Journal: Nature Communications

Article Title: Lysosome-targeting live attenuated influenza vaccines elicit robust and broad immunity in mice

doi: 10.1038/s41467-026-69920-0

Figure Lengend Snippet: a LTM-dependent degradation of viral NS1 protein. Western blot analysis shows reduced NS1 protein levels in cells expressing NS1-N LTM compared with the N LTM mutant , while NS1 mRNA levels remain comparable ( n = 3). b Lysosome dependence of LTM-mediated NS1 degradation. NS1-N LTM protein degradation is blocked by lysosomal inhibitors but not by proteasome or autophagy inhibition. HEK293T cells expressing either NS1-N LTM (left) or NS1-N LTM mutant (right) protein were cultured with or without the proteasome inhibitor MG-132 (10 µM), the autophagy inhibitor 3-methyladenine (3-MA; 10 mM), bafilomycin A1 (Baf A1; 0.4 µM), or chloroquine (CQ; 50 µM) for 6 h. The viral NS1 protein was detected by Western blotting ( n = 3). c Co-immunoprecipitation demonstrating interaction of HSC70 with NS1-N LTM but not with the NS1 LTM mutant ( n = 3). d Dependence of LTM-mediated NS1 degradation on LAMP2A. Conventional HEK293T cells and LAMP2A-KO HEK293T cells were transfected with constructs expressing NS1-N LTM (left) or NS1-N LTM mutant (right) protein and collected 24 h post-transfection. Viral NS1 protein was detected by Western blotting ( n = 3). Immunofluorescence analysis showing colocalization of NS1-N LTM with HSC70 ( e ) and LAMP2A ( f ), but not of the NS1-N LTM mutant . Green, NS1; red, HSC70 or LAMP2A; blue, nuclei; yellow, colocalization sites; scale bar, 5 µm. Representative images of at least three independent experiments are shown. LAMP2A-dependent degradation of NS1-N LTM during viral infection in conventional and LAMP2A-KO HEK293T ( g ) and A549 ( h ) cells. Replication competence of NS1-N LTM and NS1-N LTM mutant viruses in conventional and LAMP2A-KO HEK293T ( i ) and A549 ( j ) cells. Immunofluorescence staining of influenza viral M1 protein at 48 h after infection (MOI = 0.01) showing the replication competence of NS1-N LTM or NS1-N LTM mutant virus in conventional and LAMP2A-KO cells. Green, M1; blue, nuclei; scale bar, 100 µm. Viral titers in culture supernatants were quantified by immunofluorescence focus-forming unit (FFU) assay ( n = 3). Data are means ± s.d; n = 3 biologically independent experiments; unpaired two-tailed t -test for ( i ) and ( j ); *** P < 0.001. Source data are provided as a Source Data file.

Article Snippet: After another 6 h of culture, the cells were washed with PBS, fixed with 4% paraformaldehyde (PFA) for 20 min at room temperature, washed with PBS, permeabilized with PBS containing 0.1% Triton X-100 for 5 min, blocked with PBS containing with 0.1% Triton X-100 and 10% goat serum for 1 h at room temperature, and incubated with anti-Flag antibody (MBL, Cat# PM020; 1:1000 dilution) and anti-HSC70 antibody (Santa Cruz Biotechnology, Cat# sc-7298; 1:300 dilution) or anti-LAMP2A antibody (Santa Cruz Biotechnology, Cat# sc-18822; 1:300 dilution) diluted in PBS containing 0.1% Triton X-100 and 1% goat serum overnight at 4 °C, followed by incubation with Alexa Fluor 488 goat anti-rabbit IgG (Life Technologies, Cat# A11034; 1:1000 dilution) and Alexa Fluor 555 goat anti-mouse IgG (Life Technologies, Cat# A32727; 1:1000 dilution) for 1 h at room temperature.

