing

A . Left, FACS pseudocolor plots of cardiac CD169 + Tim4 + macrophages and separation based on LYVE1 surface expression in naïve and 1 d post-MI mice. Right , quantitation of LYVE1 hi and LYVE1 low CD169 + Tim4 + macrophages in hearts from naïve and 1 d post-MI mice. n=4-6/group; statistics: unpaired t test. B . Heat map of 462 significant (p adjusted<0.05) DEGs by RNAseq analysis in sorted LYVE1 hi and LYVE1 low CD169 + Tim4 + cardiac macrophages 1 d post-MI. C. PCA plots using the top 500 DEGs after rlog transformation of RNAseq data from these macrophages sorted from the indicated sites in naïve and 1 d post-MI mice. D. Left , Flow histograms depicting LYVE1 surface expression on cardiac CD169 + Tim4 + macrophages (green) and total Autofluorescence + CD64 + MHCII + macrophages (brown) in WT and Spx mice, 1 d post-MI. Right , FACS quantitation of LYVE1 hi and LYVE1 low CD169 + Tim4 + macrophages in the hearts of WT and Spx mice, 1 d post-MI; n=5-6/group. Statistics: unpaired t test. E. Representative confocal micrograph of border zone (BZ) myocardium immunostained for CD169 (red) and Tim4 (green) 1 d post-MI in WT and Spx mice; nuclear staining with DAPI (blue). Scale bar, 200 μm. Inset shows magnified images of CD169 and Tim4 staining. Yellow arrows indicate double positive cells; scale bar 10 μm.

Journal: medRxiv

Article Title: Splenic CD169 + Tim4 + Marginal Metallophilic Macrophages Are Essential for Wound Healing After Myocardial Infarction

doi: 10.1101/2024.08.09.24311769

Figure Lengend Snippet: A . Left, FACS pseudocolor plots of cardiac CD169 + Tim4 + macrophages and separation based on LYVE1 surface expression in naïve and 1 d post-MI mice. Right , quantitation of LYVE1 hi and LYVE1 low CD169 + Tim4 + macrophages in hearts from naïve and 1 d post-MI mice. n=4-6/group; statistics: unpaired t test. B . Heat map of 462 significant (p adjusted<0.05) DEGs by RNAseq analysis in sorted LYVE1 hi and LYVE1 low CD169 + Tim4 + cardiac macrophages 1 d post-MI. C. PCA plots using the top 500 DEGs after rlog transformation of RNAseq data from these macrophages sorted from the indicated sites in naïve and 1 d post-MI mice. D. Left , Flow histograms depicting LYVE1 surface expression on cardiac CD169 + Tim4 + macrophages (green) and total Autofluorescence + CD64 + MHCII + macrophages (brown) in WT and Spx mice, 1 d post-MI. Right , FACS quantitation of LYVE1 hi and LYVE1 low CD169 + Tim4 + macrophages in the hearts of WT and Spx mice, 1 d post-MI; n=5-6/group. Statistics: unpaired t test. E. Representative confocal micrograph of border zone (BZ) myocardium immunostained for CD169 (red) and Tim4 (green) 1 d post-MI in WT and Spx mice; nuclear staining with DAPI (blue). Scale bar, 200 μm. Inset shows magnified images of CD169 and Tim4 staining. Yellow arrows indicate double positive cells; scale bar 10 μm.

Article Snippet: Cell suspensions were incubated with anti-mouse CD16/32 (clone 93, BioLegend) for 10 min at 4°C to block Fcγ receptors, and then stained for 60 minutes in staining buffer with anti-mouse fluorochrome-conjugated antibodies in panel appropriate combinations for specific experiments as follows: Ly6C-PE-Cy7 (HK1.4, eBioscience), Ly6C-PE Vio770 (1G7.G10, Miltenyi Biotec), CD45.1-FITC (A20, Miltenyi Biotec), CD45.2-PE (104, BD Biosciences), CD169-PE (REA197, Miltenyi Biotec; and 3D6.112, BioLegend), CD11b-Alexa Fluor 700 (M1/70, eBioscience), Tim4-Alexa Fluor 647 (RMT4-54, BioLegend), Gr1/Ly6G-eFluor 450 (RB6-8C5, eBioscience), F4/80-PerCP-Cy5.5 (BM8, eBioscience), MARCO-FITC (ED31, Novus Biologicals), CD45-600 Super Bright (30-F11, eBioscience), CD45-PE-Cy7 (30-F11, BD Biosciences), LYVE1 Alexa Fluor 488 (ALY7, eBioscience), CD45-605 NC (30-F11, eBioscience), CD54(ICAM-1)-PE (eBioKat-1, eBioscience), MHCII (I-A/I-E)-APC-eFluor780 (M5/114.15.2, eBioscience), TGFβ1-APC (TW7-16B4, BioLegend), CD54-FITC (YN1/1.7.4, BioLegend), CD169-PerCP/Cy5.5 (3D6.112, BioLegend), CD169-PE (3D6.112, BioLegend), CD64-Brilliant Violet 605 (X54-5/7.1, BioLegend), CD206-FITC (MR5D3, AbD Serotech), CD45-eVolve 605 (30-F11, eBioscience), CD206-Alexa Fluor 647 (MR5D3, Bio-Rad), IL17A-Alexa Fluor 700 (TC11-18H10.1, BioLegend), CD34-Alexa Fluor 647 (SA376A4, BioLegend), CD117(c-kit)-PE/Cy7 (ACK2, BioLegend), NOS2-TRITC (N-20, Santa Cruz Biotechnology), and CD16/32-PE (93, BioLegend, without pre-Fcγ receptor blocking).

