lcn2 Search Results


94
Sino Biological mouse recombinant lcn2
Monomeric form of Ent can disseminate into systemic circulation. Serum was collected from male germ-free (GF) rats and GF rats co-housed (GFC) with conventional mice for 10 d (8 weeks old, n = 5–6) at Taconic Facility. Serum metabolites were extracted using standard procedures for targeted metabolomics profiling. The extracted samples were analyzed using HPLC coupled to Agilent 6495 QQQ mass spectrometry (LC–MS). Ent was quantified as its monomeric form 2, 3-dihydroxy benzoic acid (2, 3-DHBA). The data were normalized with internal standards and log2-transformed on a per-sample basis. (A) Ent spectra (B) Fold change in serum 2, 3-DHBA. Note: Trace amounts of 2, 3-DHBA in GF animal sera are likely to be from dead bacteria in the diet. (C) Fecal <t>Lcn2.</t> Results are expressed as mean ± SEM. *** p < 0.001.
Mouse Recombinant Lcn2, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pmc13114135-86-0-6?v=Sino+Biological
Average 94 stars, based on 1 article reviews
mouse recombinant lcn2 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp lcn2 mm01324470 m1
Monomeric form of Ent can disseminate into systemic circulation. Serum was collected from male germ-free (GF) rats and GF rats co-housed (GFC) with conventional mice for 10 d (8 weeks old, n = 5–6) at Taconic Facility. Serum metabolites were extracted using standard procedures for targeted metabolomics profiling. The extracted samples were analyzed using HPLC coupled to Agilent 6495 QQQ mass spectrometry (LC–MS). Ent was quantified as its monomeric form 2, 3-dihydroxy benzoic acid (2, 3-DHBA). The data were normalized with internal standards and log2-transformed on a per-sample basis. (A) Ent spectra (B) Fold change in serum 2, 3-DHBA. Note: Trace amounts of 2, 3-DHBA in GF animal sera are likely to be from dead bacteria in the diet. (C) Fecal <t>Lcn2.</t> Results are expressed as mean ± SEM. *** p < 0.001.
Gene Exp Lcn2 Mm01324470 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/us12569498-451-16--1?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
gene exp lcn2 mm01324470 m1 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

92
Taconic Biosciences lcn2
Monomeric form of Ent can disseminate into systemic circulation. Serum was collected from male germ-free (GF) rats and GF rats co-housed (GFC) with conventional mice for 10 d (8 weeks old, n = 5–6) at Taconic Facility. Serum metabolites were extracted using standard procedures for targeted metabolomics profiling. The extracted samples were analyzed using HPLC coupled to Agilent 6495 QQQ mass spectrometry (LC–MS). Ent was quantified as its monomeric form 2, 3-dihydroxy benzoic acid (2, 3-DHBA). The data were normalized with internal standards and log2-transformed on a per-sample basis. (A) Ent spectra (B) Fold change in serum 2, 3-DHBA. Note: Trace amounts of 2, 3-DHBA in GF animal sera are likely to be from dead bacteria in the diet. (C) Fecal <t>Lcn2.</t> Results are expressed as mean ± SEM. *** p < 0.001.
Lcn2, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/10__1128_slash_iai__00132___16-524-4-30?v=Taconic+Biosciences
Average 92 stars, based on 1 article reviews
lcn2 - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

95
Proteintech metal ab12228
( A ) UMAP of four subclusters of CFs in the Sham, CLP 12h, and CLP 24h groups with integrated transcriptomes. ( B ) Distribution of four subclusters of CFs with prolonged duration after sepsis UMAP. ( C ) Histogram of the proportion of four subclusters of CFs in each group. ( D ) mIHC staining images showing the expression and distribution of DAPI, Gsn, Fmo2, and <t>Lcn2</t> in CFs after sepsis; n = 8 per group. Scale bars, 25 μm. ( E ) Pseudotime trajectory analysis of Fmo2+ and Lcn2+ CF subclusters (right) with significant changes after sepsis and their changes with sepsis duration (left). ( F ) HALLMARK functional analysis heatmap of Lcn2+ and Fmo2+ CFs with significant changes after sepsis. ( G ) TEM images showing the morphology of CFs in mice of the Sham or sepsis groups; n = 8 per group. Scale bars, 2 μm. ( H ) ROS detection of Fmo2+ and Lcn2+ CFs; n = 3 per group. Scale bars, 50 μm. ( I ) Mitochondrial fatty acid metabolism capacity assay of Fmo2+ and Lcn2+ CFs after a Seahorse XF24 assay and flow cytometry; n = 3 per group. ( J ) GO enrichment analysis of Lcn2+ CFs after sepsis. ( K ) Top five TFs with the largest differences in expression estimated in the postsepsis Fmo2+ and Lcn2+ CFs. Fibro, fibroblasts.
Metal Ab12228, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pmc12978241-264-35-37?v=Proteintech
Average 95 stars, based on 1 article reviews
metal ab12228 - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

94
Aviva Systems lcn2
Transcriptome analysis of hypoxic response in MLO-Y4 cells. ( a ) Principal Component Analysis (PCA): Each point represents a sample (red: hypoxia, blue: control). ( b ) Heatmap: Rows represent genes, columns represent samples, and colors indicate normalized expression values (red: high expression, green: low expression). The heatmap was generated using iDEP (version 0.96; http://bioinformatics.sdstate.edu/idep96/ ). ( c ) KEGG pathway analysis: The top 30 statistically significant pathways are shown. The vertical axis represents KEGG pathways, while the horizontal axis represents statistical significance (Adjusted P-Value). Dot size indicates the number of associated genes, and color represents the direction of expression change (red: upregulated, blue: downregulated). KEGG pathway information is from the Kyoto Encyclopedia of Genes and Genomes and is used with permission from Kanehisa Laboratories – . ( d ) Volcano Plot: Each dot represents a gene. The horizontal axis represents the log 2 fold change, and the vertical axis represents statistical significance (− log 10 p-value). Red indicates significantly upregulated genes, while blue indicates significantly downregulated genes. (e-g) Gene Ontology (GO) Analysis: The top 30 statistically significant pathways are displayed. ( e ) Biological Process, ( f ) Molecular Function, and ( g ) Cellular Component. Dot size indicates the number of associated genes, and color represents the direction of expression change (red: upregulated, blue: downregulated). ( h – k ) Expression Changes of Specific Genes: Gene expression levels in MLO-Y4 cells under hypoxic conditions were measured using real-time RT-PCR and presented as box plots. ( l ) Western blot analysis of HIF-1α expression after HIF-1α siRNA knockdown in MLO-Y4 cells. ( m ) Quantification of HIF-1α protein levels normalized to β-actin. Band densities were measured using ImageJ software ( n = 3). ( n ) <t>LCN2</t> mRNA expression levels were evaluated by real-time RT-PCR in MLO-Y4 cells under control (normoxic), hypoxic, and hypoxia with HIF-1α knockdown conditions. Data are shown as mean ± standard deviation (SD). Statistical significance was set at * p < 0.05, ** p < 0.01.
Lcn2, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pmc12864796-279-21-22?v=Aviva+Systems
Average 94 stars, based on 1 article reviews
lcn2 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

rna  (OriGene)
91
OriGene rna
Figure <t>2:</t> <t>LCN2</t> is induced in AT of EAE, cancer- and sepsis-inducing cachectic mice. (A) Venn diagram including the up-regulated genes in choroid plexus, dura mater and spinal cord of EAE mice. (B, C) Lcn2 mRNA (B) and protein (C) expression. HSL was used as loading control. HSL was the same as shown in Figure 1F because it is part of the same western blot. (D, E) Tumor mass progression (D), % body weight loss (E) in mice during LLC post inoculation (n ¼ 17 PBS and n ¼ 11 LLC mice). (F) sWAT weight 21 days post inoculation (n ¼ 17 PBS and n ¼ 11 LLC mice). Representative immunofluorescence of Phalloidin (green), LCN2 (red), Dapi (blue) in sWAT of PBS and LLC mice 21 days post inoculation (n ¼ 5 PBS and n ¼ 4 LLC mice). Representative immunoblots of LCN2 in in sWAT of PBS and LLC mice 21 days post inoculation (n ¼ 5 PBS and n ¼ 4 LLC mice). VINCULIN was used as loading control. (H) Volcano plot and functional enrichment analysis for biological processes of up-regulated genes (Log2FC > 1.5; pAdj<0.05) in sWAT of EAE and LCC mice (n ¼ 5 mice/group). (H) Single cell <t>RNA-sequencing</t> (PRJNA626597) of visceral white adipose tissue isolated from mice 1 month after sepsis induction. (J) Fibroblast annotation for fibroblast adipocyte precursors (FAP: Podh, Col5a3) and adipose stem cells (ASC: Dpp4, Sema3c). (K) Lcn2 expression in fibroblast of control and sepsis mice. Data was reported as mean SD. Student’s T test *p < 0.05; **p < 0.01; ***p < 0.001 treated vs Ctrl.
Rna, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pm37517520-86-15-20?v=OriGene
Average 91 stars, based on 1 article reviews
rna - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

93
OriGene lcn2
Correlation between serum (a) IL‐31, (b) <t>LCN2</t> and (c) CCL2 levels and itching intensity in psoriasis patients. Each dot represents an individual patient sample ( n = 20). * p < 0.05; *** p < 0.001. CCL2, chemokine ligand 2; IL‐31, interleukin‐31; LCN2, <t>lipocalin‐2;</t> ns, not significant.
Lcn2, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pmc12272815-64-5-21?v=OriGene
Average 93 stars, based on 1 article reviews
lcn2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
Cyagen Biosciences lcn2 f f male mice
Atorvastatin inhibits macrophage/microglia <t>LCN2</t> expression after ICH and microglia LCN2 expression after BI injury. A The macrophage/microglia were sorted from mice hemorrhagic brain via flow cytometry, from which the protein was extracted before conducting western blot assay. B The quantification of each blot was calculated. For each group, n = 6. F(2,15) = 61.19, ***p < 0.0001 by one-way ANOVA. C Double-immunofluorescence staining of Iba-1 and LCN2 in peri-hematomal area of mice brain at day 3 after ICH and the quantifications were presented in D . For each group, n = 8. Data are displayed as median ± interquartile range. Z = 4.419, ***p < 0.0001 for Sham + Veh vs ICH + Veh and Z = 2.369, *p < 0.0357 for ICH + Veh vs ICH + ATo by non-parametric test(Kruskal–Wallis). E Double-immunofluorescence staining of Iba-1 and LCN2 in BV cell line at 24 h after BI injury and the quantifications were presented in F . For each group, n = 6. Data are displayed as median ± interquartile range. Z = 4.722, ***p < 0.0001 for Sham + Veh vs BI + Veh, Z = 1.180, p = 0.9512 for BI + Veh vs BI + 2.5 μM Ato, Z = 2.525, *p = 0.0463 for BI + Veh vs BI + 5 μM Ato and Z = 3.378, **p = 0.0029 for BI + Veh vs BI + 10 μM Ato by non-parametric test(Kruskal–Wallis). G ELISA assay results of LCN2 from supernatant of BV2 culture medium. n = 6. F(4,25) = 120.8, ***p < 0.0001 by one-way ANOVA. H qPCR analysis of relative mRNA levels of Lcn2 in BV2 cell lines. For each group, n = 6. F(4,25) = 39.68, ***p < 0.0001 by one-way ANOVA
Lcn2 F F Male Mice, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pmc12092887-22-33-42?v=Cyagen+Biosciences
Average 94 stars, based on 1 article reviews
lcn2 f f male mice - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
OriGene human lcn2 knockout kit
Figure 1. <t>LCN2</t> and other tumorigenic markers in human prostate cancer cell lines. The human prostate cancer cell lines LNCaP and PC-3 were analyzed for mRNA or protein expression after culturing under basal conditions. (A) Quantitative mRNA analysis of NFKBIZ, GJA1, IL1B, LCN2, and CXCL8 in both cell lines revealed significantly higher expression levels in PC-3 cells (n = 4). Relative mRNA expressions were normalized to ACTB expression and values are given in relation to LNCaP cells. Significant differences between LNCaP and PC-3 cells are indicated as *** p < 0.001. (B) Western blot analysis confirmed lower protein expression of these markers in LNCaP cells (n ≥3). β-actin and α-tubulin expression served as internal loading controls.
Human Lcn2 Knockout Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pm35053376-62-3-7?v=OriGene
Average 90 stars, based on 1 article reviews
human lcn2 knockout kit - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