Techniques: Western Blot, Expressing, Mutagenesis, Inhibition, Cell Culture, Immunoprecipitation, Transfection, Construct, Immunofluorescence, Infection, Staining, Virus, Two Tailed Test

Journal: Nature Communications

Article Title: Lysosome-targeting live attenuated influenza vaccines elicit robust and broad immunity in mice

doi: 10.1038/s41467-026-69920-0

Figure Lengend Snippet: a Schematic illustration depicting the design and generation of LYTAR 2.0 influenza viruses. LYTAR 2.0 viruses are attenuated in conventional cells through LTM-mediated viral protein degradation by the CMA system but can replicate efficiently in LAMP2A-knockout (KO) cells. VP stands for viral protein. b Western blots showing the dependence of LTM-mediated viral protein degradation on the lysosome. HEK293T cells expressing the indicated viral proteins were cultured in the presence or absence of Baf A1 (0.4 µM) for 6 h. The viral proteins were detected by Western blotting ( n = 3). c Western blots showing the LAMP2A dependency of LTM-mediated viral protein degradation. Conventional HEK293T cells and LAMP2A-KO HEK293T cells were transfected with constructs expressing the indicated viral proteins and collected 24 h post-transfection for viral protein detection by Western blotting ( n = 3). d Western blots showing the LAMP2A dependency of LTM-mediated viral protein degradation in HEK293T cells. Conventional HEK293T cells and LAMP2A-KO HEK293T cells were infected with the indicated LYTAR 2.0 viruses and collected 48 h post-infection for detection of viral proteins by Western blotting ( n = 3). e Western blots showing the LAMP2A dependence of LTM-mediated viral protein degradation in A549 cells. Conventional A549 cells and LAMP2A-KO A549 cells were infected with the indicated LYTAR 2.0 viruses and collected 48 h post-infection for detection of viral proteins by Western blotting ( n = 3). Source data are provided as a Source Data file.

Article Snippet: After another 6 h of culture, the cells were washed with PBS, fixed with 4% paraformaldehyde (PFA) for 20 min at room temperature, washed with PBS, permeabilized with PBS containing 0.1% Triton X-100 for 5 min, blocked with PBS containing with 0.1% Triton X-100 and 10% goat serum for 1 h at room temperature, and incubated with anti-Flag antibody (MBL, Cat# PM020; 1:1000 dilution) and anti-HSC70 antibody (Santa Cruz Biotechnology, Cat# sc-7298; 1:300 dilution) or anti-LAMP2A antibody (Santa Cruz Biotechnology, Cat# sc-18822; 1:300 dilution) diluted in PBS containing 0.1% Triton X-100 and 1% goat serum overnight at 4 °C, followed by incubation with Alexa Fluor 488 goat anti-rabbit IgG (Life Technologies, Cat# A11034; 1:1000 dilution) and Alexa Fluor 555 goat anti-mouse IgG (Life Technologies, Cat# A32727; 1:1000 dilution) for 1 h at room temperature.

Techniques: Knock-Out, Western Blot, Expressing, Cell Culture, Transfection, Construct, Infection

Journal: Nature Communications

Article Title: Lysosome-targeting live attenuated influenza vaccines elicit robust and broad immunity in mice

doi: 10.1038/s41467-026-69920-0

Figure Lengend Snippet: a Multi-cycle replication kinetics of the indicated viruses in conventional and LAMP2A-KO MDCK cells. Data are presented as means ± s.d ( n = 3). b triLTM-dependent degradation of viral proteins. Western blot analysis shows reduced levels of triLTM-tagged viral proteins compared with mutated triLTM-tagged controls, while corresponding mRNA levels remain comparable ( n = 3). c Lysosome dependence of triLTM-mediated viral protein degradation. HEK293T cells expressing triLTM-tagged or mutated triLTM-tagged viral proteins were cultured in the presence or absence of Baf A1 (0.4 µM) for 6 h and collected for detection of indicated viral proteins by Western blotting ( n = 3). d Co-immunoprecipitation demonstrating interaction of HSC70 with triLTM-tagged viral proteins but not with mutated triLTM-tagged viral proteins ( n = 3). LAMP2A-dependent degradation of triLTM-tagged viral proteins during viral infection in conventional and LAMP2A-KO HEK293T ( e ) and A549 ( f ) cells ( n = 3). Conventional cells and LAMP2A-KO cells were infected with LYTAR 2.0 dual triLTMs or LYTAR 2.0 dual triLTMs mutant virus and collected at 48 h after infection for detection of indicated proteins by Western blotting ( n = 3). Replication competence of LYTAR 2.0 dual triLTMs and LYTAR 2.0 dual triLTMs mutant viruses in conventional and LAMP2A-KO HEK293T ( g ) and A549 ( h ) cells. Immunofluorescence staining of influenza viral M1 protein at 48 h after infection (MOI = 0.01) showing the replication competence of LYTAR 2.0 dual triLTMs and LYTAR 2.0 dual triLTMs mutant virus in conventional and LAMP2A-KO HEK293T cells. Green, M1; blue, nuclei; scale bar, 100 µm. Viral titers in culture supernatants were quantified by immunofluorescence focus-forming unit (FFU) assay ( n = 3). Data are means ± s.d; n = 3 biologically independent experiments; unpaired two-tailed t -test for ( g ) and ( h ); *** P < 0.001. Source data are provided as a Source Data file.