Techniques: Expressing, Quantitation Assay, Transformation Assay, Staining

FACS plots and quantitation of Ly6C low CD169 + Tim4 + macrophages and total Ly6C low cells in blood ( A ) and in heart ( B ) 1 d post-MI in wild-type (WT) and splenectomized (Spx) WT mice, and CD169 DTR mice given diphtheria toxin (CD169 DTR /DT) at the time of MI; n=5-7/group, statistics: one-way ANOVA, Bonferroni post-test. Isotype antibody is shown in gray. C . FACS plots and group data for blood CD45 + CD11b + Ly6G + neutrophils and ICAM-1/CD54 + neutrophils 1 d post MI in WT, Spx, and CD169 DTR /DT mice; n=6-8/group; statistics: one-way ANOVA, Bonferroni post-test. D . Left, Representative confocal images of immunofluorescent Ly6G staining in WT, Spx, and CD169 DTR /DT hearts 1 d post-MI demonstrating Ly6G + neutrophil (red) infiltration (arrows); nuclear staining with DAPI (blue). Scale bar 20 μm. Right , FACS plots and corresponding quantitation of cardiac CD45 + CD11b + Ly6G + neutrophils (red) and annexin V + apoptotic neutrophils (blue) in the same groups 1 d post-MI; n=3-4/group, statistics: one-way ANOVA, Dunnett’sT3 post-test. E . FACS density plots for Lin − c-kit + CD34 + CD16/32 + granulocyte monocyte precursors (GMPs) in bone marrow from WT, Spx, and CD169 DTR /DT mice 1 d post MI, together with quantitation. Flow gates were based on isotype antibody control. n=5-7/group; statistics: one-way ANOVA, Tukey’s post-test. F . Left , Representative FACS dot plots identifying cardiac neutrophils as CD11b + Ly6G + cells in WT mice and as Ly6G + tdTomato + cells in Catchup mice at baseline and 1 d post-MI. Right Top , Representative histograms of Ly6G and tdTomato fluorescence intensity in heart mononuclear cells from the same groups. Right Bottom , FACS dot plots gated on cardiac CD169 + Tim4 + macrophages illustrating tdTomato expression in Catchup mice 1 d post-MI. Auto, autofluorescence. G . Representative FACS histograms of intracellular IL4 and IL10 staining in cardiac Ly6C low cells 1 d post MI in WT, Spx and CD169 DTR /DT mice, together with cell quantitation of the Ly6C low subsets. N=6-7/group; statistics: one-way ANOVA, Bonferroni post-test. H . Representative FACS pseudocolor plots for intracellular TGFβ and IL10 staining in cardiac CD169 + macrophages 1 d post MI in WT and Spx mice, with accompanying quantitation; n=4-5/group, statistics: unpaired t test.

Journal: medRxiv

Article Title: Splenic CD169 + Tim4 + Marginal Metallophilic Macrophages Are Essential for Wound Healing After Myocardial Infarction

doi: 10.1101/2024.08.09.24311769

Figure Lengend Snippet: FACS plots and quantitation of Ly6C low CD169 + Tim4 + macrophages and total Ly6C low cells in blood ( A ) and in heart ( B ) 1 d post-MI in wild-type (WT) and splenectomized (Spx) WT mice, and CD169 DTR mice given diphtheria toxin (CD169 DTR /DT) at the time of MI; n=5-7/group, statistics: one-way ANOVA, Bonferroni post-test. Isotype antibody is shown in gray. C . FACS plots and group data for blood CD45 + CD11b + Ly6G + neutrophils and ICAM-1/CD54 + neutrophils 1 d post MI in WT, Spx, and CD169 DTR /DT mice; n=6-8/group; statistics: one-way ANOVA, Bonferroni post-test. D . Left, Representative confocal images of immunofluorescent Ly6G staining in WT, Spx, and CD169 DTR /DT hearts 1 d post-MI demonstrating Ly6G + neutrophil (red) infiltration (arrows); nuclear staining with DAPI (blue). Scale bar 20 μm. Right , FACS plots and corresponding quantitation of cardiac CD45 + CD11b + Ly6G + neutrophils (red) and annexin V + apoptotic neutrophils (blue) in the same groups 1 d post-MI; n=3-4/group, statistics: one-way ANOVA, Dunnett’sT3 post-test. E . FACS density plots for Lin − c-kit + CD34 + CD16/32 + granulocyte monocyte precursors (GMPs) in bone marrow from WT, Spx, and CD169 DTR /DT mice 1 d post MI, together with quantitation. Flow gates were based on isotype antibody control. n=5-7/group; statistics: one-way ANOVA, Tukey’s post-test. F . Left , Representative FACS dot plots identifying cardiac neutrophils as CD11b + Ly6G + cells in WT mice and as Ly6G + tdTomato + cells in Catchup mice at baseline and 1 d post-MI. Right Top , Representative histograms of Ly6G and tdTomato fluorescence intensity in heart mononuclear cells from the same groups. Right Bottom , FACS dot plots gated on cardiac CD169 + Tim4 + macrophages illustrating tdTomato expression in Catchup mice 1 d post-MI. Auto, autofluorescence. G . Representative FACS histograms of intracellular IL4 and IL10 staining in cardiac Ly6C low cells 1 d post MI in WT, Spx and CD169 DTR /DT mice, together with cell quantitation of the Ly6C low subsets. N=6-7/group; statistics: one-way ANOVA, Bonferroni post-test. H . Representative FACS pseudocolor plots for intracellular TGFβ and IL10 staining in cardiac CD169 + macrophages 1 d post MI in WT and Spx mice, with accompanying quantitation; n=4-5/group, statistics: unpaired t test.

Article Snippet: Cell suspensions were incubated with anti-mouse CD16/32 (clone 93, BioLegend) for 10 min at 4°C to block Fcγ receptors, and then stained for 60 minutes in staining buffer with anti-mouse fluorochrome-conjugated antibodies in panel appropriate combinations for specific experiments as follows: Ly6C-PE-Cy7 (HK1.4, eBioscience), Ly6C-PE Vio770 (1G7.G10, Miltenyi Biotec), CD45.1-FITC (A20, Miltenyi Biotec), CD45.2-PE (104, BD Biosciences), CD169-PE (REA197, Miltenyi Biotec; and 3D6.112, BioLegend), CD11b-Alexa Fluor 700 (M1/70, eBioscience), Tim4-Alexa Fluor 647 (RMT4-54, BioLegend), Gr1/Ly6G-eFluor 450 (RB6-8C5, eBioscience), F4/80-PerCP-Cy5.5 (BM8, eBioscience), MARCO-FITC (ED31, Novus Biologicals), CD45-600 Super Bright (30-F11, eBioscience), CD45-PE-Cy7 (30-F11, BD Biosciences), LYVE1 Alexa Fluor 488 (ALY7, eBioscience), CD45-605 NC (30-F11, eBioscience), CD54(ICAM-1)-PE (eBioKat-1, eBioscience), MHCII (I-A/I-E)-APC-eFluor780 (M5/114.15.2, eBioscience), TGFβ1-APC (TW7-16B4, BioLegend), CD54-FITC (YN1/1.7.4, BioLegend), CD169-PerCP/Cy5.5 (3D6.112, BioLegend), CD169-PE (3D6.112, BioLegend), CD64-Brilliant Violet 605 (X54-5/7.1, BioLegend), CD206-FITC (MR5D3, AbD Serotech), CD45-eVolve 605 (30-F11, eBioscience), CD206-Alexa Fluor 647 (MR5D3, Bio-Rad), IL17A-Alexa Fluor 700 (TC11-18H10.1, BioLegend), CD34-Alexa Fluor 647 (SA376A4, BioLegend), CD117(c-kit)-PE/Cy7 (ACK2, BioLegend), NOS2-TRITC (N-20, Santa Cruz Biotechnology), and CD16/32-PE (93, BioLegend, without pre-Fcγ receptor blocking).