88
Thermo Fisher gene exp lcn2 hs01008571 m1
Figure 1. <t>LCN2</t> and other tumorigenic markers in human prostate cancer cell lines. The human prostate cancer cell lines LNCaP and PC-3 were analyzed for mRNA or protein expression after culturing under basal conditions. (A) Quantitative mRNA analysis of NFKBIZ, GJA1, IL1B, LCN2, and CXCL8 in both cell lines revealed significantly higher expression levels in PC-3 cells (n = 4). Relative mRNA expressions were normalized to ACTB expression and values are given in relation to LNCaP cells. Significant differences between LNCaP and PC-3 cells are indicated as *** p < 0.001. (B) Western blot analysis confirmed lower protein expression of these markers in LNCaP cells (n ≥3). β-actin and α-tubulin expression served as internal loading controls.
Gene Exp Lcn2 Hs01008571 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pm41933388-85-14-15?v=Thermo+Fisher
Average 88 stars, based on 1 article reviews
gene exp lcn2 hs01008571 m1 - by Bioz Stars, 2026-08
88/100 stars
  Buy from Supplier

91
OriGene sr405112
KEY RESOURCES TABLE
Sr405112, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pmc06415305-107-9-5?v=OriGene
Average 91 stars, based on 1 article reviews
sr405112 - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

93
OriGene human ngal elisa kit
KEY RESOURCES TABLE
Human Ngal Elisa Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lcn2/pmc12272815-64-23-21?v=OriGene
Average 93 stars, based on 1 article reviews
human ngal elisa kit - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


Monomeric form of Ent can disseminate into systemic circulation. Serum was collected from male germ-free (GF) rats and GF rats co-housed (GFC) with conventional mice for 10 d (8 weeks old, n = 5–6) at Taconic Facility. Serum metabolites were extracted using standard procedures for targeted metabolomics profiling. The extracted samples were analyzed using HPLC coupled to Agilent 6495 QQQ mass spectrometry (LC–MS). Ent was quantified as its monomeric form 2, 3-dihydroxy benzoic acid (2, 3-DHBA). The data were normalized with internal standards and log2-transformed on a per-sample basis. (A) Ent spectra (B) Fold change in serum 2, 3-DHBA. Note: Trace amounts of 2, 3-DHBA in GF animal sera are likely to be from dead bacteria in the diet. (C) Fecal Lcn2. Results are expressed as mean ± SEM. *** p < 0.001.

Journal: Gut Microbes

Article Title: Microbial metabolite Enterobactin impairs mitochondrial respiration and alleviates colitis

doi: 10.1080/19490976.2026.2662638

Figure Lengend Snippet: Monomeric form of Ent can disseminate into systemic circulation. Serum was collected from male germ-free (GF) rats and GF rats co-housed (GFC) with conventional mice for 10 d (8 weeks old, n = 5–6) at Taconic Facility. Serum metabolites were extracted using standard procedures for targeted metabolomics profiling. The extracted samples were analyzed using HPLC coupled to Agilent 6495 QQQ mass spectrometry (LC–MS). Ent was quantified as its monomeric form 2, 3-dihydroxy benzoic acid (2, 3-DHBA). The data were normalized with internal standards and log2-transformed on a per-sample basis. (A) Ent spectra (B) Fold change in serum 2, 3-DHBA. Note: Trace amounts of 2, 3-DHBA in GF animal sera are likely to be from dead bacteria in the diet. (C) Fecal Lcn2. Results are expressed as mean ± SEM. *** p < 0.001.

Article Snippet: Mouse recombinant Lcn2 was purchased from Sino Biological Inc. (50060-MNAH).

Techniques: Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy, Transformation Assay, Bacteria

Ent exacerbates mitochondrial dysfunction in Lcn2 −/− BMDMs and is rescued by rec-Lcn2. BMDMs were isolated from wild-type (WT) and Lcn2-deficient (Lcn2 −/− ) mice to assess mitochondrial function using a Seahorse XF Analyzer. (A and B) Oxygen consumption rate (OCR) was measured (C) BMDMs were treated with Ent alone or in combination with ferric iron (1:1 ratio) for 24 h to assess the impact on mitochondrial respiration. (D) Quantification of key mitochondrial parameters revealed that Ent treatment significantly reduced basal respiration, ATP production, maximal respiration, proton leak, and spare respiratory capacity in Lcn2KO BMDMs (E) Mito-respiration was measured with Ent, rec-Lcn2 or both. (F) Cotreatment with rec-Lcn2 on basal respiration, maximal respiration, ATP production, and spare respiratory capacity indicating OCR. (G) Iron-chelating activity was assessed in the supernatants using the chrome azurol S (CAS) liquid assay. Control reactions included Ent alone, and rec-Lcn2 alone. (H) Mitochondrial reactive oxygen species (ROS) were measured using MitoSOX™ Red staining followed by flow cytometry analysis. Data represent mean ± SEM. Statistical significance was determined using unpaired Student’s t -test or one-way ANOVA where appropriate (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).

Journal: Gut Microbes

Article Title: Microbial metabolite Enterobactin impairs mitochondrial respiration and alleviates colitis

doi: 10.1080/19490976.2026.2662638

Figure Lengend Snippet: Ent exacerbates mitochondrial dysfunction in Lcn2 −/− BMDMs and is rescued by rec-Lcn2. BMDMs were isolated from wild-type (WT) and Lcn2-deficient (Lcn2 −/− ) mice to assess mitochondrial function using a Seahorse XF Analyzer. (A and B) Oxygen consumption rate (OCR) was measured (C) BMDMs were treated with Ent alone or in combination with ferric iron (1:1 ratio) for 24 h to assess the impact on mitochondrial respiration. (D) Quantification of key mitochondrial parameters revealed that Ent treatment significantly reduced basal respiration, ATP production, maximal respiration, proton leak, and spare respiratory capacity in Lcn2KO BMDMs (E) Mito-respiration was measured with Ent, rec-Lcn2 or both. (F) Cotreatment with rec-Lcn2 on basal respiration, maximal respiration, ATP production, and spare respiratory capacity indicating OCR. (G) Iron-chelating activity was assessed in the supernatants using the chrome azurol S (CAS) liquid assay. Control reactions included Ent alone, and rec-Lcn2 alone. (H) Mitochondrial reactive oxygen species (ROS) were measured using MitoSOX™ Red staining followed by flow cytometry analysis. Data represent mean ± SEM. Statistical significance was determined using unpaired Student’s t -test or one-way ANOVA where appropriate (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001).

Article Snippet: Mouse recombinant Lcn2 was purchased from Sino Biological Inc. (50060-MNAH).

Techniques: Isolation, Activity Assay, Control, Staining, Flow Cytometry

Ent impairs mitochondrial respiration in model intestinal epithelia. Caco-2, intestinal epithelial cells (IEC), were treated with iron-free Ent (25 μM) or iron-bound Ent-Fe³⁺ (25 μM; 1:1 ratio) or Fe +3 alone and assessed mitochondrial function. (A) Mitochondrial respiration was evaluated using the Seahorse XF Analyzer by measuring oxygen consumption rate (OCR). (B) Basal and maximal respiration, ATP-linked respiration, proton leak and spare respiratory capacity (C) Mito-respiration was measured with Ent, rec-Lcn2, or both. (D) IEC were treated with 25 µM Ent for 24 h and total cellular proteins were analyzed by immunoblotting using antibodies against key subunits of the mitochondrial oxidative phosphorylation (OXPHOS) complexes I–V of electron transport chain. Densitometry scanning of complex II (E) Immunoblots of Hif1α, p -AMPK, total AMPK, and loading control β-actin (F and G) IEC were treated with 25 µM enterobactin for 24 h, and mitochondrial ROS levels were assessed using MitoSOX™ Red dye followed by flow cytometry analysis. Data represent mean ± SEM from at least three independent experiments. Statistical significance was determined using one-way ANOVA where appropriate (* p < 0.05 and ** p < 0.01).

Journal: Gut Microbes

Article Title: Microbial metabolite Enterobactin impairs mitochondrial respiration and alleviates colitis

doi: 10.1080/19490976.2026.2662638

Figure Lengend Snippet: Ent impairs mitochondrial respiration in model intestinal epithelia. Caco-2, intestinal epithelial cells (IEC), were treated with iron-free Ent (25 μM) or iron-bound Ent-Fe³⁺ (25 μM; 1:1 ratio) or Fe +3 alone and assessed mitochondrial function. (A) Mitochondrial respiration was evaluated using the Seahorse XF Analyzer by measuring oxygen consumption rate (OCR). (B) Basal and maximal respiration, ATP-linked respiration, proton leak and spare respiratory capacity (C) Mito-respiration was measured with Ent, rec-Lcn2, or both. (D) IEC were treated with 25 µM Ent for 24 h and total cellular proteins were analyzed by immunoblotting using antibodies against key subunits of the mitochondrial oxidative phosphorylation (OXPHOS) complexes I–V of electron transport chain. Densitometry scanning of complex II (E) Immunoblots of Hif1α, p -AMPK, total AMPK, and loading control β-actin (F and G) IEC were treated with 25 µM enterobactin for 24 h, and mitochondrial ROS levels were assessed using MitoSOX™ Red dye followed by flow cytometry analysis. Data represent mean ± SEM from at least three independent experiments. Statistical significance was determined using one-way ANOVA where appropriate (* p < 0.05 and ** p < 0.01).

Article Snippet: Mouse recombinant Lcn2 was purchased from Sino Biological Inc. (50060-MNAH).

Techniques: Western Blot, Phospho-proteomics, Control, Flow Cytometry

Therapeutic oral administration of 2, 3-DHBA is effective in protecting against DSS-induced pathology than 2, 5-DHBA. Eight-weeks-old male C57BL/6J mice (WT, n = 3–5) were administered with 2% DSS in drinking water for 7 d, confirmed that mice were rectally bleeding. DSS water was replaced with regular water. Control mice were given regular water. After the cessation of DSS (i.e., during recovery phase), mice were administered with either 2, 3-dihydroxybenzoic acid (2, 3-DHBA) or 2, 5-dihydroxybenzoic acid (2, 5-DHBA: 500 µg/mouse, orally) or PBS for 7 d. Feces and blood were collected for the isolation of hemolysis-free serum. Intestinal barrier function was assessed via FITC-dextran administered 4 h before euthanasia. (A) Schematic representation of the experiment (B) Percent body weight loss/gain; (C) Gross colon images (D) Colon length (E) % Spleen weight (F) % Cecum weight (G) Serum fluorescence (H) Serum Lcn2 (I) Fecal Lcn2 (J) Serum KC (K) Colonic MPO. Data are presented as mean ± SEM from at least three independent experiments or biological replicates. Statistical comparisons were performed using one-way ANOVA with Tukey’s post hoc test (* p < 0.05, ** p < 0.01, and *** p < 0.001).

Journal: Gut Microbes

Article Title: Microbial metabolite Enterobactin impairs mitochondrial respiration and alleviates colitis

doi: 10.1080/19490976.2026.2662638

Figure Lengend Snippet: Therapeutic oral administration of 2, 3-DHBA is effective in protecting against DSS-induced pathology than 2, 5-DHBA. Eight-weeks-old male C57BL/6J mice (WT, n = 3–5) were administered with 2% DSS in drinking water for 7 d, confirmed that mice were rectally bleeding. DSS water was replaced with regular water. Control mice were given regular water. After the cessation of DSS (i.e., during recovery phase), mice were administered with either 2, 3-dihydroxybenzoic acid (2, 3-DHBA) or 2, 5-dihydroxybenzoic acid (2, 5-DHBA: 500 µg/mouse, orally) or PBS for 7 d. Feces and blood were collected for the isolation of hemolysis-free serum. Intestinal barrier function was assessed via FITC-dextran administered 4 h before euthanasia. (A) Schematic representation of the experiment (B) Percent body weight loss/gain; (C) Gross colon images (D) Colon length (E) % Spleen weight (F) % Cecum weight (G) Serum fluorescence (H) Serum Lcn2 (I) Fecal Lcn2 (J) Serum KC (K) Colonic MPO. Data are presented as mean ± SEM from at least three independent experiments or biological replicates. Statistical comparisons were performed using one-way ANOVA with Tukey’s post hoc test (* p < 0.05, ** p < 0.01, and *** p < 0.001).