Article Snippet: After another 6 h of culture, the cells were washed with PBS, fixed with 4% paraformaldehyde (PFA) for 20 min at room temperature, washed with PBS, permeabilized with PBS containing 0.1% Triton X-100 for 5 min, blocked with PBS containing with 0.1% Triton X-100 and 10% goat serum for 1 h at room temperature, and incubated with anti-Flag antibody (MBL, Cat# PM020; 1:1000 dilution) and anti-HSC70 antibody (Santa Cruz Biotechnology, Cat# sc-7298; 1:300 dilution) or anti-LAMP2A antibody (Santa Cruz Biotechnology, Cat# sc-18822; 1:300 dilution) diluted in PBS containing 0.1% Triton X-100 and 1% goat serum overnight at 4 °C, followed by incubation with Alexa Fluor 488 goat anti-rabbit IgG (Life Technologies, Cat# A11034; 1:1000 dilution) and Alexa Fluor 555 goat anti-mouse IgG (Life Technologies, Cat# A32727; 1:1000 dilution) for 1 h at room temperature.

Techniques: Western Blot, Expressing, Cell Culture, Immunoprecipitation, Infection, Mutagenesis, Virus, Immunofluorescence, Staining, Two Tailed Test

Journal: Advanced science (Weinheim, Baden-Wurttemberg, Germany)

Article Title: Activation and Purification of ß-Glucocerebrosidase by Exploiting its Transporter LIMP-2 - Implications for Novel Treatment Strategies in Gaucher's and Parkinson's Disease.

doi: 10.1002/advs.202401641

Figure Lengend Snippet: Figure 1. Interaction of GCase variants with their lysosomal transporter LIMP-2. A) Crystal structure of GCase (PDB: 5LVX).[44] The domains and motifs are colored as follows: pink: antiparallel beta-sheet (domain 1); grey: TIM barrel (domain 2) containing active site (green); blue: beta-barrel (domain 3);[45] orange: proposed LIMP-2-binding motif.[42] Single amino acids comprising the active site, as well as amino acids exchanged in common disease- associated GCase variants E326K, N370S, and L444P are labeled and highlighted. B) GCase activity in cell lysates of HEK 293T cells overexpressing GCase variants (n = 3-8; mock: 8; wt: 8; E326K: 5; N370S: 3; L444P: 5; individual transfections). All disease-associated variants show significantly reduced activity. E326K shows a residual activity of 40.0 ± 2.2%, N370S, and L444P do not differ significantly from the mock. C) Illustration of the lysosomal transport of GCase and its interaction with LIMP-2. GCase binds to LIMP-2 in the ER to form a transporting complex. After trafficking through the Golgi, the LIMP-2/GCase complex is sorted to lysosomal compartments where low pH triggers complex dissociation. D) Western blot analyses of whole-cell lysates and LE fractions of HEK 293T cells expressing GCase variants and FL-LIMP-2 or FL-LIMP-2-3xD as a control. LE fractions are higher in GCase, LIMP-2, and the lysosomal protein LAMP-2A. Enriched fractions of cells overexpressing FL-LIMP-2 show increased levels of GCase. Blots containing a dashed line were spliced for a more comprehensive data presentation (both parts are from the same image). E) Quantification of western blot signal from lysate and LE HEK 293T samples (Figure 1D) (n = 3-6; mock: 6; wt: 6; E326K: 3; N370S: 3; L444P: 3; individual cell harvests). The abundance of wt, E326K, and N370S GCase was significantly increased in LE fractions when FL-LIMP-2 was co-expressed compared to the co-expression of the non- binding 3xD control. In general, the GCase signal was increased in LE fractions but did not reach statistical significance for FL-LIMP-2-3xD samples and FL-LIMP-2 + L444P. F) GCase activity in cell lysates and LE fractions of HEK 293T cells overexpressing GCase variants and FL-LIMP-2 or FL-LIMP-2-3xD (n = 3-7; mock: 7; wt: 7; E326K: 4; N370S: 3; L444P: 4; individual cell harvests). Overexpression of FL-LIMP-2 resulted in an increase of GCase activity in the lysate itself, but also in the LE fraction for wt GCase and the E326K variant, while no significant differences were observed for the N370S and