Techniques: Quantitation Assay, Staining, Control, Fluorescence, Expressing

A . Kaplan-Meier survival curves over 10 d following MI or sham operation in WT, Spx, and CD169 DTR /DT mice, and after MI in CD45.2 Spx mice with adoptive transfer of naïve splenic CD169 + Tim4 + cells from syngeneic CD45.1 WT mice 24 h post-MI (Spx-MI+AT). Statistical comparisons: log-rank test. B . Gross images of post-MI cardiac rupture with hemothorax or hemopericardium, and Kaplan-Meier curves for freedom from rupture over 10 d post-MI in WT, Spx, CD169 DTR /DT, and Spx-MI+AT mice. Statistical comparisons: log-rank test. C . Left , Representative post-mortem whole hearts and end-diastolic long-axis 2-dimensional echocardiograms from WT-MI, Spx-MI, CD169 DTR /DT-MI and Spx-MI+AT mice (10 d post-MI). Right , Quantitation of LV ejection fraction (EF) and end-diastolic and end-systolic volume (EDV and ESV) at 10 d post-MI; n=4-6/group, statistics: one-way ANOVA, Bonferroni post-test. D . Left , Representative confocal images of immunofluorescent staining for CD206 (green) and iNOS (red) in the heart infarct border zone (BZ) from WT-MI, Spx-MI, CD169 DTR /DT-MI, and Spx-MI+AT mice 10 d post-MI. DAPI (blue) nuclear staining. iNOS + CD206 + cells appear yellow. Higher magnification is shown in the middle panel. Right , quantitation of iNOS + CD206 + and iNOS − CD206 + cells/mm 2 in the hearts. N=3/group, statistics: one-way ANOVA, Bonferroni post-test. NS, not significant. E . Top Left , Confocal images of MMP-9 immunostaining (red) in infarct BZ of hearts from WT-MI, Spx-MI, CD169 DTR /DT-MI, and Spx-MI+AT mice 10 d post-MI. Nuclear staining with DAPI (blue). Top Right , Quantitative group data for total MMP-9 mean fluorescence intensity per region of interest (ROI). AU, arbitrary units. N=4/group, statistics: one-way ANOVA, Bonferroni post-test. Bottom , Representative Masson’s trichrome stains of infarcted hearts (10 d post-MI) from the same groups demonstrating MI border zone (BZ) fibrosis, together with BZ fibrosis quantitation. n=4/group; statistics: one-way ANOVA, Bonferroni post-test. F . FACS quantitation of Ly6C hi blood monocytes and serum IL-10 levels in WT-MI, Spx-MI, CD169 DTR /DT-MI, and Spx-MI+AT mice at 10 d post-MI. N=4-7/group, statistics: one-way ANOVA, Bonferroni post-test.

Journal: medRxiv

Article Title: Splenic CD169 + Tim4 + Marginal Metallophilic Macrophages Are Essential for Wound Healing After Myocardial Infarction

doi: 10.1101/2024.08.09.24311769

Figure Lengend Snippet: A . Kaplan-Meier survival curves over 10 d following MI or sham operation in WT, Spx, and CD169 DTR /DT mice, and after MI in CD45.2 Spx mice with adoptive transfer of naïve splenic CD169 + Tim4 + cells from syngeneic CD45.1 WT mice 24 h post-MI (Spx-MI+AT). Statistical comparisons: log-rank test. B . Gross images of post-MI cardiac rupture with hemothorax or hemopericardium, and Kaplan-Meier curves for freedom from rupture over 10 d post-MI in WT, Spx, CD169 DTR /DT, and Spx-MI+AT mice. Statistical comparisons: log-rank test. C . Left , Representative post-mortem whole hearts and end-diastolic long-axis 2-dimensional echocardiograms from WT-MI, Spx-MI, CD169 DTR /DT-MI and Spx-MI+AT mice (10 d post-MI). Right , Quantitation of LV ejection fraction (EF) and end-diastolic and end-systolic volume (EDV and ESV) at 10 d post-MI; n=4-6/group, statistics: one-way ANOVA, Bonferroni post-test. D . Left , Representative confocal images of immunofluorescent staining for CD206 (green) and iNOS (red) in the heart infarct border zone (BZ) from WT-MI, Spx-MI, CD169 DTR /DT-MI, and Spx-MI+AT mice 10 d post-MI. DAPI (blue) nuclear staining. iNOS + CD206 + cells appear yellow. Higher magnification is shown in the middle panel. Right , quantitation of iNOS + CD206 + and iNOS − CD206 + cells/mm 2 in the hearts. N=3/group, statistics: one-way ANOVA, Bonferroni post-test. NS, not significant. E . Top Left , Confocal images of MMP-9 immunostaining (red) in infarct BZ of hearts from WT-MI, Spx-MI, CD169 DTR /DT-MI, and Spx-MI+AT mice 10 d post-MI. Nuclear staining with DAPI (blue). Top Right , Quantitative group data for total MMP-9 mean fluorescence intensity per region of interest (ROI). AU, arbitrary units. N=4/group, statistics: one-way ANOVA, Bonferroni post-test. Bottom , Representative Masson’s trichrome stains of infarcted hearts (10 d post-MI) from the same groups demonstrating MI border zone (BZ) fibrosis, together with BZ fibrosis quantitation. n=4/group; statistics: one-way ANOVA, Bonferroni post-test. F . FACS quantitation of Ly6C hi blood monocytes and serum IL-10 levels in WT-MI, Spx-MI, CD169 DTR /DT-MI, and Spx-MI+AT mice at 10 d post-MI. N=4-7/group, statistics: one-way ANOVA, Bonferroni post-test.