Article Snippet: Mouse recombinant Lcn2 was purchased from Sino Biological Inc. (50060-MNAH).

Techniques: Control, Isolation, Fluorescence

( A ) UMAP of four subclusters of CFs in the Sham, CLP 12h, and CLP 24h groups with integrated transcriptomes. ( B ) Distribution of four subclusters of CFs with prolonged duration after sepsis UMAP. ( C ) Histogram of the proportion of four subclusters of CFs in each group. ( D ) mIHC staining images showing the expression and distribution of DAPI, Gsn, Fmo2, and Lcn2 in CFs after sepsis; n = 8 per group. Scale bars, 25 μm. ( E ) Pseudotime trajectory analysis of Fmo2+ and Lcn2+ CF subclusters (right) with significant changes after sepsis and their changes with sepsis duration (left). ( F ) HALLMARK functional analysis heatmap of Lcn2+ and Fmo2+ CFs with significant changes after sepsis. ( G ) TEM images showing the morphology of CFs in mice of the Sham or sepsis groups; n = 8 per group. Scale bars, 2 μm. ( H ) ROS detection of Fmo2+ and Lcn2+ CFs; n = 3 per group. Scale bars, 50 μm. ( I ) Mitochondrial fatty acid metabolism capacity assay of Fmo2+ and Lcn2+ CFs after a Seahorse XF24 assay and flow cytometry; n = 3 per group. ( J ) GO enrichment analysis of Lcn2+ CFs after sepsis. ( K ) Top five TFs with the largest differences in expression estimated in the postsepsis Fmo2+ and Lcn2+ CFs. Fibro, fibroblasts.

Journal: Science Advances

Article Title: Cytoskeletal remodeling promotes tunneling nanotube formation and drives cardiac resident cell mitochondrial transfer in sepsis

doi: 10.1126/sciadv.adz3266

Figure Lengend Snippet: ( A ) UMAP of four subclusters of CFs in the Sham, CLP 12h, and CLP 24h groups with integrated transcriptomes. ( B ) Distribution of four subclusters of CFs with prolonged duration after sepsis UMAP. ( C ) Histogram of the proportion of four subclusters of CFs in each group. ( D ) mIHC staining images showing the expression and distribution of DAPI, Gsn, Fmo2, and Lcn2 in CFs after sepsis; n = 8 per group. Scale bars, 25 μm. ( E ) Pseudotime trajectory analysis of Fmo2+ and Lcn2+ CF subclusters (right) with significant changes after sepsis and their changes with sepsis duration (left). ( F ) HALLMARK functional analysis heatmap of Lcn2+ and Fmo2+ CFs with significant changes after sepsis. ( G ) TEM images showing the morphology of CFs in mice of the Sham or sepsis groups; n = 8 per group. Scale bars, 2 μm. ( H ) ROS detection of Fmo2+ and Lcn2+ CFs; n = 3 per group. Scale bars, 50 μm. ( I ) Mitochondrial fatty acid metabolism capacity assay of Fmo2+ and Lcn2+ CFs after a Seahorse XF24 assay and flow cytometry; n = 3 per group. ( J ) GO enrichment analysis of Lcn2+ CFs after sepsis. ( K ) Top five TFs with the largest differences in expression estimated in the postsepsis Fmo2+ and Lcn2+ CFs. Fibro, fibroblasts.

Article Snippet: After blocking with goat serum, sections were incubated overnight at 4°C with primary antibodies [Cldn5 (1:200; Cell Signaling, #66879), Metal (:200; Abcam, ab12228), Cxcl2 (1:200; Abcam, ab317569), Gsn (1:200; Proteintech, 11644-2-AP), Fmo2 (1:200; Proteintech, 67019-1-Ig), Lcn2 (1:200; Proteintech, 26991-1-AP), CD74 (1:200; Abcam, ab289885), troponin (1:200; Abcam, ab209813), CD31 (1:200; Abcam, ab182981), PDGFR (1:200; Abcam, ab203491), CD68 (1:200; Abcam, ab283654), and actin (1:200; Abcam, ab8227)].

Techniques: Staining, Expressing, Functional Assay, Flow Cytometry

( A ) UMAP of four subclusters of cardiac monocytes-macrophages in the Sham, CLP 12h, and CLP 24h group integrated transcriptomes. ( B ) UMAP distribution of four subclusters of cardiac monocytes-macrophages with the duration of sepsis. ( C ) Histogram of the proportion of four subclusters of cardiac monocytes-macrophages in each group. ( D ) mIHC staining images showing the expression and distribution of DAPI, CD74, Metal, and Ccr2 in cardiac monocytes-macrophages after sepsis; n = 8 per group. Scale bars, 25 μm. ( E ) Pseudotime trajectory of the occurrence and development of Ccr2+, Metal+, and Hpgd+ cardiac macrophage subclusters under normal conditions (left); pseudotime trajectory of the occurrence and development of cardiac macrophages with the prolongation of sepsis duration (right); and pseudotime trajectory of Ccr2+, Metal+, and Hpgd+ cardiac macrophage subclusters with the duration of sepsis (bottom). ( F ) HALLMARK functional analysis heatmap of Hpgd+, Metal+, and Ccr2+ cardiac macrophages with significant changes after sepsis. ( G ) Mitochondrial respiration assay of Hpgd+, Metal+, and Ccr2+ cardiac macrophages; n = 3 per group. ( H ) TEM images showing the morphology of cardiac macrophages in mice of the Sham or sepsis group; n = 8 per group. Scale bars, 2 μm. ( I ) ROS detection of Hpgd+, Metal+, and Ccr2+ cardiac macrophages; n = 3 per group. Scale bars, 50 μm. ( J ) GO enrichment analysis of Metal+ and Ccr2+ cardiac macrophages after sepsis. ( K ) Top five TFs with the largest differences in expression estimated in the postsepsis Hpgd+ and Metal+ cardiac macrophages and Lcn2+ cardiac monocytes. Macro, macrophages; Mono, monocytes.

Journal: Science Advances

Article Title: Cytoskeletal remodeling promotes tunneling nanotube formation and drives cardiac resident cell mitochondrial transfer in sepsis

doi: 10.1126/sciadv.adz3266

Figure Lengend Snippet: ( A ) UMAP of four subclusters of cardiac monocytes-macrophages in the Sham, CLP 12h, and CLP 24h group integrated transcriptomes. ( B ) UMAP distribution of four subclusters of cardiac monocytes-macrophages with the duration of sepsis. ( C ) Histogram of the proportion of four subclusters of cardiac monocytes-macrophages in each group. ( D ) mIHC staining images showing the expression and distribution of DAPI, CD74, Metal, and Ccr2 in cardiac monocytes-macrophages after sepsis; n = 8 per group. Scale bars, 25 μm. ( E ) Pseudotime trajectory of the occurrence and development of Ccr2+, Metal+, and Hpgd+ cardiac macrophage subclusters under normal conditions (left); pseudotime trajectory of the occurrence and development of cardiac macrophages with the prolongation of sepsis duration (right); and pseudotime trajectory of Ccr2+, Metal+, and Hpgd+ cardiac macrophage subclusters with the duration of sepsis (bottom). ( F ) HALLMARK functional analysis heatmap of Hpgd+, Metal+, and Ccr2+ cardiac macrophages with significant changes after sepsis. ( G ) Mitochondrial respiration assay of Hpgd+, Metal+, and Ccr2+ cardiac macrophages; n = 3 per group. ( H ) TEM images showing the morphology of cardiac macrophages in mice of the Sham or sepsis group; n = 8 per group. Scale bars, 2 μm. ( I ) ROS detection of Hpgd+, Metal+, and Ccr2+ cardiac macrophages; n = 3 per group. Scale bars, 50 μm. ( J ) GO enrichment analysis of Metal+ and Ccr2+ cardiac macrophages after sepsis. ( K ) Top five TFs with the largest differences in expression estimated in the postsepsis Hpgd+ and Metal+ cardiac macrophages and Lcn2+ cardiac monocytes. Macro, macrophages; Mono, monocytes.

Article Snippet: After blocking with goat serum, sections were incubated overnight at 4°C with primary antibodies [Cldn5 (1:200; Cell Signaling, #66879), Metal (:200; Abcam, ab12228), Cxcl2 (1:200; Abcam, ab317569), Gsn (1:200; Proteintech, 11644-2-AP), Fmo2 (1:200; Proteintech, 67019-1-Ig), Lcn2 (1:200; Proteintech, 26991-1-AP), CD74 (1:200; Abcam, ab289885), troponin (1:200; Abcam, ab209813), CD31 (1:200; Abcam, ab182981), PDGFR (1:200; Abcam, ab203491), CD68 (1:200; Abcam, ab283654), and actin (1:200; Abcam, ab8227)].

Techniques: Staining, Expressing, Functional Assay, Respiration Assay

( A ) TEM images showing the morphology of cardiomyocytes, endothelial cells, fibroblasts, and macrophages in mouse heart tissue from the Drp1 WT-CLP and Drp1 eCKO-CLP mice; n = 8 per group. Scale bars, 2 μm. ( B ) ROS detection in primary endothelial cells, fibroblasts, and macrophages from the Drp1 WT-CLP and Drp1 eCKO-CLP mice after treated with LPS; n = 3 per group. Scale bars, 50 μm. ( C ) scRNA-seq analysis of Cxcl2+ endothelial cells, Metal+ endothelial cells, Lcn2+ fibroblasts, and Metal+ macrophages in Drp1 WT-CLP and Drp1 eCKO-CLP mice with cell distribution density, UMAP, and violin plots. ( D ) GO enrichment analysis of endothelial cells, fibroblasts, and macrophages after sepsis. ( E ) Mitochondrial respiration capacity assays and basal and maximal respiratory profiling of primary endothelial cells, fibroblasts, and macrophages from Drp1 WT-CLP and Drp1 eCKO-CLP mice; n = 8 per group. ( F ) Representative images of O 2 concentration changes and O 2 flux per mass and bar graphs from Drp1 WT-CLP and Drp1 eCKO-CLP mice. Oxygen consumption capacity measured by high-resolution respirometry in complexes I and II, including CI leak, CI OXPHOS, CI + CII OXPHOS, CI + CII ET, CII ET, and CIV OXPHOS; n = 8 per group. ( G ) Ultrasound and endocardial/epicardial strain coefficients from Drp1 WT-CLP and Drp1 eCKO-CLP mice; n = 8 per group. ET, electron transfer system.

Journal: Science Advances

Article Title: Cytoskeletal remodeling promotes tunneling nanotube formation and drives cardiac resident cell mitochondrial transfer in sepsis

doi: 10.1126/sciadv.adz3266

Figure Lengend Snippet: ( A ) TEM images showing the morphology of cardiomyocytes, endothelial cells, fibroblasts, and macrophages in mouse heart tissue from the Drp1 WT-CLP and Drp1 eCKO-CLP mice; n = 8 per group. Scale bars, 2 μm. ( B ) ROS detection in primary endothelial cells, fibroblasts, and macrophages from the Drp1 WT-CLP and Drp1 eCKO-CLP mice after treated with LPS; n = 3 per group. Scale bars, 50 μm. ( C ) scRNA-seq analysis of Cxcl2+ endothelial cells, Metal+ endothelial cells, Lcn2+ fibroblasts, and Metal+ macrophages in Drp1 WT-CLP and Drp1 eCKO-CLP mice with cell distribution density, UMAP, and violin plots. ( D ) GO enrichment analysis of endothelial cells, fibroblasts, and macrophages after sepsis. ( E ) Mitochondrial respiration capacity assays and basal and maximal respiratory profiling of primary endothelial cells, fibroblasts, and macrophages from Drp1 WT-CLP and Drp1 eCKO-CLP mice; n = 8 per group. ( F ) Representative images of O 2 concentration changes and O 2 flux per mass and bar graphs from Drp1 WT-CLP and Drp1 eCKO-CLP mice. Oxygen consumption capacity measured by high-resolution respirometry in complexes I and II, including CI leak, CI OXPHOS, CI + CII OXPHOS, CI + CII ET, CII ET, and CIV OXPHOS; n = 8 per group. ( G ) Ultrasound and endocardial/epicardial strain coefficients from Drp1 WT-CLP and Drp1 eCKO-CLP mice; n = 8 per group. ET, electron transfer system.