Article Snippet: Following antibodies and dilution factors were used for western blot analysis: Primary: goat anti LIMP2 (polyclonal, ThermoFisher Scientific Inc., Waltham, MA, United States, #PA5-19111; dilution: 1:1000), mouse anti GCase (monoclonal, clone E2E, Abnova, Taipeh, Taiwan,#H00002629-M01; dilution: 1:1000), rabbit anti GCase (polyclonal, Sigma-Aldrich, St. Louis, MO, United States, #G4171; dilution: 1:1000), rabbit anti LAMP-2A (monoclonal, clone SA4601, Novus Biologicals, Centennial, CO, United States, #NBP2-67298; dilution: 1:1000), goat anti GAPDH (polyclonal, R&D Systems, Minneapolis, MN, United States, #AF5718; dilution: 1:5000), rabbit anti calnexin (polyclonal, Cell Signaling Technology, Danvers, MA, United States, #2433, dilution: 1:1000).

Techniques: Binding Assay, Labeling, Activity Assay, Transfection, Western Blot, Expressing, Control, Over Expression, Variant Assay

Journal: Advanced science (Weinheim, Baden-Wurttemberg, Germany)

Article Title: Activation and Purification of ß-Glucocerebrosidase by Exploiting its Transporter LIMP-2 - Implications for Novel Treatment Strategies in Gaucher's and Parkinson's Disease.

doi: 10.1002/advs.202401641

Figure Lengend Snippet: Figure 2. Characterization of primary human fibroblasts of controls and patients with PD and GD. A) Western blot of whole cell lysates from control (CTRL-1,2,3), PD patient-derived (PD-1,2), and GD patient-derived (GD) primary human fibroblasts. Quantitative analysis of signals can be found in Figure S3 (Supporting Information). GCase levels were comparable between control and PD but diminished in GD (Figure S3A, Supporting Information). LIMP-2 levels were increased in PD compared to controls (Figure S3B, Supporting Information). LAMP-2A and calnexin levels varied between cell lines and did not show any significant trend between groups (Figure S3C,D, Supporting Information). GAPDH and CBB staining of the gel are presented as loading controls. B) GCase activity in whole-cell lysates of control, PD, and GD fibroblast cell lines (n = 3-7; CTRL-1,2,3: 7; PD-1,2: 7; GD: 3; individual cell harvests). The E326K lines PD-1 and PD-2 showed significantly lower GCase activity (66.41±2.69% and 73.56±6.50%) compared to the control lines. In contrast, activity in the GD line (GBA1L444P/L444P) was almost fully abolished (3.11±0.11% residual activity). C) Colocalization of LIMP-2 and GCase in primary human fibroblasts determined via Pearson’s correlation coefficient (n = CTRL-1: 30; CTRL-2: 38; CTRL-3: 33; PD-1: 44; PD-2: 51; GD: 27; individual cells from multiple images). PD patient fibroblasts PD-1 and PD-2 show mildly reduced colocalization of LIMP-2 and GCase compared to control lines. In the GD patient line, colocalization was diminished even further. D) Representative immunofluorescence images of primary human fibroblast lines. Objective magnification: 40x. Green: LIMP-2; red: GCase, blue: DAPI. All lines show the vesicular distribution of LIMP-2, indicating lysosomes. Control and PD lines show visible colocalization of GCase with the LIMP-2 signal. In GD fibroblasts, the GCase signal was less intense and less granular, representing lower expression and lysosomal localization. Statistics: replicates (dots) with mean (column) ± SEM (B); violin plot with median (dashed line) and quartiles (dotted line) (C). Tests: Nested one-way ANOVA with Tukey’s multiple comparison test (B,C). * p < 0.05; ** p < 0.01; **** p < 0.0001.

Article Snippet: Following antibodies and dilution factors were used for western blot analysis: Primary: goat anti LIMP2 (polyclonal, ThermoFisher Scientific Inc., Waltham, MA, United States, #PA5-19111; dilution: 1:1000), mouse anti GCase (monoclonal, clone E2E, Abnova, Taipeh, Taiwan,#H00002629-M01; dilution: 1:1000), rabbit anti GCase (polyclonal, Sigma-Aldrich, St. Louis, MO, United States, #G4171; dilution: 1:1000), rabbit anti LAMP-2A (monoclonal, clone SA4601, Novus Biologicals, Centennial, CO, United States, #NBP2-67298; dilution: 1:1000), goat anti GAPDH (polyclonal, R&D Systems, Minneapolis, MN, United States, #AF5718; dilution: 1:5000), rabbit anti calnexin (polyclonal, Cell Signaling Technology, Danvers, MA, United States, #2433, dilution: 1:1000).