Article Snippet: Cell suspensions were incubated with anti-mouse CD16/32 (clone 93, BioLegend) for 10 min at 4°C to block Fcγ receptors, and then stained for 60 minutes in staining buffer with anti-mouse fluorochrome-conjugated antibodies in panel appropriate combinations for specific experiments as follows: Ly6C-PE-Cy7 (HK1.4, eBioscience), Ly6C-PE Vio770 (1G7.G10, Miltenyi Biotec), CD45.1-FITC (A20, Miltenyi Biotec), CD45.2-PE (104, BD Biosciences), CD169-PE (REA197, Miltenyi Biotec; and 3D6.112, BioLegend), CD11b-Alexa Fluor 700 (M1/70, eBioscience), Tim4-Alexa Fluor 647 (RMT4-54, BioLegend), Gr1/Ly6G-eFluor 450 (RB6-8C5, eBioscience), F4/80-PerCP-Cy5.5 (BM8, eBioscience), MARCO-FITC (ED31, Novus Biologicals), CD45-600 Super Bright (30-F11, eBioscience), CD45-PE-Cy7 (30-F11, BD Biosciences), LYVE1 Alexa Fluor 488 (ALY7, eBioscience), CD45-605 NC (30-F11, eBioscience), CD54(ICAM-1)-PE (eBioKat-1, eBioscience), MHCII (I-A/I-E)-APC-eFluor780 (M5/114.15.2, eBioscience), TGFβ1-APC (TW7-16B4, BioLegend), CD54-FITC (YN1/1.7.4, BioLegend), CD169-PerCP/Cy5.5 (3D6.112, BioLegend), CD169-PE (3D6.112, BioLegend), CD64-Brilliant Violet 605 (X54-5/7.1, BioLegend), CD206-FITC (MR5D3, AbD Serotech), CD45-eVolve 605 (30-F11, eBioscience), CD206-Alexa Fluor 647 (MR5D3, Bio-Rad), IL17A-Alexa Fluor 700 (TC11-18H10.1, BioLegend), CD34-Alexa Fluor 647 (SA376A4, BioLegend), CD117(c-kit)-PE/Cy7 (ACK2, BioLegend), NOS2-TRITC (N-20, Santa Cruz Biotechnology), and CD16/32-PE (93, BioLegend, without pre-Fcγ receptor blocking).

Techniques: Adoptive Transfer Assay, Quantitation Assay, Staining, Immunostaining, Fluorescence

A . Protocol for LXRα agonist T0901317 treatment (40 mg/kg i.p.) from 1 d prior to 5 d post-MI, with 10 d post-MI follow-up, in WT and Spx mice. B . FACS contour plots and quantitation of cardiac CD169 + Tim4 + macrophages 1 d post-MI and blood CD169 + Tim4 + macrophages 10 d post-MI in untreated and T0901317-treated WT and Spx mice. N=5-6/group, statistics: one-way ANOVA, Bonferroni post-test. C . Kaplan-Meier survival curves post-MI in untreated and T0901317-treated WT and Spx mice. Statistical comparisons by log-rank test, group sizes as indicated. D . Representative end-diastolic long-axis 2-dimensional echocardiograms and group data for LV ejection fraction (EF) and end-diastolic and end-systolic volume (EDV and ESV) in the same mouse groups at 10 d post-MI; n=5-10/group, statistics: one-way ANOVA, Bonferroni post-test. E . Top , Kaplan-Meier survival curves over 8 w post-MI in WT mice treated with either vehicle or T0901317 from 1 d before MI to 5 d post-MI (statistical comparison by log-rank test, n=12-17/group as indicated) and group data for LVEF, LVEDV, LVESV, and normalized heart and lung weight at 8 w post-MI; n=8-9/group for echocardiography, n=4-7/group for gravimetry. Statistical comparisons: unpaired t test. HF, heart failure; TL, tibia length; NS, not significant. Bottom Left , Representative Masson’s trichrome staining of LV short-axis sections (2x magnification) and infarct border zone (BZ, scale bar 500 μm), along with quantitation of cardiac fibrosis (BZ and remote zone [RZ], blue staining) in vehicle- and T0901317-treated WT HF mice. Also shown are confocal images of immunofluorescent staining for CD206 (green) and iNOS (red) in the RZ of hearts from vehicle-and T0901317-treated HF mice (8 w post-MI) and quantitation of iNOS + CD206 + and iNOS − CD206 + macrophages (Mφ) per mm 2 . Double positive (CD206 + iNOS + ) cells appear yellow (arrows). DAPI (blue) was used for nuclear staining. N=4-8/group, statistics: unpaired t test. Bottom Right , Representative FACS contour plots to identify Ly6C hi monocytes in vehicle- and T0901317-treated WT HF mice (8 w post-MI), and corresponding quantitation. N=5-10/group, statistics: unpaired t test.

Journal: medRxiv

Article Title: Splenic CD169 + Tim4 + Marginal Metallophilic Macrophages Are Essential for Wound Healing After Myocardial Infarction

doi: 10.1101/2024.08.09.24311769

Figure Lengend Snippet: A . Protocol for LXRα agonist T0901317 treatment (40 mg/kg i.p.) from 1 d prior to 5 d post-MI, with 10 d post-MI follow-up, in WT and Spx mice. B . FACS contour plots and quantitation of cardiac CD169 + Tim4 + macrophages 1 d post-MI and blood CD169 + Tim4 + macrophages 10 d post-MI in untreated and T0901317-treated WT and Spx mice. N=5-6/group, statistics: one-way ANOVA, Bonferroni post-test. C . Kaplan-Meier survival curves post-MI in untreated and T0901317-treated WT and Spx mice. Statistical comparisons by log-rank test, group sizes as indicated. D . Representative end-diastolic long-axis 2-dimensional echocardiograms and group data for LV ejection fraction (EF) and end-diastolic and end-systolic volume (EDV and ESV) in the same mouse groups at 10 d post-MI; n=5-10/group, statistics: one-way ANOVA, Bonferroni post-test. E . Top , Kaplan-Meier survival curves over 8 w post-MI in WT mice treated with either vehicle or T0901317 from 1 d before MI to 5 d post-MI (statistical comparison by log-rank test, n=12-17/group as indicated) and group data for LVEF, LVEDV, LVESV, and normalized heart and lung weight at 8 w post-MI; n=8-9/group for echocardiography, n=4-7/group for gravimetry. Statistical comparisons: unpaired t test. HF, heart failure; TL, tibia length; NS, not significant. Bottom Left , Representative Masson’s trichrome staining of LV short-axis sections (2x magnification) and infarct border zone (BZ, scale bar 500 μm), along with quantitation of cardiac fibrosis (BZ and remote zone [RZ], blue staining) in vehicle- and T0901317-treated WT HF mice. Also shown are confocal images of immunofluorescent staining for CD206 (green) and iNOS (red) in the RZ of hearts from vehicle-and T0901317-treated HF mice (8 w post-MI) and quantitation of iNOS + CD206 + and iNOS − CD206 + macrophages (Mφ) per mm 2 . Double positive (CD206 + iNOS + ) cells appear yellow (arrows). DAPI (blue) was used for nuclear staining. N=4-8/group, statistics: unpaired t test. Bottom Right , Representative FACS contour plots to identify Ly6C hi monocytes in vehicle- and T0901317-treated WT HF mice (8 w post-MI), and corresponding quantitation. N=5-10/group, statistics: unpaired t test.