Article Snippet: After blocking with goat serum, sections were incubated overnight at 4°C with primary antibodies [Cldn5 (1:200; Cell Signaling, #66879), Metal (:200; Abcam, ab12228), Cxcl2 (1:200; Abcam, ab317569), Gsn (1:200; Proteintech, 11644-2-AP), Fmo2 (1:200; Proteintech, 67019-1-Ig), Lcn2 (1:200; Proteintech, 26991-1-AP), CD74 (1:200; Abcam, ab289885), troponin (1:200; Abcam, ab209813), CD31 (1:200; Abcam, ab182981), PDGFR (1:200; Abcam, ab203491), CD68 (1:200; Abcam, ab283654), and actin (1:200; Abcam, ab8227)].

Techniques: Concentration Assay

Transcriptome analysis of hypoxic response in MLO-Y4 cells. ( a ) Principal Component Analysis (PCA): Each point represents a sample (red: hypoxia, blue: control). ( b ) Heatmap: Rows represent genes, columns represent samples, and colors indicate normalized expression values (red: high expression, green: low expression). The heatmap was generated using iDEP (version 0.96; http://bioinformatics.sdstate.edu/idep96/ ). ( c ) KEGG pathway analysis: The top 30 statistically significant pathways are shown. The vertical axis represents KEGG pathways, while the horizontal axis represents statistical significance (Adjusted P-Value). Dot size indicates the number of associated genes, and color represents the direction of expression change (red: upregulated, blue: downregulated). KEGG pathway information is from the Kyoto Encyclopedia of Genes and Genomes and is used with permission from Kanehisa Laboratories – . ( d ) Volcano Plot: Each dot represents a gene. The horizontal axis represents the log 2 fold change, and the vertical axis represents statistical significance (− log 10 p-value). Red indicates significantly upregulated genes, while blue indicates significantly downregulated genes. (e-g) Gene Ontology (GO) Analysis: The top 30 statistically significant pathways are displayed. ( e ) Biological Process, ( f ) Molecular Function, and ( g ) Cellular Component. Dot size indicates the number of associated genes, and color represents the direction of expression change (red: upregulated, blue: downregulated). ( h – k ) Expression Changes of Specific Genes: Gene expression levels in MLO-Y4 cells under hypoxic conditions were measured using real-time RT-PCR and presented as box plots. ( l ) Western blot analysis of HIF-1α expression after HIF-1α siRNA knockdown in MLO-Y4 cells. ( m ) Quantification of HIF-1α protein levels normalized to β-actin. Band densities were measured using ImageJ software ( n = 3). ( n ) LCN2 mRNA expression levels were evaluated by real-time RT-PCR in MLO-Y4 cells under control (normoxic), hypoxic, and hypoxia with HIF-1α knockdown conditions. Data are shown as mean ± standard deviation (SD). Statistical significance was set at * p < 0.05, ** p < 0.01.

Journal: Scientific Reports

Article Title: Lipocalin-2 upregulation in hypoxic murine osteocytes enhances RANKL-induced osteoclastogenesis

doi: 10.1038/s41598-025-34575-2

Figure Lengend Snippet: Transcriptome analysis of hypoxic response in MLO-Y4 cells. ( a ) Principal Component Analysis (PCA): Each point represents a sample (red: hypoxia, blue: control). ( b ) Heatmap: Rows represent genes, columns represent samples, and colors indicate normalized expression values (red: high expression, green: low expression). The heatmap was generated using iDEP (version 0.96; http://bioinformatics.sdstate.edu/idep96/ ). ( c ) KEGG pathway analysis: The top 30 statistically significant pathways are shown. The vertical axis represents KEGG pathways, while the horizontal axis represents statistical significance (Adjusted P-Value). Dot size indicates the number of associated genes, and color represents the direction of expression change (red: upregulated, blue: downregulated). KEGG pathway information is from the Kyoto Encyclopedia of Genes and Genomes and is used with permission from Kanehisa Laboratories – . ( d ) Volcano Plot: Each dot represents a gene. The horizontal axis represents the log 2 fold change, and the vertical axis represents statistical significance (− log 10 p-value). Red indicates significantly upregulated genes, while blue indicates significantly downregulated genes. (e-g) Gene Ontology (GO) Analysis: The top 30 statistically significant pathways are displayed. ( e ) Biological Process, ( f ) Molecular Function, and ( g ) Cellular Component. Dot size indicates the number of associated genes, and color represents the direction of expression change (red: upregulated, blue: downregulated). ( h – k ) Expression Changes of Specific Genes: Gene expression levels in MLO-Y4 cells under hypoxic conditions were measured using real-time RT-PCR and presented as box plots. ( l ) Western blot analysis of HIF-1α expression after HIF-1α siRNA knockdown in MLO-Y4 cells. ( m ) Quantification of HIF-1α protein levels normalized to β-actin. Band densities were measured using ImageJ software ( n = 3). ( n ) LCN2 mRNA expression levels were evaluated by real-time RT-PCR in MLO-Y4 cells under control (normoxic), hypoxic, and hypoxia with HIF-1α knockdown conditions. Data are shown as mean ± standard deviation (SD). Statistical significance was set at * p < 0.05, ** p < 0.01.

Article Snippet: The following polyclonal antibodies were used: SLC22A17 (Abonova, Taipei, Taiwan), megalin (Bioss, Woburn, MA, USA), HIF1-α (GeneTex, Irvine, CA, USA), and LCN2 (Aviva Systems Biology, San Diego, CA, USA).

Techniques: Control, Expressing, Generated, Gene Expression, Quantitative RT-PCR, Western Blot, Knockdown, Software, Standard Deviation

Real-time RT-PCR analysis of primary osteocytes under hypoxia. ( a ) Number of Topaz-positive cells isolated using fluorescence-activated cell sorting (FACS): The number of Topaz-positive cells isolated using FACS is shown. ( b ) Morphology of isolated Topaz-positive cells: The morphology of isolated Topaz-positive cells is shown. Scale bar: 100 μm. ( c – f ) Gene expression analysis using real-time RT-PCR. Expression levels of (c) Lcn2 , ( d ) Rankl , ( e ) Opg , and ( f ) Rankl/Opg ratio in primary osteocytes under hypoxia and control conditions. Data are presented as mean ± SD. Statistical significance was set at * p < 0.05, ** p < 0.01.

Journal: Scientific Reports

Article Title: Lipocalin-2 upregulation in hypoxic murine osteocytes enhances RANKL-induced osteoclastogenesis

doi: 10.1038/s41598-025-34575-2

Figure Lengend Snippet: Real-time RT-PCR analysis of primary osteocytes under hypoxia. ( a ) Number of Topaz-positive cells isolated using fluorescence-activated cell sorting (FACS): The number of Topaz-positive cells isolated using FACS is shown. ( b ) Morphology of isolated Topaz-positive cells: The morphology of isolated Topaz-positive cells is shown. Scale bar: 100 μm. ( c – f ) Gene expression analysis using real-time RT-PCR. Expression levels of (c) Lcn2 , ( d ) Rankl , ( e ) Opg , and ( f ) Rankl/Opg ratio in primary osteocytes under hypoxia and control conditions. Data are presented as mean ± SD. Statistical significance was set at * p < 0.05, ** p < 0.01.

Article Snippet: The following polyclonal antibodies were used: SLC22A17 (Abonova, Taipei, Taiwan), megalin (Bioss, Woburn, MA, USA), HIF1-α (GeneTex, Irvine, CA, USA), and LCN2 (Aviva Systems Biology, San Diego, CA, USA).

Techniques: Quantitative RT-PCR, Isolation, Fluorescence, FACS, Gene Expression, Expressing, Control

Expression of LCN2 receptors and real-time RT-PCR analysis of LCN2 treatment in MLO-Y4 cells. (a) Immunofluorescence staining of LCN2 receptors in MLO-Y4 cells. Expression of LCN2 receptors, Megalin and 24p3R, was analyzed using immunofluorescence staining. Nuclei were stained with DAPI. Scale bar: 100 μm. (b–d) Gene expression analysis after 1 day of LCN2 treatment. MLO-Y4 cells were cultured with rmLCN2 protein for 1 day, and gene expression levels of (b) Rankl , (c) Opg , and (d) Rankl/Opg ratio were analyzed using real-time RT-PCR. (e–g) Gene expression analysis after 3 days of LCN2 treatment. MLO-Y4 cells were cultured with rmLCN2 protein for 3 days, and gene expression levels of (e) Rankl , (f) Opg , and (g) Rankl/Opg ratio were analyzed using real-time RT-PCR. (h) Gene expression level of Lrp2 (Megalin) in MLO-Y4 cells after siRNA-mediated knockdown. (i) Gene expression level of Lrp2 in MLO-Y4 cells transfected with negative control (NC) siRNA. (j) Gene expression level of Slc22a17 (24p3R) in MLO-Y4 cells after siRNA-mediated knockdown. (k) Gene expression level of Slc22a17 after NC siRNA transfection. (l) Expression of Rankl was evaluated by real-time RT-PCR after rmLCN2 treatment in MLO-Y4 cells with knockdown of Megalin or 24p3R. Data are presented as mean ± SD ( n = 4). Statistical significance was set at * p < 0.05. ** p < 0.01.

Journal: Scientific Reports

Article Title: Lipocalin-2 upregulation in hypoxic murine osteocytes enhances RANKL-induced osteoclastogenesis

doi: 10.1038/s41598-025-34575-2

Figure Lengend Snippet: Expression of LCN2 receptors and real-time RT-PCR analysis of LCN2 treatment in MLO-Y4 cells. (a) Immunofluorescence staining of LCN2 receptors in MLO-Y4 cells. Expression of LCN2 receptors, Megalin and 24p3R, was analyzed using immunofluorescence staining. Nuclei were stained with DAPI. Scale bar: 100 μm. (b–d) Gene expression analysis after 1 day of LCN2 treatment. MLO-Y4 cells were cultured with rmLCN2 protein for 1 day, and gene expression levels of (b) Rankl , (c) Opg , and (d) Rankl/Opg ratio were analyzed using real-time RT-PCR. (e–g) Gene expression analysis after 3 days of LCN2 treatment. MLO-Y4 cells were cultured with rmLCN2 protein for 3 days, and gene expression levels of (e) Rankl , (f) Opg , and (g) Rankl/Opg ratio were analyzed using real-time RT-PCR. (h) Gene expression level of Lrp2 (Megalin) in MLO-Y4 cells after siRNA-mediated knockdown. (i) Gene expression level of Lrp2 in MLO-Y4 cells transfected with negative control (NC) siRNA. (j) Gene expression level of Slc22a17 (24p3R) in MLO-Y4 cells after siRNA-mediated knockdown. (k) Gene expression level of Slc22a17 after NC siRNA transfection. (l) Expression of Rankl was evaluated by real-time RT-PCR after rmLCN2 treatment in MLO-Y4 cells with knockdown of Megalin or 24p3R. Data are presented as mean ± SD ( n = 4). Statistical significance was set at * p < 0.05. ** p < 0.01.

Article Snippet: The following polyclonal antibodies were used: SLC22A17 (Abonova, Taipei, Taiwan), megalin (Bioss, Woburn, MA, USA), HIF1-α (GeneTex, Irvine, CA, USA), and LCN2 (Aviva Systems Biology, San Diego, CA, USA).