Techniques: Western Blot, Control, Derivative Assay, Staining, Activity Assay, Expressing, Comparison

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 2 | Shotgun SILAC-proteomics discovery approach. (a) Schematic of stable isotope labelling with amino acid in cell culture for MS analysis (SILAC-MS/MS). Acid-adapted and naive MCF-7 cells were grown either in media of normal isotopic distribution or in heavy (D6-Lys, D 10-Arg) medium for eight doublings (1 week). The cells were collected and lysed and combined for equal protein loads between the two groups. A label-flipping approach was employed through a parallel experiment, allowing for confident quantification and reducing false-positive biomarker associations. (b) The Venn diagrams show the number of protein discovered in each flipping experiment. The number underneath the diagram is the total protein number. Orange is the number of proteins with heavy label and blue with the light label. The graph beside the Venn diagram is observed log2 peak area ratios for flipping experiments plotted on the same graph. Candidate biomarkers were selected among proteins showing at least a 1.5-fold increase in expression under acidic conditions in both replicates across flipping experiments. (c) A Pie chart of proteins with increased expression in acid-adapted cells. In all, 45% of the proteins are cytoplasmic and 55% membrane proteins of which 12.8% are lysosomal and endosome proteins. (d) LC-MRM validation of discovered low-pH-induced proteins. MS/MS spectra of peptides from LAMP2 shown here, was extracted from our shotgun data set and used for the development of targeted multiple reaction monitoring (MRM) assays (optimized transitions indicated in red). Bottom panel: relative quantification was accomplished by comparing peak areas using Skyline.

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Multiplex sample analysis, Cell Culture, Tandem Mass Spectroscopy, Biomarker Discovery, Expressing, Membrane, Targeted Proteomics

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 3 | In vitro confirmation of proteomics results. (a) Quantitative reverse transcription–PCR and (b) western blot and (c) ICC results confirmed the higher expression level of LAMP2 in AA cells relative to NA MCF-7 cells. (d) LAMP2 siRNA treatment of NA and AA MCF-7 cells decreased the viability of acid-adapted cells much more than non-adapted cells. (e) siRNA treatment of spheres of AA and NA MCF-7 cells revealed that growth and size of AA spheres are affected by LAMP2 expression. The graph shows the average pixel count of spheres from both groups with error bars as s.d. (f) Representative images of spheroid 3D culture model (Rotary system) of MCF-7 cells showing the increased expression of LAMP2 close to the central part of the tumours at the oxygen diffusion limit (B200 mm). (g) Representative images of heterogeneous LAMP2 expression (black arrow in IHC analysis) indicate high expression of LAMP2 at the suspected acidic regions of mouse tumour xenografts, such as the necrotic area neighbourhood and invasive edges.

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: In Vitro, Reverse Transcription, Western Blot, Expressing, Diffusion-based Assay

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 4 | Correlation of marker expression with tumour pH using intravital imaging of SNARF-1 in DWC followed by IHC staining. (a) Regional extracellular tumour pH was determined by intravital imaging of the pH-sensitive fluorescent dye, SNARF-1, in breast cancer DWC xenograft tumours using an olympus multiphoton microscope. (b) Representative pH maps generated by the SNARF-1 ratiometric analysis on day 16 post tumour inoculation. Acidity ranges from low pH (black) to normal pH (white), meaning black is the most acidic area and white the least. (c) After the final SNARF-1 imaging, the tumours were extracted and fixed in the same orientation they were imaged and IHC stained for LAMP2 expression. The two left panels represent images of marker IHC staining for LAMP2 in two magnifications. (d) IHC staining images superimposed over the corresponding pH map (white, light grey, dark grey and black) to correlate the acidity of each region to expression of LAMP2 in the corresponding area. The stained tumours in each mapped region for acidity were analysed using positive pixel analysis by our custom-trained software in Definiene. The number in each box represents the percentage of cells that are LAMP2 positive. The correlation analysis showed significantly higher expression of LAMP2 in acidic areas of the tumours compared with non-acidic regions (Student’s t-test, Po0.001 and error bars represent s.d.).