Article Snippet: Cell suspensions were incubated with anti-mouse CD16/32 (clone 93, BioLegend) for 10 min at 4°C to block Fcγ receptors, and then stained for 60 minutes in staining buffer with anti-mouse fluorochrome-conjugated antibodies in panel appropriate combinations for specific experiments as follows: Ly6C-PE-Cy7 (HK1.4, eBioscience), Ly6C-PE Vio770 (1G7.G10, Miltenyi Biotec), CD45.1-FITC (A20, Miltenyi Biotec), CD45.2-PE (104, BD Biosciences), CD169-PE (REA197, Miltenyi Biotec; and 3D6.112, BioLegend), CD11b-Alexa Fluor 700 (M1/70, eBioscience), Tim4-Alexa Fluor 647 (RMT4-54, BioLegend), Gr1/Ly6G-eFluor 450 (RB6-8C5, eBioscience), F4/80-PerCP-Cy5.5 (BM8, eBioscience), MARCO-FITC (ED31, Novus Biologicals), CD45-600 Super Bright (30-F11, eBioscience), CD45-PE-Cy7 (30-F11, BD Biosciences), LYVE1 Alexa Fluor 488 (ALY7, eBioscience), CD45-605 NC (30-F11, eBioscience), CD54(ICAM-1)-PE (eBioKat-1, eBioscience), MHCII (I-A/I-E)-APC-eFluor780 (M5/114.15.2, eBioscience), TGFβ1-APC (TW7-16B4, BioLegend), CD54-FITC (YN1/1.7.4, BioLegend), CD169-PerCP/Cy5.5 (3D6.112, BioLegend), CD169-PE (3D6.112, BioLegend), CD64-Brilliant Violet 605 (X54-5/7.1, BioLegend), CD206-FITC (MR5D3, AbD Serotech), CD45-eVolve 605 (30-F11, eBioscience), CD206-Alexa Fluor 647 (MR5D3, Bio-Rad), IL17A-Alexa Fluor 700 (TC11-18H10.1, BioLegend), CD34-Alexa Fluor 647 (SA376A4, BioLegend), CD117(c-kit)-PE/Cy7 (ACK2, BioLegend), NOS2-TRITC (N-20, Santa Cruz Biotechnology), and CD16/32-PE (93, BioLegend, without pre-Fcγ receptor blocking).

Techniques: Quantitation Assay, Comparison, Staining

A . FACS plots and characterization of human CD45 + CD14 + HLA- DR + CD64 + CD169 + Tim4 + circulating macrophages from a subject with acute STEMI. The accompanying overlaid contour plot illustrates CD14 + HLA-DR + (red) and CD64 + CD169 + Tim4 + (green) subsets superimposed on all CD45 + leukocytes in an SSC-A versus FSC-A gate. B . Top , FACS gating strategy for sorting CD45 + CD14 + HLA-DR + CD169 + cells from human peripheral blood for further characterization using ImageStream analysis. Bottom , ImageStream visualization of FACS-sorted CD45 + CD169 + blood cells from STEMI patients and control subjects undergoing elective percutaneous coronary intervention (PCI), and group data for size distribution of CD169 + cells; scale bar 10 μm. C . FACS contour plots and quantitation of circulating CD45 + CD14 + HLA-DR + CD64 + CD169 + Tim4 + macrophages in STEMI and control PCI subjects. n=11-14/group, statistics: unpaired t test.

Journal: medRxiv

Article Title: Splenic CD169 + Tim4 + Marginal Metallophilic Macrophages Are Essential for Wound Healing After Myocardial Infarction

doi: 10.1101/2024.08.09.24311769

Figure Lengend Snippet: A . FACS plots and characterization of human CD45 + CD14 + HLA- DR + CD64 + CD169 + Tim4 + circulating macrophages from a subject with acute STEMI. The accompanying overlaid contour plot illustrates CD14 + HLA-DR + (red) and CD64 + CD169 + Tim4 + (green) subsets superimposed on all CD45 + leukocytes in an SSC-A versus FSC-A gate. B . Top , FACS gating strategy for sorting CD45 + CD14 + HLA-DR + CD169 + cells from human peripheral blood for further characterization using ImageStream analysis. Bottom , ImageStream visualization of FACS-sorted CD45 + CD169 + blood cells from STEMI patients and control subjects undergoing elective percutaneous coronary intervention (PCI), and group data for size distribution of CD169 + cells; scale bar 10 μm. C . FACS contour plots and quantitation of circulating CD45 + CD14 + HLA-DR + CD64 + CD169 + Tim4 + macrophages in STEMI and control PCI subjects. n=11-14/group, statistics: unpaired t test.