Techniques: Expressing, Quantitative RT-PCR, Immunofluorescence, Staining, Gene Expression, Cell Culture, Knockdown, Transfection, Negative Control

LCN2 enhanced osteoclastogenesis via MLO-Y4 cells. ( a ) Microscopic images of osteoclasts. Osteoclast precursors were cultured under the following conditions: macrophage colony-stimulating factor (M-CSF), M-CSF (100 ng/mL) + receptor activator of nuclear factor-κB ligand (RANKL) (100 ng/mL), M-CSF + RANKL + rmLCN2 (100 ng/mL), or M-CSF + rmLCN2. Representative TRAP-stained images of osteoclasts under each condition are shown. Scale bar = 100 μm. ( b ) Quantification of TRAP-positive osteoclasts: The number of TRAP-positive cells with three or more nuclei was quantified. Data are presented as mean ± standard deviation (SD). ( c ) Osteoclast formation in the MLO-Y4 co-culture system: Osteoclast precursors were co-cultured with MLO-Y4 cells in the presence of vitamin D3 and prostaglandin E2, with or without rmLCN2. TRAP staining was used to visualize osteoclast formation. Scale bar = 100 μm. ( d ) Quantification of TRAP-positive osteoclasts in the co-culture system. The number of TRAP-positive osteoclasts was quantified in control and rmLCN2-treated groups. Data are presented as mean ± SD. Statistical significance was determined using the Tukey–Kramer test ( n = 4), with * p < 0.05 and ** p < 0.01 considered significant.

Journal: Scientific Reports

Article Title: Lipocalin-2 upregulation in hypoxic murine osteocytes enhances RANKL-induced osteoclastogenesis

doi: 10.1038/s41598-025-34575-2

Figure Lengend Snippet: LCN2 enhanced osteoclastogenesis via MLO-Y4 cells. ( a ) Microscopic images of osteoclasts. Osteoclast precursors were cultured under the following conditions: macrophage colony-stimulating factor (M-CSF), M-CSF (100 ng/mL) + receptor activator of nuclear factor-κB ligand (RANKL) (100 ng/mL), M-CSF + RANKL + rmLCN2 (100 ng/mL), or M-CSF + rmLCN2. Representative TRAP-stained images of osteoclasts under each condition are shown. Scale bar = 100 μm. ( b ) Quantification of TRAP-positive osteoclasts: The number of TRAP-positive cells with three or more nuclei was quantified. Data are presented as mean ± standard deviation (SD). ( c ) Osteoclast formation in the MLO-Y4 co-culture system: Osteoclast precursors were co-cultured with MLO-Y4 cells in the presence of vitamin D3 and prostaglandin E2, with or without rmLCN2. TRAP staining was used to visualize osteoclast formation. Scale bar = 100 μm. ( d ) Quantification of TRAP-positive osteoclasts in the co-culture system. The number of TRAP-positive osteoclasts was quantified in control and rmLCN2-treated groups. Data are presented as mean ± SD. Statistical significance was determined using the Tukey–Kramer test ( n = 4), with * p < 0.05 and ** p < 0.01 considered significant.

Article Snippet: The following polyclonal antibodies were used: SLC22A17 (Abonova, Taipei, Taiwan), megalin (Bioss, Woburn, MA, USA), HIF1-α (GeneTex, Irvine, CA, USA), and LCN2 (Aviva Systems Biology, San Diego, CA, USA).

Techniques: Cell Culture, Staining, Standard Deviation, Co-Culture Assay, Control

Effect of LCN2 on ERK1/2, p38, and JNK MAPK phosphorylation in MLO-Y4 cells. MLO-Y4 cells were incubated with 100 ng/mL of rmLCN2 for 0, 5, 15, 30, and 60 min; 0 indicates the condition without rmLCN2 treatment. ( a ) Western blot analysis: Cells were lysed and analyzed by western blotting using antibodies against phospho-ERK1/2, ERK1/2, phospho-p38, p38, phospho-JNK, JNK, and β-actin. ( b – g ) Quantification of protein phosphorylation levels. Band densities were measured using ImageJ software. ( b ) p-ERK1/2, ( d ) p-JNK, and ( f ) p-p38 phosphorylation levels were normalized to β-actin. ( c ), ( e ), and ( g ) phosphorylation levels were normalized to their respective total protein levels ( n = 3). ( h ) RANKL mRNA relative expression as measured by real-time RT-PCR. MLO-Y4 cells were treated with rmLCN2 (100 ng/mL) and MAPK inhibitors—U0126, SB203580, and JNK inhibitor II (SP600125)—at 10 µM for 3 days ( n = 4). Data are shown as mean ± SD. Statistical significance was determined using Tukey-Kramer test, with * p < 0.05 and ** p < 0.01.

Journal: Scientific Reports

Article Title: Lipocalin-2 upregulation in hypoxic murine osteocytes enhances RANKL-induced osteoclastogenesis

doi: 10.1038/s41598-025-34575-2

Figure Lengend Snippet: Effect of LCN2 on ERK1/2, p38, and JNK MAPK phosphorylation in MLO-Y4 cells. MLO-Y4 cells were incubated with 100 ng/mL of rmLCN2 for 0, 5, 15, 30, and 60 min; 0 indicates the condition without rmLCN2 treatment. ( a ) Western blot analysis: Cells were lysed and analyzed by western blotting using antibodies against phospho-ERK1/2, ERK1/2, phospho-p38, p38, phospho-JNK, JNK, and β-actin. ( b – g ) Quantification of protein phosphorylation levels. Band densities were measured using ImageJ software. ( b ) p-ERK1/2, ( d ) p-JNK, and ( f ) p-p38 phosphorylation levels were normalized to β-actin. ( c ), ( e ), and ( g ) phosphorylation levels were normalized to their respective total protein levels ( n = 3). ( h ) RANKL mRNA relative expression as measured by real-time RT-PCR. MLO-Y4 cells were treated with rmLCN2 (100 ng/mL) and MAPK inhibitors—U0126, SB203580, and JNK inhibitor II (SP600125)—at 10 µM for 3 days ( n = 4). Data are shown as mean ± SD. Statistical significance was determined using Tukey-Kramer test, with * p < 0.05 and ** p < 0.01.

Article Snippet: The following polyclonal antibodies were used: SLC22A17 (Abonova, Taipei, Taiwan), megalin (Bioss, Woburn, MA, USA), HIF1-α (GeneTex, Irvine, CA, USA), and LCN2 (Aviva Systems Biology, San Diego, CA, USA).

Techniques: Phospho-proteomics, Incubation, Western Blot, Software, Expressing, Quantitative RT-PCR

Orthodontic tooth movement (OTM) model and the role of LCN2 in osteoclastogenesis. ( a ) Schematic illustration of OTM in mice. Intraoral image of a nickel-titanium (Ni-Ti) closed-coil spring positioned between the upper-left first molar and the maxillary alveolar bone beneath the incisors. A 0.1 mm stainless steel wire was used to secure the appliance to the posterior surface of the first molar and through holes drilled in the alveolar bone. The maxillary first molar was moved mesially by the applied orthodontic force. ( b ) Immunohistochemical analysis of HIF-1α and LCN2 expression. The expression of HIF-1α and LCN2 in osteocytes was examined during OTM. The percentage of HIF-1α- and LCN2-positive osteocytes was evaluated within a 400 × 200 μm region on the mesial periodontal ligament compression side, approximately 150 μm from the distobuccal root branch of the upper left first molar. After initiating OTM, observations were conducted on days 0, 2, and 6. Arrowheads indicate HIF-1α- or LCN2-positive osteocytes. Black arrows indicate the direction of orthodontic force. M: mesial side; D: distal side; a: alveolar bone; p: periodontal ligament; r: root. Black scale bar = 50 μm. White scale bar = 25 μm. ( c , d ) Quantification of HIF-1α- and LCN2-Positive Osteocytes during OTM: The percentage of HIF-1α- and LCN2-positive osteocytes was quantified at each time point. ( e ) TRAP-stained images of the mesial compression side of the distal buccal root of the maxillary left first molar at day 0, 2, and 6 after OTM, and at day 6 group treated with LCN2-neutralizing antibody every two days. Scale bar = 50 μm. ( f ) Number of TRAP-positive cells located on the alveolar bone surface on the mesial compression side. Data are presented as mean ± SD. Statistical significance was determined using the Tukey–Kramer test ( n = 4), with * p < 0.05 and ** p < 0.01 considered significant.

Journal: Scientific Reports

Article Title: Lipocalin-2 upregulation in hypoxic murine osteocytes enhances RANKL-induced osteoclastogenesis

doi: 10.1038/s41598-025-34575-2

Figure Lengend Snippet: Orthodontic tooth movement (OTM) model and the role of LCN2 in osteoclastogenesis. ( a ) Schematic illustration of OTM in mice. Intraoral image of a nickel-titanium (Ni-Ti) closed-coil spring positioned between the upper-left first molar and the maxillary alveolar bone beneath the incisors. A 0.1 mm stainless steel wire was used to secure the appliance to the posterior surface of the first molar and through holes drilled in the alveolar bone. The maxillary first molar was moved mesially by the applied orthodontic force. ( b ) Immunohistochemical analysis of HIF-1α and LCN2 expression. The expression of HIF-1α and LCN2 in osteocytes was examined during OTM. The percentage of HIF-1α- and LCN2-positive osteocytes was evaluated within a 400 × 200 μm region on the mesial periodontal ligament compression side, approximately 150 μm from the distobuccal root branch of the upper left first molar. After initiating OTM, observations were conducted on days 0, 2, and 6. Arrowheads indicate HIF-1α- or LCN2-positive osteocytes. Black arrows indicate the direction of orthodontic force. M: mesial side; D: distal side; a: alveolar bone; p: periodontal ligament; r: root. Black scale bar = 50 μm. White scale bar = 25 μm. ( c , d ) Quantification of HIF-1α- and LCN2-Positive Osteocytes during OTM: The percentage of HIF-1α- and LCN2-positive osteocytes was quantified at each time point. ( e ) TRAP-stained images of the mesial compression side of the distal buccal root of the maxillary left first molar at day 0, 2, and 6 after OTM, and at day 6 group treated with LCN2-neutralizing antibody every two days. Scale bar = 50 μm. ( f ) Number of TRAP-positive cells located on the alveolar bone surface on the mesial compression side. Data are presented as mean ± SD. Statistical significance was determined using the Tukey–Kramer test ( n = 4), with * p < 0.05 and ** p < 0.01 considered significant.

Article Snippet: The following polyclonal antibodies were used: SLC22A17 (Abonova, Taipei, Taiwan), megalin (Bioss, Woburn, MA, USA), HIF1-α (GeneTex, Irvine, CA, USA), and LCN2 (Aviva Systems Biology, San Diego, CA, USA).

Techniques: Immunohistochemical staining, Expressing, Staining

Illustration of how hypoxic stress induces LCN2 in osteocytes and stimulates bone resorption. Under hypoxia conditions, osteocytes increase the expression of LCN2, which, through autocrine and paracrine signaling, enhances RANKL expression. Increased RANKL then drives the differentiation of osteoclast precursor cells into osteoclasts, thereby promoting bone resorption.

Journal: Scientific Reports

Article Title: Lipocalin-2 upregulation in hypoxic murine osteocytes enhances RANKL-induced osteoclastogenesis

doi: 10.1038/s41598-025-34575-2

Figure Lengend Snippet: Illustration of how hypoxic stress induces LCN2 in osteocytes and stimulates bone resorption. Under hypoxia conditions, osteocytes increase the expression of LCN2, which, through autocrine and paracrine signaling, enhances RANKL expression. Increased RANKL then drives the differentiation of osteoclast precursor cells into osteoclasts, thereby promoting bone resorption.

Article Snippet: The following polyclonal antibodies were used: SLC22A17 (Abonova, Taipei, Taiwan), megalin (Bioss, Woburn, MA, USA), HIF1-α (GeneTex, Irvine, CA, USA), and LCN2 (Aviva Systems Biology, San Diego, CA, USA).