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Marker, Expressing, Imaging, Immunohistochemistry, Microscopy, Generated, Staining, Software

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 5 | Effect of NaHCO3 buffer therapy on LAMP2 expression. (a) IHC staining of LAMP2 in representative cross-sections of ZR-75.1 tumours treated with tap water and NaHCO3 (left) or tap water (right), respectively. Positive pixel analysis of LAMP2 staining was carried out using Aperio Positive Pixel Count v9 (two columns in the middle; red is strong positive). (b) Positive pixel analysis of LAMP2 was compared with GLUT1 and CA9 as controls. A significant decrease in the percentage of strong positive LAMP2 pixels was observed in NaHCO3-treated cross-sections with much less decrease in GLUT1 expression and no significant change in CA9 expression. The data are plotted as the mean þ s.d.) of six tumour per mouse from each group. (c) Bioluminescence images of luciferase activity in the primary tumours of MDA-mb-231/Luc with non-silencing shRNA (left) versus LAMP2 knockdown clone D5 (right) xenografted in nude mice. LAMP2 knockdown tumours had less activity and grew more slowly. (d) Tumour size comparison of knocked down LAMP2 clones versus the non-silencing group using caliper. LAMP2 knockdowns had very slow growth rate at the early stage of tumour growth. (e) Representative images of metastases into axillary lymph node of LAMP2 knockdown cells (N ¼ 5 mice) and non-silencing vector cells (N ¼ 5 mice). Knocking down LAMP2 reduces the metastasis of cancer cells significantly (Student’s t-test, Po0.001, error bars represents mean with s.d.).

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Expressing, Immunohistochemistry, Staining, Luciferase, Activity Assay, shRNA, Knockdown, Comparison, Clone Assay, Plasmid Preparation

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 6 | Translational study for LAMP2 expression in breast cancer samples. (a) Microarray mRNA expression profile of LAMP2 in breast cancer tumours and normal tissue samples. Data are represented as mean þ s.d. Note the log10 scale of RNA expression. (b) Percent positivity of LAMP2 IHC staining of cores from the breast cancer patient samples TMA containing 201 biopsy cores. A consecutive raise in LAMP2-positive staining pattern was observed with the progress of breast tumours from DCIS to invasive ductal carcinoma with metastasis. (c) Representative images of analysed TMA cores from each stage with the corresponding illustration from the schematic model of breast cancer progression at the bottom. (d) Overexpression of LAMP2 in acidic regions of breast cancer tumours. IHC staining of a DCIS with LAMP2 antibody showed overexpression of this protein in regions expected to be more acidic such as centres of DCIS or DCIS with microinvasion. Underneath each IHC panel is a colour-coded picture of the IHC section based on LAMP2 positivity (0–3) for better understanding.

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Expressing, Microarray, RNA Expression, Immunohistochemistry, Staining, Over Expression

Journal: Nature communications

Article Title: Chronic acidosis in the tumour microenvironment selects for overexpression of LAMP2 in the plasma membrane.

doi: 10.1038/ncomms9752

Figure Lengend Snippet: Figure 7 | Proposed acid-adaptation mechanism. (a) LAMP2 expression in normal and cancer cells in breast tumour samples. LAMP2 membrane overexpression is indicated by arrows in breast cancer tumours (DCIS) in the right-most image that is a zoom-in of the yellow box in its neighbour. (b) LAMP2 expression in chronically acid-adapted cells versus non-adapted by ICC. To make sure LAMP2 is at the cell surface and not just cell periphery, we added wheat germ agglutinin (WGA) as a membrane marker to the cells; co-registration of LAMP2 and WGA was measured (merge) and confirmed membrane expression of LAMP2. (c) Membrane expression of LAMP2. Western blot of membrane protein extracted from AA and NA MCF-7 cells shows higher expression of LAMP2 at the cell surface of AA cells. (d) Schematic presentation of LAMP2 role in acid adaptation of cancer cells. In chronic acidosis, a possible mechanism could involve the exocytosis of more acidic lysosomes. This strategy helps the cells to secrete large amounts of acid in one step, and also by presenting of LAMP2 at the cell membrane protects themselves from acid degradation. LAMP2 with hydrated hyper-branched carbohydrate chains can protect the membrane against acidity. (e) The cathepsin-B assay in the media of AA and NA MCF-7 cells; AA MCF-7 cells secrete significantly more cathepsin B into their extracellular environment, consistent with increased lysosomal turnover rates.