Article Snippet: Cell suspensions were incubated with anti-mouse CD16/32 (clone 93, BioLegend) for 10 min at 4°C to block Fcγ receptors, and then stained for 60 minutes in staining buffer with anti-mouse fluorochrome-conjugated antibodies in panel appropriate combinations for specific experiments as follows: Ly6C-PE-Cy7 (HK1.4, eBioscience), Ly6C-PE Vio770 (1G7.G10, Miltenyi Biotec), CD45.1-FITC (A20, Miltenyi Biotec), CD45.2-PE (104, BD Biosciences), CD169-PE (REA197, Miltenyi Biotec; and 3D6.112, BioLegend), CD11b-Alexa Fluor 700 (M1/70, eBioscience), Tim4-Alexa Fluor 647 (RMT4-54, BioLegend), Gr1/Ly6G-eFluor 450 (RB6-8C5, eBioscience), F4/80-PerCP-Cy5.5 (BM8, eBioscience), MARCO-FITC (ED31, Novus Biologicals), CD45-600 Super Bright (30-F11, eBioscience), CD45-PE-Cy7 (30-F11, BD Biosciences), LYVE1 Alexa Fluor 488 (ALY7, eBioscience), CD45-605 NC (30-F11, eBioscience), CD54(ICAM-1)-PE (eBioKat-1, eBioscience), MHCII (I-A/I-E)-APC-eFluor780 (M5/114.15.2, eBioscience), TGFβ1-APC (TW7-16B4, BioLegend), CD54-FITC (YN1/1.7.4, BioLegend), CD169-PerCP/Cy5.5 (3D6.112, BioLegend), CD169-PE (3D6.112, BioLegend), CD64-Brilliant Violet 605 (X54-5/7.1, BioLegend), CD206-FITC (MR5D3, AbD Serotech), CD45-eVolve 605 (30-F11, eBioscience), CD206-Alexa Fluor 647 (MR5D3, Bio-Rad), IL17A-Alexa Fluor 700 (TC11-18H10.1, BioLegend), CD34-Alexa Fluor 647 (SA376A4, BioLegend), CD117(c-kit)-PE/Cy7 (ACK2, BioLegend), NOS2-TRITC (N-20, Santa Cruz Biotechnology), and CD16/32-PE (93, BioLegend, without pre-Fcγ receptor blocking).

Techniques: Control, Quantitation Assay

Overview of the experimental workflow (A–D) Animal is anesthetized (A), followed by retro-orbital lectin injection (B). Animals then undergo transcardiac perfusion (C), followed by leg dissection and skin removal (D). (E–H) (E) Leg samples undergo fixation, decalcification, delipidation methods, and RI matching (tissue clearing) to render them transparent, as shown in (F). Cleared leg samples were imaged on a light-sheet fluorescence microscope (G) to view the vasculature, as shown in (H).

Journal: iScience

Article Title: Comparative analysis of clearing methods for 3D imaging of the vasculature in mineralized mouse tissues

doi: 10.1016/j.isci.2026.115464

Figure Lengend Snippet: Overview of the experimental workflow (A–D) Animal is anesthetized (A), followed by retro-orbital lectin injection (B). Animals then undergo transcardiac perfusion (C), followed by leg dissection and skin removal (D). (E–H) (E) Leg samples undergo fixation, decalcification, delipidation methods, and RI matching (tissue clearing) to render them transparent, as shown in (F). Cleared leg samples were imaged on a light-sheet fluorescence microscope (G) to view the vasculature, as shown in (H).

Article Snippet: After the depth of anesthesia was confirmed by absence of toe pinch reflex, mice were retro-orbitally injected with 50 μL Lycopersicon esculentum (tomato) lectin 649 nm (Vector Laboratories, USA DL-1178-1) or 50 uL of 2% Evans blue dye (Sigma-Aldrich E2129) in sterile saline solution (Sigma-Aldrich S8776) into the retro-bulbar sinus vein using a 31-gauge needle.

Techniques: Injection, Dissection, Fluorescence, Microscopy

Comparison of clearing methods on mouse hindlimb vascular visualization (A) Schematic diagram of the knee region indicating imaging orientation and planes of depth of view. (B–G) Light microscopy images of mouse hindlimbs cleared using either iDISCO + , vDISCO, fDISCO, EZ Clear, Binaree, or CLARITY. (H–M) Sagittal view of light-sheet fluorescent microscope (LSFM) images of mouse hindlimbs following perfusion with lectin-649 nm and processing with the indicated tissue clearing protocols (far left column). Yellow dashed box indicates the knee region. (N–S) Magnified view of the knee region corresponding to the samples shown in (H–M). (T–Y) Images showing the depth of view of the knee region (the yellow axis for the Z plane is indicated in each panel on the far left of the image). (Z–E′) Optical sections along the z axis of the knee region at increasing depths (from 1 to 3 mm) highlight the retention of crisp signal in the vessels within the iDISCO+ and EZ Clear processed samples. n = 5 samples per group; t test, p ≤ 0.05. Scale bars, 500 μm. See also , , , , , , and .

Journal: iScience

Article Title: Comparative analysis of clearing methods for 3D imaging of the vasculature in mineralized mouse tissues

doi: 10.1016/j.isci.2026.115464

Figure Lengend Snippet: Comparison of clearing methods on mouse hindlimb vascular visualization (A) Schematic diagram of the knee region indicating imaging orientation and planes of depth of view. (B–G) Light microscopy images of mouse hindlimbs cleared using either iDISCO + , vDISCO, fDISCO, EZ Clear, Binaree, or CLARITY. (H–M) Sagittal view of light-sheet fluorescent microscope (LSFM) images of mouse hindlimbs following perfusion with lectin-649 nm and processing with the indicated tissue clearing protocols (far left column). Yellow dashed box indicates the knee region. (N–S) Magnified view of the knee region corresponding to the samples shown in (H–M). (T–Y) Images showing the depth of view of the knee region (the yellow axis for the Z plane is indicated in each panel on the far left of the image). (Z–E′) Optical sections along the z axis of the knee region at increasing depths (from 1 to 3 mm) highlight the retention of crisp signal in the vessels within the iDISCO+ and EZ Clear processed samples. n = 5 samples per group; t test, p ≤ 0.05. Scale bars, 500 μm. See also , , , , , , and .

Article Snippet: After the depth of anesthesia was confirmed by absence of toe pinch reflex, mice were retro-orbitally injected with 50 μL Lycopersicon esculentum (tomato) lectin 649 nm (Vector Laboratories, USA DL-1178-1) or 50 uL of 2% Evans blue dye (Sigma-Aldrich E2129) in sterile saline solution (Sigma-Aldrich S8776) into the retro-bulbar sinus vein using a 31-gauge needle.