Techniques: Expressing

Figure 2: LCN2 is induced in AT of EAE, cancer- and sepsis-inducing cachectic mice. (A) Venn diagram including the up-regulated genes in choroid plexus, dura mater and spinal cord of EAE mice. (B, C) Lcn2 mRNA (B) and protein (C) expression. HSL was used as loading control. HSL was the same as shown in Figure 1F because it is part of the same western blot. (D, E) Tumor mass progression (D), % body weight loss (E) in mice during LLC post inoculation (n ¼ 17 PBS and n ¼ 11 LLC mice). (F) sWAT weight 21 days post inoculation (n ¼ 17 PBS and n ¼ 11 LLC mice). Representative immunofluorescence of Phalloidin (green), LCN2 (red), Dapi (blue) in sWAT of PBS and LLC mice 21 days post inoculation (n ¼ 5 PBS and n ¼ 4 LLC mice). Representative immunoblots of LCN2 in in sWAT of PBS and LLC mice 21 days post inoculation (n ¼ 5 PBS and n ¼ 4 LLC mice). VINCULIN was used as loading control. (H) Volcano plot and functional enrichment analysis for biological processes of up-regulated genes (Log2FC > 1.5; pAdj<0.05) in sWAT of EAE and LCC mice (n ¼ 5 mice/group). (H) Single cell RNA-sequencing (PRJNA626597) of visceral white adipose tissue isolated from mice 1 month after sepsis induction. (J) Fibroblast annotation for fibroblast adipocyte precursors (FAP: Podh, Col5a3) and adipose stem cells (ASC: Dpp4, Sema3c). (K) Lcn2 expression in fibroblast of control and sepsis mice. Data was reported as mean SD. Student’s T test *p < 0.05; **p < 0.01; ***p < 0.001 treated vs Ctrl.

Journal: Molecular metabolism

Article Title: Lipocalin-2 promotes adipose-macrophage interactions to shape peripheral and central inflammatory responses in experimental autoimmune encephalomyelitis.

doi: 10.1016/j.molmet.2023.101783

Figure Lengend Snippet: Figure 2: LCN2 is induced in AT of EAE, cancer- and sepsis-inducing cachectic mice. (A) Venn diagram including the up-regulated genes in choroid plexus, dura mater and spinal cord of EAE mice. (B, C) Lcn2 mRNA (B) and protein (C) expression. HSL was used as loading control. HSL was the same as shown in Figure 1F because it is part of the same western blot. (D, E) Tumor mass progression (D), % body weight loss (E) in mice during LLC post inoculation (n ¼ 17 PBS and n ¼ 11 LLC mice). (F) sWAT weight 21 days post inoculation (n ¼ 17 PBS and n ¼ 11 LLC mice). Representative immunofluorescence of Phalloidin (green), LCN2 (red), Dapi (blue) in sWAT of PBS and LLC mice 21 days post inoculation (n ¼ 5 PBS and n ¼ 4 LLC mice). Representative immunoblots of LCN2 in in sWAT of PBS and LLC mice 21 days post inoculation (n ¼ 5 PBS and n ¼ 4 LLC mice). VINCULIN was used as loading control. (H) Volcano plot and functional enrichment analysis for biological processes of up-regulated genes (Log2FC > 1.5; pAdj<0.05) in sWAT of EAE and LCC mice (n ¼ 5 mice/group). (H) Single cell RNA-sequencing (PRJNA626597) of visceral white adipose tissue isolated from mice 1 month after sepsis induction. (J) Fibroblast annotation for fibroblast adipocyte precursors (FAP: Podh, Col5a3) and adipose stem cells (ASC: Dpp4, Sema3c). (K) Lcn2 expression in fibroblast of control and sepsis mice. Data was reported as mean SD. Student’s T test *p < 0.05; **p < 0.01; ***p < 0.001 treated vs Ctrl.

Article Snippet: For LCN2 gene silencing, differentiated 3T3-L1 cells were transfected with 40 pmol of small interfering RNA (LCN2 or scramble sequence, Origene) using Lipofectamine 2000 transfection reagent, according to manufacturer’s instructions (ThermoFisher Waltarm, MA, USA).

Techniques: Expressing, Control, Western Blot, Functional Assay, RNA Sequencing, Isolation

Correlation between serum (a) IL‐31, (b) LCN2 and (c) CCL2 levels and itching intensity in psoriasis patients. Each dot represents an individual patient sample ( n = 20). * p < 0.05; *** p < 0.001. CCL2, chemokine ligand 2; IL‐31, interleukin‐31; LCN2, lipocalin‐2; ns, not significant.

Journal: Experimental Dermatology

Article Title: Itching Sensation and Elevated Interleukin‐31 Levels as Potential Indicators of Exceptional Response to Biologics in Patients With Moderate‐To‐Severe Psoriasis

doi: 10.1111/exd.70138

Figure Lengend Snippet: Correlation between serum (a) IL‐31, (b) LCN2 and (c) CCL2 levels and itching intensity in psoriasis patients. Each dot represents an individual patient sample ( n = 20). * p < 0.05; *** p < 0.001. CCL2, chemokine ligand 2; IL‐31, interleukin‐31; LCN2, lipocalin‐2; ns, not significant.

Article Snippet: ELISA kits for human IL‐31, LCN2 and CCL2 were purchased from ABclonal (Human Interleukin 31 ELISA kit, RK00378; Woburn, MA, USA), Origene Technologies (human NGAL ELISA kit, EA200004; Rockville, MD, USA) and R&D Systems (Human CCL2/MCP‐1 Quantikine ELISA kit, DCP00; Minneapolis, MN, USA).

Techniques:

Differential serum pruritus‐associated protein levels in ER and non‐ER patients with psoriasis before and after treatment. Serum (a) IL‐31, (b) LCN2 and (c) CCL2 concentrations in the ER and non‐ER groups before and after treatment. Changes in (d) IL‐31, (e) LCN2 and (f) CCL2 concentrations according to biologics treatment in ER and non‐ER patients. Each dot represents an individual patient sample, n = 10 for each group. * p < 0.05; ** p < 0.01. CCL2, chemokine ligand 2; ER, exceptional responder; IL‐31, interleukin‐31; LCN2, lipocalin‐2; non‐ER, non‐exceptional responder; Tx, Treatment.

Journal: Experimental Dermatology

Article Title: Itching Sensation and Elevated Interleukin‐31 Levels as Potential Indicators of Exceptional Response to Biologics in Patients With Moderate‐To‐Severe Psoriasis

doi: 10.1111/exd.70138

Figure Lengend Snippet: Differential serum pruritus‐associated protein levels in ER and non‐ER patients with psoriasis before and after treatment. Serum (a) IL‐31, (b) LCN2 and (c) CCL2 concentrations in the ER and non‐ER groups before and after treatment. Changes in (d) IL‐31, (e) LCN2 and (f) CCL2 concentrations according to biologics treatment in ER and non‐ER patients. Each dot represents an individual patient sample, n = 10 for each group. * p < 0.05; ** p < 0.01. CCL2, chemokine ligand 2; ER, exceptional responder; IL‐31, interleukin‐31; LCN2, lipocalin‐2; non‐ER, non‐exceptional responder; Tx, Treatment.

Article Snippet: ELISA kits for human IL‐31, LCN2 and CCL2 were purchased from ABclonal (Human Interleukin 31 ELISA kit, RK00378; Woburn, MA, USA), Origene Technologies (human NGAL ELISA kit, EA200004; Rockville, MD, USA) and R&D Systems (Human CCL2/MCP‐1 Quantikine ELISA kit, DCP00; Minneapolis, MN, USA).

Techniques:

Atorvastatin inhibits macrophage/microglia LCN2 expression after ICH and microglia LCN2 expression after BI injury. A The macrophage/microglia were sorted from mice hemorrhagic brain via flow cytometry, from which the protein was extracted before conducting western blot assay. B The quantification of each blot was calculated. For each group, n = 6. F(2,15) = 61.19, ***p < 0.0001 by one-way ANOVA. C Double-immunofluorescence staining of Iba-1 and LCN2 in peri-hematomal area of mice brain at day 3 after ICH and the quantifications were presented in D . For each group, n = 8. Data are displayed as median ± interquartile range. Z = 4.419, ***p < 0.0001 for Sham + Veh vs ICH + Veh and Z = 2.369, *p < 0.0357 for ICH + Veh vs ICH + ATo by non-parametric test(Kruskal–Wallis). E Double-immunofluorescence staining of Iba-1 and LCN2 in BV cell line at 24 h after BI injury and the quantifications were presented in F . For each group, n = 6. Data are displayed as median ± interquartile range. Z = 4.722, ***p < 0.0001 for Sham + Veh vs BI + Veh, Z = 1.180, p = 0.9512 for BI + Veh vs BI + 2.5 μM Ato, Z = 2.525, *p = 0.0463 for BI + Veh vs BI + 5 μM Ato and Z = 3.378, **p = 0.0029 for BI + Veh vs BI + 10 μM Ato by non-parametric test(Kruskal–Wallis). G ELISA assay results of LCN2 from supernatant of BV2 culture medium. n = 6. F(4,25) = 120.8, ***p < 0.0001 by one-way ANOVA. H qPCR analysis of relative mRNA levels of Lcn2 in BV2 cell lines. For each group, n = 6. F(4,25) = 39.68, ***p < 0.0001 by one-way ANOVA

Journal: Cellular and Molecular Neurobiology

Article Title: Atorvastatin Protects Against the Macrophage/Microglia-Related Neuroinflammation via Inhibiting Lipocalin-2 in Mouse Experimental Intracerebral Hemorrhage Model

doi: 10.1007/s10571-025-01566-w

Figure Lengend Snippet: Atorvastatin inhibits macrophage/microglia LCN2 expression after ICH and microglia LCN2 expression after BI injury. A The macrophage/microglia were sorted from mice hemorrhagic brain via flow cytometry, from which the protein was extracted before conducting western blot assay. B The quantification of each blot was calculated. For each group, n = 6. F(2,15) = 61.19, ***p < 0.0001 by one-way ANOVA. C Double-immunofluorescence staining of Iba-1 and LCN2 in peri-hematomal area of mice brain at day 3 after ICH and the quantifications were presented in D . For each group, n = 8. Data are displayed as median ± interquartile range. Z = 4.419, ***p < 0.0001 for Sham + Veh vs ICH + Veh and Z = 2.369, *p < 0.0357 for ICH + Veh vs ICH + ATo by non-parametric test(Kruskal–Wallis). E Double-immunofluorescence staining of Iba-1 and LCN2 in BV cell line at 24 h after BI injury and the quantifications were presented in F . For each group, n = 6. Data are displayed as median ± interquartile range. Z = 4.722, ***p < 0.0001 for Sham + Veh vs BI + Veh, Z = 1.180, p = 0.9512 for BI + Veh vs BI + 2.5 μM Ato, Z = 2.525, *p = 0.0463 for BI + Veh vs BI + 5 μM Ato and Z = 3.378, **p = 0.0029 for BI + Veh vs BI + 10 μM Ato by non-parametric test(Kruskal–Wallis). G ELISA assay results of LCN2 from supernatant of BV2 culture medium. n = 6. F(4,25) = 120.8, ***p < 0.0001 by one-way ANOVA. H qPCR analysis of relative mRNA levels of Lcn2 in BV2 cell lines. For each group, n = 6. F(4,25) = 39.68, ***p < 0.0001 by one-way ANOVA

Article Snippet: In the present study, young male C57BL/6 mice aged 18–21 weeks were provided by the Experimental Animal Center of Military Medical University (animal ethics protocol number:#20210424), 8 week-old LCN2 f/f,CX3CR1−Cre male mice and LCN2 f/f male mice were constructed and incubated by Cyagen Co. (Suzhou, China) (Supplemental data).