Article Snippet: LAMP2 siRNAs (Trilencer-27: 27mer siRNA, Origene) were transfected using Lipofectamine RNAiMAX (Invitrogen # 13778030) according to the manufacturer’s protocol.

Techniques: Expressing, Membrane, Over Expression, Marker, Western Blot

Journal: Journal of Personalized Medicine

Article Title: NLRP3 Inflammasome Is Involved in Cocaine-Mediated Potentiation on Behavioral Changes in CX3CR1-Deficient Mice

doi: 10.3390/jpm11100963

Figure Lengend Snippet: The levels of lysosomal markers in cocaine-treated WT and CX3CR1−/− mice. ( A , B ) Representative WBs showed increased levels of LAMP2 glycosylated form but not for its native form in the striatum of CX3CR1−/− mice compared to WT mice with cocaine administration ( n = 4–6, * p < 0.05). ( C , D ) Representative WBs showed increased levels of LAMP2 native and glycosylated form in the hippocampus of CX3CR1−/− mice compared to WT mice with cocaine administration ( n = 4–6, * p < 0.05). ( E , F ) Representative WBs showed increased levels of mature Cat D in the striatum of CX3CR1−/− mice compared to WT mice with cocaine administration ( n = 4–6, * p < 0.05). ( G , H ) Representative WBs showed increased levels of both pro- and mature Cat D in the hippocampus of CX3CR1−/− mice compared to WT mice with cocaine administration ( n = 4–6, * p < 0.05).

Article Snippet: Antibodies including ASC (1:1000; NBP1-78977), LC3II (1:3000; NB100-2220), CD11b (1:1000, NB110-89474), LAMP2 (1:1000, NB300-591), Iba-1 (1:1000, NB100-1028) were purchased from Novus Biologicals (Centennial, CO, USA); IL1β (1:2000; 65-0812R) was from Bioss (Woburn, MA, USA), Cathepsin D (1:1000, ab75852) was from Abcam (Waltham, MA, USA).

Techniques:

Journal: Journal of Personalized Medicine

Article Title: NLRP3 Inflammasome Is Involved in Cocaine-Mediated Potentiation on Behavioral Changes in CX3CR1-Deficient Mice

doi: 10.3390/jpm11100963

Figure Lengend Snippet: CX3CR1 deficiency regulated lysosomal biogenesis process in the brain at basal conditions. ( A ) Representative WBs showed increased levels of LAMP2 glycosylated form in the striatum of CX3CR1−/− mice compared to WT controls under basal levels ( n = 4–6, * p < 0.05). ( B ) Representative WBs showed increased levels of LAMP2 glycosylated form in the hippocampus of CX3CR1−/− mice compared to WT controls at basal levels ( n = 4–6, * p < 0.05). ( C ) Representative WBs showed increased levels of mature cathepsin D in the striatum but not in hippocampus of CX3CR1−/− mice compared to WT controls under basal levels ( n = 4–6, * p < 0.05). ( D ) Statistical analysis for mature Cat D WBs shown in ( C ).

Article Snippet: Antibodies including ASC (1:1000; NBP1-78977), LC3II (1:3000; NB100-2220), CD11b (1:1000, NB110-89474), LAMP2 (1:1000, NB300-591), Iba-1 (1:1000, NB100-1028) were purchased from Novus Biologicals (Centennial, CO, USA); IL1β (1:2000; 65-0812R) was from Bioss (Woburn, MA, USA), Cathepsin D (1:1000, ab75852) was from Abcam (Waltham, MA, USA).

Techniques:

Journal: Journal of Virology

Article Title: Antagonism of epidermal growth factor receptor signaling favors hepatitis E virus life cycle