Techniques: Comparison, Imaging, Light Microscopy, Microscopy

Evaluation of decalcification duration for achieving optimal clearing and vascular visualization in aged mouse hindlimbs (A) A sagittal maximum intensity projection following LSFM imaging of a mouse hindlimb perfused with lectin-649 nm and cleared using iDISCO + with 2 days of decalcification in 10% EDTA. The yellow dashed area is magnified in (B) and represents the knee region, with the outline of the femur and tibia noted. (C) A depth-of-view image of the sample in (A) (note the z axis, in yellow, at the far left) showing how fluorescence signal diminishes at greater depths. (D) A similarly perfused mouse hindlimb processed for iDISCO + clearing after 5 days of decalcification. (E) A magnified view of the knee region from (A) and (F) a depth-of-view image showing improved signal intensity overall, less signal from bone, and more intense signal at greater imaging depths along the z axis. (G) Schematic of the knee region showing imaging orientation and planes of optical sections shown in (H) and (I). (H and I) Comparison of optical sections of the knee along the z axis. (J) Quantification of the signal-to-background fluorescence ratio (SBR) (expressed as mean ± SEM) in the mouse hindlimb showing increased SBR in the 5-day decalcification samples compared to 2-day decalcification. n = 5 samples per group (6-month-old mice; both sexes); t test, ∗∗∗∗ p ≤ 0.0001. Scale bars, 500 μm. See also , and .

Journal: iScience

Article Title: Comparative analysis of clearing methods for 3D imaging of the vasculature in mineralized mouse tissues

doi: 10.1016/j.isci.2026.115464

Figure Lengend Snippet: Evaluation of decalcification duration for achieving optimal clearing and vascular visualization in aged mouse hindlimbs (A) A sagittal maximum intensity projection following LSFM imaging of a mouse hindlimb perfused with lectin-649 nm and cleared using iDISCO + with 2 days of decalcification in 10% EDTA. The yellow dashed area is magnified in (B) and represents the knee region, with the outline of the femur and tibia noted. (C) A depth-of-view image of the sample in (A) (note the z axis, in yellow, at the far left) showing how fluorescence signal diminishes at greater depths. (D) A similarly perfused mouse hindlimb processed for iDISCO + clearing after 5 days of decalcification. (E) A magnified view of the knee region from (A) and (F) a depth-of-view image showing improved signal intensity overall, less signal from bone, and more intense signal at greater imaging depths along the z axis. (G) Schematic of the knee region showing imaging orientation and planes of optical sections shown in (H) and (I). (H and I) Comparison of optical sections of the knee along the z axis. (J) Quantification of the signal-to-background fluorescence ratio (SBR) (expressed as mean ± SEM) in the mouse hindlimb showing increased SBR in the 5-day decalcification samples compared to 2-day decalcification. n = 5 samples per group (6-month-old mice; both sexes); t test, ∗∗∗∗ p ≤ 0.0001. Scale bars, 500 μm. See also , and .

Article Snippet: After the depth of anesthesia was confirmed by absence of toe pinch reflex, mice were retro-orbitally injected with 50 μL Lycopersicon esculentum (tomato) lectin 649 nm (Vector Laboratories, USA DL-1178-1) or 50 uL of 2% Evans blue dye (Sigma-Aldrich E2129) in sterile saline solution (Sigma-Aldrich S8776) into the retro-bulbar sinus vein using a 31-gauge needle.

Techniques: Imaging, Fluorescence, Comparison

Assessing the impact of imaging orientation between iDISCO + and EZ Clear in the mouse hindlimb (A and B) Schematics illustrate the different imaging orientations and planes of optical sections for (C–R). (C–F) Comparison of how an anterior or sagittal orientation of the sample relative to the microscope objective impacts fluorescence signal intensity and depth within the vasculature of the adult murine hindlimb following perfusion with lectin-649 and either EZ Clear or iDISCO + tissue clearing. (G–J) Optical sections of both views, with the femur and tibia indicated. (K–N) Depth-of-view images and (O–R) optical sections along the z axis of the knee region. Scale bars, 500 μm. SLGV, superior lateral geniculate vessel; SMGV, superior medial geniculate vessel; IMGV, inferior medial geniculate vessel; ILGV, inferior lateral geniculate vessel. n = 5 samples per group; t test, p ≤ 0.05. Scale bars, 500 μm. See also , , , , and .

Journal: iScience

Article Title: Comparative analysis of clearing methods for 3D imaging of the vasculature in mineralized mouse tissues

doi: 10.1016/j.isci.2026.115464

Figure Lengend Snippet: Assessing the impact of imaging orientation between iDISCO + and EZ Clear in the mouse hindlimb (A and B) Schematics illustrate the different imaging orientations and planes of optical sections for (C–R). (C–F) Comparison of how an anterior or sagittal orientation of the sample relative to the microscope objective impacts fluorescence signal intensity and depth within the vasculature of the adult murine hindlimb following perfusion with lectin-649 and either EZ Clear or iDISCO + tissue clearing. (G–J) Optical sections of both views, with the femur and tibia indicated. (K–N) Depth-of-view images and (O–R) optical sections along the z axis of the knee region. Scale bars, 500 μm. SLGV, superior lateral geniculate vessel; SMGV, superior medial geniculate vessel; IMGV, inferior medial geniculate vessel; ILGV, inferior lateral geniculate vessel. n = 5 samples per group; t test, p ≤ 0.05. Scale bars, 500 μm. See also , , , , and .

Article Snippet: After the depth of anesthesia was confirmed by absence of toe pinch reflex, mice were retro-orbitally injected with 50 μL Lycopersicon esculentum (tomato) lectin 649 nm (Vector Laboratories, USA DL-1178-1) or 50 uL of 2% Evans blue dye (Sigma-Aldrich E2129) in sterile saline solution (Sigma-Aldrich S8776) into the retro-bulbar sinus vein using a 31-gauge needle.

Techniques: Imaging, Comparison, Microscopy, Fluorescence

Comparison of the mouse hindlimb vascular network visualized by micro-CT or by iDISCO + clearing and light-sheet imaging (A and B) Anterior view of representative micro-CT images of the mouse hindlimb following perfusion with Vascupaint contrast agent and an LSFM image of a mouse hindlimb perfused with lectin-649 and cleared using iDISCO + . Bone in the micro-CT images is pseudocolored white, while vessels in both the micro-CT and light-sheet panels are color coded based on vessel diameter (the keys corresponding to vessel diameter are to the right of [E and F]). (C and D) Medial and (E and F) lateral views of the same samples. (G) Quantification of the frequency of different diameter vessels in micro-CT and LSFM-imaged samples, with error bars showing mean ± SEM. (H) Quantification of the difference in vessel volume relative to the sample volume (calculated as vessel volume ratio (%) = V e s s e l v o l u m e S a m p l e v o l u m e × 100%) between micro-CT and LSFM-imaged samples, with error bars showing mean ± SEM. F, femur; Fi, fibula; P, patella; T, tibia; IMGA, inferior medial geniculate artery; ILGA, inferior lateral geniculate artery; PA, popliteal artery; SMGA, superior medial genicular artery; SLGA, superior lateral genicular artery). n = 5 samples per group (2 month-old mice); t test, ∗∗∗∗ p ≤ 0.0001. Scale bars, 500 μm. See also .