Techniques: Expressing, Flow Cytometry, Western Blot, Double Immunofluorescence Staining, Enzyme-linked Immunosorbent Assay

Atorvastatin exerts anti-neuroinflammation via macrophage/microglia LCN2 suppression. A Double-immunofluorescence staining of Iba-1 and CD16 in peri-hematoma area of mice brain at day 3 after ICH and the quantifications for Iba-1( +) cell count ( B ), relative OD of CD16 ( C ) and CD16( +)Iba-1( +) cell percentage D were presented. For each group, n = 6. F(4,25) = 6.471, **p = 0.0010 for Iba-1( +) cell count, F(4,25) = 30.07, ***p < 0.0001 for relative OD of CD16 and F(4,25) = 9.163, ***p = 0.0001 for CD16( +)Iba-1( +) cell percentage by one-way ANOVA. E Double-immunofluorescence staining of Iba-1 and iNOS in BV cell line at 24 h after BI injury and the quantifications of iNOS OD values in different comparisons were presented in F – H . F(2,15) = 11.39, **p = 0.0010 for F , F(2,15) = 2.012, p = 0.1683 for G and F(2,15) = 15.153, ***p = 0.0003 for H by one-way ANOVA. IL-1β ( I ) and TNF ( J ) ELISA assays for supernatant from cell culture medium were conducted. n = 6. F(6,35) = 34.14, ***p < 0.0001 for IL-1β and F(6,35) = 20.35, ***p < 0.0001 for TNF by one-way ANOVA

Journal: Cellular and Molecular Neurobiology

Article Title: Atorvastatin Protects Against the Macrophage/Microglia-Related Neuroinflammation via Inhibiting Lipocalin-2 in Mouse Experimental Intracerebral Hemorrhage Model

doi: 10.1007/s10571-025-01566-w

Figure Lengend Snippet: Atorvastatin exerts anti-neuroinflammation via macrophage/microglia LCN2 suppression. A Double-immunofluorescence staining of Iba-1 and CD16 in peri-hematoma area of mice brain at day 3 after ICH and the quantifications for Iba-1( +) cell count ( B ), relative OD of CD16 ( C ) and CD16( +)Iba-1( +) cell percentage D were presented. For each group, n = 6. F(4,25) = 6.471, **p = 0.0010 for Iba-1( +) cell count, F(4,25) = 30.07, ***p < 0.0001 for relative OD of CD16 and F(4,25) = 9.163, ***p = 0.0001 for CD16( +)Iba-1( +) cell percentage by one-way ANOVA. E Double-immunofluorescence staining of Iba-1 and iNOS in BV cell line at 24 h after BI injury and the quantifications of iNOS OD values in different comparisons were presented in F – H . F(2,15) = 11.39, **p = 0.0010 for F , F(2,15) = 2.012, p = 0.1683 for G and F(2,15) = 15.153, ***p = 0.0003 for H by one-way ANOVA. IL-1β ( I ) and TNF ( J ) ELISA assays for supernatant from cell culture medium were conducted. n = 6. F(6,35) = 34.14, ***p < 0.0001 for IL-1β and F(6,35) = 20.35, ***p < 0.0001 for TNF by one-way ANOVA

Article Snippet: In the present study, young male C57BL/6 mice aged 18–21 weeks were provided by the Experimental Animal Center of Military Medical University (animal ethics protocol number:#20210424), 8 week-old LCN2 f/f,CX3CR1−Cre male mice and LCN2 f/f male mice were constructed and incubated by Cyagen Co. (Suzhou, China) (Supplemental data).

Techniques: Double Immunofluorescence Staining, Cell Counting, Enzyme-linked Immunosorbent Assay, Cell Culture

Atorvastatin alleviates neural damage and neurological deficit via macrophage/microglia LCN2 downregulation. A TUNEL images and B quantification of the peri-hematomal area in mice from different groups at day 7 after ICH. For each group, n = 6. Scale bar = 20 μm. F(3,20) = 13.90, ***p < 0.0001 by one-way ANOVA. C Immunohistochemistry staining of Darpp32 in mouse brain from different groups at day 28 after ICH, and the neuronal loss(%) was calculated and presented D by equation: neuron loss = Area(ipsilateral)/Area(contralateral)*100(%). For each group, n = 6. F(3,20) = 24.06, ***p < 0.0001 by one-way ANOVA. E Forelimb uses asymmetry and F corner turn scores in mice from different groups at day 7 after ICH. n = 12. Values are mean ± SD. F(3,44) = 7.327, ***p = 0.0004 for forelimb use asymmetry and F(3,44) = 22.61, ***p < 0.0001 for corner turn scores by one-way ANOVA. G Immunofluorescence staining of NeuN in primary cultured neurons from BV2-neuron co-culture system at 24 h after BI injury in LCN2 NC group, LCN2 NC + Ato group and LCN2 OE + Ato group, and the H NeuN( +) cell loss and I relative axonal length were calculated. For each group, n = 6. F(2,15) = 15.41, ***p = 0.0002 for NeuN( +) cell loss and F(2,15) = 17.75, ***p = 0.0001 for relative axonal length by one-way ANOVA

Journal: Cellular and Molecular Neurobiology

Article Title: Atorvastatin Protects Against the Macrophage/Microglia-Related Neuroinflammation via Inhibiting Lipocalin-2 in Mouse Experimental Intracerebral Hemorrhage Model

doi: 10.1007/s10571-025-01566-w

Figure Lengend Snippet: Atorvastatin alleviates neural damage and neurological deficit via macrophage/microglia LCN2 downregulation. A TUNEL images and B quantification of the peri-hematomal area in mice from different groups at day 7 after ICH. For each group, n = 6. Scale bar = 20 μm. F(3,20) = 13.90, ***p < 0.0001 by one-way ANOVA. C Immunohistochemistry staining of Darpp32 in mouse brain from different groups at day 28 after ICH, and the neuronal loss(%) was calculated and presented D by equation: neuron loss = Area(ipsilateral)/Area(contralateral)*100(%). For each group, n = 6. F(3,20) = 24.06, ***p < 0.0001 by one-way ANOVA. E Forelimb uses asymmetry and F corner turn scores in mice from different groups at day 7 after ICH. n = 12. Values are mean ± SD. F(3,44) = 7.327, ***p = 0.0004 for forelimb use asymmetry and F(3,44) = 22.61, ***p < 0.0001 for corner turn scores by one-way ANOVA. G Immunofluorescence staining of NeuN in primary cultured neurons from BV2-neuron co-culture system at 24 h after BI injury in LCN2 NC group, LCN2 NC + Ato group and LCN2 OE + Ato group, and the H NeuN( +) cell loss and I relative axonal length were calculated. For each group, n = 6. F(2,15) = 15.41, ***p = 0.0002 for NeuN( +) cell loss and F(2,15) = 17.75, ***p = 0.0001 for relative axonal length by one-way ANOVA

Article Snippet: In the present study, young male C57BL/6 mice aged 18–21 weeks were provided by the Experimental Animal Center of Military Medical University (animal ethics protocol number:#20210424), 8 week-old LCN2 f/f,CX3CR1−Cre male mice and LCN2 f/f male mice were constructed and incubated by Cyagen Co. (Suzhou, China) (Supplemental data).

Techniques: TUNEL Assay, Immunohistochemistry, Staining, Immunofluorescence, Cell Culture, Co-Culture Assay

Figure 1. LCN2 and other tumorigenic markers in human prostate cancer cell lines. The human prostate cancer cell lines LNCaP and PC-3 were analyzed for mRNA or protein expression after culturing under basal conditions. (A) Quantitative mRNA analysis of NFKBIZ, GJA1, IL1B, LCN2, and CXCL8 in both cell lines revealed significantly higher expression levels in PC-3 cells (n = 4). Relative mRNA expressions were normalized to ACTB expression and values are given in relation to LNCaP cells. Significant differences between LNCaP and PC-3 cells are indicated as *** p < 0.001. (B) Western blot analysis confirmed lower protein expression of these markers in LNCaP cells (n ≥3). β-actin and α-tubulin expression served as internal loading controls.

Journal: Cells

Article Title: Lipocalin-2 (LCN2) Deficiency Leads to Cellular Changes in Highly Metastatic Human Prostate Cancer Cell Line PC-3.

doi: 10.3390/cells11020260

Figure Lengend Snippet: Figure 1. LCN2 and other tumorigenic markers in human prostate cancer cell lines. The human prostate cancer cell lines LNCaP and PC-3 were analyzed for mRNA or protein expression after culturing under basal conditions. (A) Quantitative mRNA analysis of NFKBIZ, GJA1, IL1B, LCN2, and CXCL8 in both cell lines revealed significantly higher expression levels in PC-3 cells (n = 4). Relative mRNA expressions were normalized to ACTB expression and values are given in relation to LNCaP cells. Significant differences between LNCaP and PC-3 cells are indicated as *** p < 0.001. (B) Western blot analysis confirmed lower protein expression of these markers in LNCaP cells (n ≥3). β-actin and α-tubulin expression served as internal loading controls.

Article Snippet: A functionally validated human LCN2 knockout kit (OriGene Technologies, Herford, Germany, Cat# KN407685) was used, which consists of two gRNA vectors (gRNA1: ACAGGGCTAGGCCCAGCCAC, gRNA2: AGAGGGACCTTGCTCAGAGG) and the donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP.

Techniques: Expressing, Western Blot

Figure 3. CRISPR/Cas9-mediated knockdown of LCN2 in PC-3 cells. LCN2-KO cells were seeded in low dilution in methylcellulose-based medium to establish single-cell-derived knockout cell lines. After being grown for 20 days in six-well plates, macroscopic (A) and microscopic (B) images of a representative clone of single-cell-derived LCN2-KO were taken. Bright-field and fluorescence images are shown in 40× and 100× magnification. (C) Western blot analysis verified knockout of LCN2 protein expression and secretion in all clones compared to parenteral PC-3 cells (n ≥3). β-actin served as an internal loading control for equal protein in lysates. Secreted LCN2 levels are shown with corresponding Ponceau S stain. Different cell clones are indexed by numbers. (D) Quantitative mRNA analysis showed successful LCN2 depletion in LCN2-KO (#1, #4, #8) compared to PC-3 cells (n = 3). LCN2 mRNA expression was normalized to GAPDH and given in relation to parenteral PC-3 cells. Differences between groups reaching significance are indicated as *** p < 0.001.

Journal: Cells

Article Title: Lipocalin-2 (LCN2) Deficiency Leads to Cellular Changes in Highly Metastatic Human Prostate Cancer Cell Line PC-3.

doi: 10.3390/cells11020260

Figure Lengend Snippet: Figure 3. CRISPR/Cas9-mediated knockdown of LCN2 in PC-3 cells. LCN2-KO cells were seeded in low dilution in methylcellulose-based medium to establish single-cell-derived knockout cell lines. After being grown for 20 days in six-well plates, macroscopic (A) and microscopic (B) images of a representative clone of single-cell-derived LCN2-KO were taken. Bright-field and fluorescence images are shown in 40× and 100× magnification. (C) Western blot analysis verified knockout of LCN2 protein expression and secretion in all clones compared to parenteral PC-3 cells (n ≥3). β-actin served as an internal loading control for equal protein in lysates. Secreted LCN2 levels are shown with corresponding Ponceau S stain. Different cell clones are indexed by numbers. (D) Quantitative mRNA analysis showed successful LCN2 depletion in LCN2-KO (#1, #4, #8) compared to PC-3 cells (n = 3). LCN2 mRNA expression was normalized to GAPDH and given in relation to parenteral PC-3 cells. Differences between groups reaching significance are indicated as *** p < 0.001.

Article Snippet: A functionally validated human LCN2 knockout kit (OriGene Technologies, Herford, Germany, Cat# KN407685) was used, which consists of two gRNA vectors (gRNA1: ACAGGGCTAGGCCCAGCCAC, gRNA2: AGAGGGACCTTGCTCAGAGG) and the donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP.

Techniques: CRISPR, Knockdown, Derivative Assay, Knock-Out, Western Blot, Expressing, Clone Assay, Control, Staining

Figure 4. LCN2 deficiency in PC-3 cells results in changes in proliferation, adhesion, and cytoskeleton rearrangement. Quantitative mRNA expression analysis of (A) PCNA and (B) GJA1 was performed in PC-3 and LCN2-KO (#1, #4, #8) cells grown in basal conditions (n = 3). Both markers were significantly reduced in all analyzed LCN2-KO cells compared to parenteral PC-3 cells. mRNA expression was normalized to GAPDH and are given in relation to parenteral PC-3 cells. Differences between the groups reaching significance are marked by asterisks (* p < 0.05, ** p < 0.01, *** p < 0.001). (C) Western blot analysis confirmed reduction in PCNA and Cx43 protein expression in LCN2-KO cells compared to PC-3 cells (n = 3). α-tubulin served as an internal loading control. (D) Metabolic activity was determined after 48 h in MTT assay (n = 3) and showed significantly reduced metabolic activity of all LCN2-KO cell lines (*** p < 0.001) compared to PC-3 cells. (E) Indirect cell attachment assay was performed as described in the Material and Methods section. Bars show the percentage of attached cells to total cells seeded (n = 3). All statistical values shown represent the comparison of LCN2-KO cell lines to the parenteral PC-3 cells. Differences between the groups reaching significance are indicated as *** p < 0.001. Note that all LCN2-deficient cell lines show significant reduction in cell attachment. (F) F-actin stress fibers were stained with Phalloidin-Rhodamine (red) in PC-3 and LCN2-KO#1 cells (n = 2). Nuclei were counterstained with DAPI (blue). Magnification: 400×, scale bar: 50 µm.

