86
|
Eurofins
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping Lck Cre Fw Tgcaacgagtgatgaggttc Eurofins Genotyping, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/cre+eurofins+fw+genotyping+lck+tgcaacgagtgatgaggttc/pm40460200-785-123-126 Average 86 stars, based on 1 article reviews
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping - by Bioz Stars,
2026-11
86/100 stars
|
Buy from Supplier |
90
|
OriGene
lck Lck, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/LCK+(NM_005356)+Human+Tagged+ORF+Clone/pm23715271-290-9-10 Average 90 stars, based on 1 article reviews
lck - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
93
|
Addgene inc
dorus gadella Dorus Gadella, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/Lck-mScarlet-I+(Plasmid+%2398821)/bio_rxiv__64898__2026__02__09__703982-193-5-7 Average 93 stars, based on 1 article reviews
dorus gadella - by Bioz Stars,
2026-11
93/100 stars
|
Buy from Supplier |
93
|
Cell Signaling Technology Inc
lck Lck, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/Phospho-Lck+(Tyr505)+Antibody/pm37146474-63-21-26 Average 93 stars, based on 1 article reviews
lck - by Bioz Stars,
2026-11
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
lck gfp Lck Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/Lck-GFP+(Plasmid+%2361099)/pmc10933150-122-44-45 Average 93 stars, based on 1 article reviews
lck gfp - by Bioz Stars,
2026-11
93/100 stars
|
Buy from Supplier |
94
|
Addgene inc
pbob lck tdtomato Pbob Lck Tdtomato, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/pBOB-Lck-tdTomato+(Plasmid+%23118739)/pmc12670911-99-14-15 Average 94 stars, based on 1 article reviews
pbob lck tdtomato - by Bioz Stars,
2026-11
94/100 stars
|
Buy from Supplier |
95
|
Addgene inc
lck gcamp6s Lck Gcamp6s, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/pZac2%2E1+gfaABC1D-lck-GCaMP6f+(Plasmid+%2352924)/pmc12368035-123-0-1 Average 95 stars, based on 1 article reviews
lck gcamp6s - by Bioz Stars,
2026-11
95/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pn1 lck gcamp5g Pn1 Lck Gcamp5g, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/pN1+Lck-GCaMP5G+(Plasmid+%2334924)/pm28151556-65-36-37 Average 93 stars, based on 1 article reviews
pn1 lck gcamp5g - by Bioz Stars,
2026-11
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pn1 lck gcamp3 Pn1 Lck Gcamp3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/pN1-Lck-GCaMP3+(Plasmid+%2326974)/10__7554_slash_elife__28307-162-7-8 Average 93 stars, based on 1 article reviews
pn1 lck gcamp3 - by Bioz Stars,
2026-11
93/100 stars
|
Buy from Supplier |
93
|
Cell Signaling Technology Inc
rabbit antibody to Rabbit Antibody To, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/lck/Lck+Rabbit+mAb/10__1074_slash_jbc__m702959200-72-54-60 Average 93 stars, based on 1 article reviews
rabbit antibody to - by Bioz Stars,
2026-11
93/100 stars
|
Buy from Supplier |