Journal: iScience

Article Title: Comparative analysis of clearing methods for 3D imaging of the vasculature in mineralized mouse tissues

doi: 10.1016/j.isci.2026.115464

Figure Lengend Snippet: Comparison of the mouse hindlimb vascular network visualized by micro-CT or by iDISCO + clearing and light-sheet imaging (A and B) Anterior view of representative micro-CT images of the mouse hindlimb following perfusion with Vascupaint contrast agent and an LSFM image of a mouse hindlimb perfused with lectin-649 and cleared using iDISCO + . Bone in the micro-CT images is pseudocolored white, while vessels in both the micro-CT and light-sheet panels are color coded based on vessel diameter (the keys corresponding to vessel diameter are to the right of [E and F]). (C and D) Medial and (E and F) lateral views of the same samples. (G) Quantification of the frequency of different diameter vessels in micro-CT and LSFM-imaged samples, with error bars showing mean ± SEM. (H) Quantification of the difference in vessel volume relative to the sample volume (calculated as vessel volume ratio (%) = V e s s e l v o l u m e S a m p l e v o l u m e × 100%) between micro-CT and LSFM-imaged samples, with error bars showing mean ± SEM. F, femur; Fi, fibula; P, patella; T, tibia; IMGA, inferior medial geniculate artery; ILGA, inferior lateral geniculate artery; PA, popliteal artery; SMGA, superior medial genicular artery; SLGA, superior lateral genicular artery). n = 5 samples per group (2 month-old mice); t test, ∗∗∗∗ p ≤ 0.0001. Scale bars, 500 μm. See also .

Article Snippet: After the depth of anesthesia was confirmed by absence of toe pinch reflex, mice were retro-orbitally injected with 50 μL Lycopersicon esculentum (tomato) lectin 649 nm (Vector Laboratories, USA DL-1178-1) or 50 uL of 2% Evans blue dye (Sigma-Aldrich E2129) in sterile saline solution (Sigma-Aldrich S8776) into the retro-bulbar sinus vein using a 31-gauge needle.

Techniques: Comparison, Micro-CT, Imaging

α2,3-sialylation is required for BCG-induced osteoclast differentiation and activity (A) Comparison of differentially expressed genes (DEGs) between BCG-infected osteoclasts (RB) and uninfected controls (R). (n = 3 biological replicates per group, differential expression was defined as |FoldChange| > 2 and padj <0.05). (B) Volcano plot of DEGs highlighting genes related to sialic acid biosynthesis. (C) KEGG pathway enrichment analysis of upregulated DEGs in RB cells. (D,E) Immunofluorescence staining of α2,3-SA in mouse calvarial sections using MAL II lectin, with quantification of α2,3-SA fluorescence intensity (n = 5). Intensity density was normalized to the PBS group mean. (F) In vitro osteoclasts subjected to MAL II lectin staining and TRAP staining, with or without sialidase treatment to enzymatically remove α2,3-SA. (G) Quantification of α2,3-SA fluorescence intensity in cultured osteoclasts (n = 5). Intensity density was measured in cellular ROIs after background subtraction and normalized to the RANKL group mean. (H) Quantification of TRAP + multinucleated cells (≥3 nuclei) per field (randomly selected fields, fixed magnification) in vitro (n = 5). (I) mRNA expression levels of osteoclast differentiation markers ( Fos, Mmp9, Nfatc1, and Ocstamp ) in osteoclasts (n = 3). Data are presented as mean ± SD. Statistical significance was determined by two-tailed unpaired Student’s t-test for two-group comparisons (E) and one-way ANOVA followed by Tukey’s post hoc test for three-group comparisons (G–I) .

Journal: Frontiers in Pharmacology

Article Title: Mycobacterium tuberculosis infection drives osteoclast overactivation via α2,3-Sialylation to promote pathological bone destruction

doi: 10.3389/fphar.2026.1738896

Figure Lengend Snippet: α2,3-sialylation is required for BCG-induced osteoclast differentiation and activity (A) Comparison of differentially expressed genes (DEGs) between BCG-infected osteoclasts (RB) and uninfected controls (R). (n = 3 biological replicates per group, differential expression was defined as |FoldChange| > 2 and padj <0.05). (B) Volcano plot of DEGs highlighting genes related to sialic acid biosynthesis. (C) KEGG pathway enrichment analysis of upregulated DEGs in RB cells. (D,E) Immunofluorescence staining of α2,3-SA in mouse calvarial sections using MAL II lectin, with quantification of α2,3-SA fluorescence intensity (n = 5). Intensity density was normalized to the PBS group mean. (F) In vitro osteoclasts subjected to MAL II lectin staining and TRAP staining, with or without sialidase treatment to enzymatically remove α2,3-SA. (G) Quantification of α2,3-SA fluorescence intensity in cultured osteoclasts (n = 5). Intensity density was measured in cellular ROIs after background subtraction and normalized to the RANKL group mean. (H) Quantification of TRAP + multinucleated cells (≥3 nuclei) per field (randomly selected fields, fixed magnification) in vitro (n = 5). (I) mRNA expression levels of osteoclast differentiation markers ( Fos, Mmp9, Nfatc1, and Ocstamp ) in osteoclasts (n = 3). Data are presented as mean ± SD. Statistical significance was determined by two-tailed unpaired Student’s t-test for two-group comparisons (E) and one-way ANOVA followed by Tukey’s post hoc test for three-group comparisons (G–I) .

Article Snippet: Biotin MAL-II , Vector laboratories , Cat# B-1265-1.

Techniques: Activity Assay, Comparison, Infection, Quantitative Proteomics, Immunofluorescence, Staining, Fluorescence, In Vitro, Cell Culture, Expressing, Two Tailed Test