Journal: Cells

Article Title: Lipocalin-2 (LCN2) Deficiency Leads to Cellular Changes in Highly Metastatic Human Prostate Cancer Cell Line PC-3.

doi: 10.3390/cells11020260

Figure Lengend Snippet: Figure 4. LCN2 deficiency in PC-3 cells results in changes in proliferation, adhesion, and cytoskeleton rearrangement. Quantitative mRNA expression analysis of (A) PCNA and (B) GJA1 was performed in PC-3 and LCN2-KO (#1, #4, #8) cells grown in basal conditions (n = 3). Both markers were significantly reduced in all analyzed LCN2-KO cells compared to parenteral PC-3 cells. mRNA expression was normalized to GAPDH and are given in relation to parenteral PC-3 cells. Differences between the groups reaching significance are marked by asterisks (* p < 0.05, ** p < 0.01, *** p < 0.001). (C) Western blot analysis confirmed reduction in PCNA and Cx43 protein expression in LCN2-KO cells compared to PC-3 cells (n = 3). α-tubulin served as an internal loading control. (D) Metabolic activity was determined after 48 h in MTT assay (n = 3) and showed significantly reduced metabolic activity of all LCN2-KO cell lines (*** p < 0.001) compared to PC-3 cells. (E) Indirect cell attachment assay was performed as described in the Material and Methods section. Bars show the percentage of attached cells to total cells seeded (n = 3). All statistical values shown represent the comparison of LCN2-KO cell lines to the parenteral PC-3 cells. Differences between the groups reaching significance are indicated as *** p < 0.001. Note that all LCN2-deficient cell lines show significant reduction in cell attachment. (F) F-actin stress fibers were stained with Phalloidin-Rhodamine (red) in PC-3 and LCN2-KO#1 cells (n = 2). Nuclei were counterstained with DAPI (blue). Magnification: 400×, scale bar: 50 µm.

Article Snippet: A functionally validated human LCN2 knockout kit (OriGene Technologies, Herford, Germany, Cat# KN407685) was used, which consists of two gRNA vectors (gRNA1: ACAGGGCTAGGCCCAGCCAC, gRNA2: AGAGGGACCTTGCTCAGAGG) and the donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP.

Techniques: Expressing, Western Blot, Control, Activity Assay, MTT Assay, Cell Attachment Assay, Comparison, Staining

Figure 5. LCN2 depletion in PC-3 cells resulted in reduced expression of pro-inflammatory cytokines. (A) Quantitative mRNA expression analysis of NFKBIZ, IL1B and CXCL8 was performed in PC-3 and LCN2-KO (#1, #4, #8) cells grown in basal conditions (n = 3). The mRNA expression of these genes was significantly reduced in all analyzed LCN2-KO cells test. mRNA expression was normalized to GAPDH and are given in relation to parenteral PC-3 cells. Differences between the groups reaching significance are indicated as ** p < 0.01, *** p < 0.001. (B) Western Blot analysis confirmed reduction in IκBζ, IL-1β and IL-8 protein expression in LCN2-KO cells compared to parental PC-3 cells (n = 3). (C) LCN2-KO#1 cells were stimulated for 48 h with indicated ratios of conditioned medium (CM) collected from PC-3 or LCN2-KO#1 cells. Western blot analysis revealed increased IL-1β quantities in LCN2-KO#1 cells, treated with CM from PC-3 cells (n = 3). (D) LCN2-KO#1 cells were stimulated with recombinant human LCN2 (rhLCN2, 100 ng/mL) for 24 h. Western blot analysis showed enhanced IL-1β expression in treated LCN2-KO#1 cells (n = 2). LCN2 was transiently reconstituted in LCN2-KO#1 cells by transfection with a (E) hLCN2 construct (n = 3) or by (F) adenoviral infection with Ad5-CMV-hLCN2 (Ad-hLCN2) (n = 2). Either a corresponding empty vector (control) or Ad5- CMV-GFP (Ad-GFP) served as controls. Cells were harvested for protein analysis after 24 h (E) or 48 h (F). Re-expression of LCN2 in LCN2-KO#1 cells resulted in increased IL-1β quantities. α-tubulin or β actin expression served as internal loading controls in Western blot analysis.

Journal: Cells

Article Title: Lipocalin-2 (LCN2) Deficiency Leads to Cellular Changes in Highly Metastatic Human Prostate Cancer Cell Line PC-3.

doi: 10.3390/cells11020260

Figure Lengend Snippet: Figure 5. LCN2 depletion in PC-3 cells resulted in reduced expression of pro-inflammatory cytokines. (A) Quantitative mRNA expression analysis of NFKBIZ, IL1B and CXCL8 was performed in PC-3 and LCN2-KO (#1, #4, #8) cells grown in basal conditions (n = 3). The mRNA expression of these genes was significantly reduced in all analyzed LCN2-KO cells test. mRNA expression was normalized to GAPDH and are given in relation to parenteral PC-3 cells. Differences between the groups reaching significance are indicated as ** p < 0.01, *** p < 0.001. (B) Western Blot analysis confirmed reduction in IκBζ, IL-1β and IL-8 protein expression in LCN2-KO cells compared to parental PC-3 cells (n = 3). (C) LCN2-KO#1 cells were stimulated for 48 h with indicated ratios of conditioned medium (CM) collected from PC-3 or LCN2-KO#1 cells. Western blot analysis revealed increased IL-1β quantities in LCN2-KO#1 cells, treated with CM from PC-3 cells (n = 3). (D) LCN2-KO#1 cells were stimulated with recombinant human LCN2 (rhLCN2, 100 ng/mL) for 24 h. Western blot analysis showed enhanced IL-1β expression in treated LCN2-KO#1 cells (n = 2). LCN2 was transiently reconstituted in LCN2-KO#1 cells by transfection with a (E) hLCN2 construct (n = 3) or by (F) adenoviral infection with Ad5-CMV-hLCN2 (Ad-hLCN2) (n = 2). Either a corresponding empty vector (control) or Ad5- CMV-GFP (Ad-GFP) served as controls. Cells were harvested for protein analysis after 24 h (E) or 48 h (F). Re-expression of LCN2 in LCN2-KO#1 cells resulted in increased IL-1β quantities. α-tubulin or β actin expression served as internal loading controls in Western blot analysis.

Article Snippet: A functionally validated human LCN2 knockout kit (OriGene Technologies, Herford, Germany, Cat# KN407685) was used, which consists of two gRNA vectors (gRNA1: ACAGGGCTAGGCCCAGCCAC, gRNA2: AGAGGGACCTTGCTCAGAGG) and the donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP.

Techniques: Expressing, Western Blot, Recombinant, Transfection, Construct, Infection, Plasmid Preparation, Control

Figure 6. LCN2 deficiency affects response to ER stress in vitro. Parental PC-3 and LCN2-KO#1 cells were treated with indicated concentrations of tunicamycin (TUN) for 24 h. Supernatants were collected, and lysates harvested for protein or mRNA analysis. (A) TUN treatment prevents glycosylation of LCN2 in PC-3 cells as evidenced by detection of non-glycosylated form of LCN2 (*LCN2) in both cell lysates and supernatants. Secreted LCN2 levels are shown with corresponding Ponceau S stain. (B) TUN treatment enhanced different unfolded protein response (UPR) markers on protein level (n ≥3) in LCN2-KO#1 and PC-3 cells. (C) Quantitative mRNA analysis of ATF4, PCNA and LCN2 was performed in PC-3 and LCN2-KO#1 cells treated with TUN (1 µg/mL) for 24 h (n = 3). Significant changes were detected between LCN2-KO cells compared to parenteral PC-3 cells. mRNA expression was normalized to GAPDH and given in relation to expression in parenteral PC-3 cells. Differences between the groups reaching significance are indicated as a ** p < 0.01, and *** p < 0.001, respectively. (D) PC-3 cells were treated with siLCN2 (35 nM) or scr siRNA for 24 h, while expression in LCN2-KO#1 cells were restored by transfection of a plasmid directing hLCN2 expression. Cells transfected with empty vector (EV) served as control. After 24 h, both cell lines were treated with TUN (1 µg/mL) for further 24 h and Western blot analysis were performed to detect p-eIF2α and LCN2 (n ≥2). (E) PC-3 and LCN2-KO#1 cells were cultured in medium with or without glucose (containing 0.5% or 10% FBS) for 48 h. Western blot analysis showed induction of p-eIF2α and ATF-4 in both cell lines, as well as non-glycosylated form of LCN2 (*LCN2) in PC-3 cells under glucose deprivation conditions (n = 3). In Western blot analysis, α-tubulin, β-actin, or GAPDH expression served as internal protein loading controls.

Journal: Cells

Article Title: Lipocalin-2 (LCN2) Deficiency Leads to Cellular Changes in Highly Metastatic Human Prostate Cancer Cell Line PC-3.

doi: 10.3390/cells11020260

Figure Lengend Snippet: Figure 6. LCN2 deficiency affects response to ER stress in vitro. Parental PC-3 and LCN2-KO#1 cells were treated with indicated concentrations of tunicamycin (TUN) for 24 h. Supernatants were collected, and lysates harvested for protein or mRNA analysis. (A) TUN treatment prevents glycosylation of LCN2 in PC-3 cells as evidenced by detection of non-glycosylated form of LCN2 (*LCN2) in both cell lysates and supernatants. Secreted LCN2 levels are shown with corresponding Ponceau S stain. (B) TUN treatment enhanced different unfolded protein response (UPR) markers on protein level (n ≥3) in LCN2-KO#1 and PC-3 cells. (C) Quantitative mRNA analysis of ATF4, PCNA and LCN2 was performed in PC-3 and LCN2-KO#1 cells treated with TUN (1 µg/mL) for 24 h (n = 3). Significant changes were detected between LCN2-KO cells compared to parenteral PC-3 cells. mRNA expression was normalized to GAPDH and given in relation to expression in parenteral PC-3 cells. Differences between the groups reaching significance are indicated as a ** p < 0.01, and *** p < 0.001, respectively. (D) PC-3 cells were treated with siLCN2 (35 nM) or scr siRNA for 24 h, while expression in LCN2-KO#1 cells were restored by transfection of a plasmid directing hLCN2 expression. Cells transfected with empty vector (EV) served as control. After 24 h, both cell lines were treated with TUN (1 µg/mL) for further 24 h and Western blot analysis were performed to detect p-eIF2α and LCN2 (n ≥2). (E) PC-3 and LCN2-KO#1 cells were cultured in medium with or without glucose (containing 0.5% or 10% FBS) for 48 h. Western blot analysis showed induction of p-eIF2α and ATF-4 in both cell lines, as well as non-glycosylated form of LCN2 (*LCN2) in PC-3 cells under glucose deprivation conditions (n = 3). In Western blot analysis, α-tubulin, β-actin, or GAPDH expression served as internal protein loading controls.

Article Snippet: A functionally validated human LCN2 knockout kit (OriGene Technologies, Herford, Germany, Cat# KN407685) was used, which consists of two gRNA vectors (gRNA1: ACAGGGCTAGGCCCAGCCAC, gRNA2: AGAGGGACCTTGCTCAGAGG) and the donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP.

Techniques: In Vitro, Glycoproteomics, Staining, Expressing, Transfection, Plasmid Preparation, Control, Western Blot, Cell Culture

KEY RESOURCES TABLE

Journal: Molecular cell

Article Title: Multisite phosphorylation of S6K1 directs a kinase phospho-code that determines substrate selection

doi: 10.1016/j.molcel.2018.11.017

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: siRNA targeting mouse LCN2 , Origene Technologies , Cat# SR405112.

Techniques: Virus, Recombinant, Purification, Mutagenesis, Cell Culture, Extraction, Staining, Protease Inhibitor, Western Blot, Silver Staining, Transfection, Affinity Chromatography, Plasmid Preparation, Control, Software