doi: 10.1128/jvi.00580-24

Figure Lengend Snippet: HEV-replicating cells show increased internalization of EGFR into lysosomal structures. Uninfected and persistently HEV-infected A549 cells were treated with 200 µM leupeptin for 24 h. ( A ) Representative confocal microscopy images of uninfected (top) and persistently HEV-infected (bottom) A549 cells immunostained for pORF2 (green), EGFR (red), and LAMP2 (cyan) after EtOH fixation. Nuclei were counterstained with DAPI (blue). Cell shown in the zoom section is indicated within the merge image. Scale bar: 40 µm. ( B ) Quantification of co-localization between cyan LAMP2 signal and red EGFR signal in panel A, depicted as tMOC per cell; N = 2; n ≥ 10. Data are presented as mean with SEM. ( C ) CTCF quantification of EGFR intensity in confocal microscopy images described in panel A; n = 20. Statistical analysis was performed using unpaired t -tests with Holm-Sidak correction for multiple-group comparison: ns: not significant; * P < 0.05, *** P < 0.001, and **** P < 0.0001. ( D ) Profile plot of region indicated in panel A (white arrow) corroborates the localization of EGFR (red) and HEV pORF2 (green) in LAMP2-positive structures (cyan). ( E and F ) 3D reconstruction of cell depicted in panel A clipped within the z-axis ( E ) or y-axis ( F ). White arrows indicate EGFR (red) inside LAMP2-positive structures (cyan). ( G ) Determination of EGFR protein half-life via a CHX chase assay in uninfected (uninf.) and persistently HEV-infected A549 cells (pers. inf.). Representative western blot of HEV pORF2 (blue = unglycosylated, gray = glycosylated), EGFR, p62, β-tubulin, and GAPDH over a time of 3 h post CHX treatment. ( H and I ) Quantification of EGFR ( H ) or p62 ( I ) amounts in panel G, shown as relative change in protein amount referred to 0 min treatment (set to 100%); N ≥ 3. A one-phase decay model was applied with an intercept of y (0) = 100 and a plateau of y = 0. Microscopy was performed on Leica TCS SP8 system with 100× objective (numerical aperture 1.4).

Article Snippet: Primary antibodies against pORF2 (HCD3K129, polyclonal rabbit α-pORF2, raised against aa112-608 of recombinant pORF2 protein), pORF3 (HPO3.1A6, purified polyclonal rabbit α-pORF3, raised against recombinant pORF3 protein), LAMP2 (polyclonal goat α-LAMP-2, AF6228; R&D Systems, Minneapolis, USA), EGFR (monoclonal mouse α-EGFR, sc-120, Santa Cruz Biotechnology), and CD63 (monoclonal mouse α-CD63, ab59479, Abcam) were incubated as previously described ( ).

Techniques: Infection, Confocal Microscopy, Comparison, Western Blot, Microscopy

Journal: Journal of Virology

Article Title: Antagonism of epidermal growth factor receptor signaling favors hepatitis E virus life cycle

doi: 10.1128/jvi.00580-24

Figure Lengend Snippet: Erlotinib treatment interferes with intracellular cholesterol homeostasis. Uninfected and persistently HEV-infected A549 cells were treated with erlotinib (25 µM) for 48 h and fixed with FA. ( A ) Representative confocal microscopy images immunostained for HEV pORF2 (green) and LAMP2 (red). Intracellular cholesterol was counterstained with filipin (magenta) and acidic organelles with lysotracker (cyan). Cell shown within the zoomed merge section is indicated within the filipin image. Scale bar: 40 µm. ( B ) Quantification of filipin CTCF per cell in panel A; n ≥ 19. Microscopy was performed on Leica TCS SP8 system with 100× objective (numerical aperture 1.4). ( C ) Quantification of colocalization (tMOC) per cell for magenta filipin signal present in red LAMP2 areas in panel A; n ≥ 20. ( D ) Quantification of lysotracker intensity as CTCF per cell in panel A; n ≥ 15. ( E ) Quantification of HEV pORF2 intensity as CTCF per cell in panel A; n ≥ 23. ( F ) Representative western blot of HEV pORF2 (blue = unglycosylated, gray = glycosylated) in lysates of uninfected and persistently HEV-infected A549 cells as well as density-gradient fractions loaded with supernatant (SN) from persistently HEV-infected A549 cells. ( G ) Extracellular HEV RNA in fractions of density-gradients as determined by qRT-PCR; depicted as % of whole genomes in gradient; N = 5. All statistics refer to respective untreated control (DMSO) or uninfected A549 cells as indicated. Unpaired t -tests with Holm-Sidak correction for multiple-group comparison: ** P < 0.01 and **** P < 0.0001.

Article Snippet: Primary antibodies against pORF2 (HCD3K129, polyclonal rabbit α-pORF2, raised against aa112-608 of recombinant pORF2 protein), pORF3 (HPO3.1A6, purified polyclonal rabbit α-pORF3, raised against recombinant pORF3 protein), LAMP2 (polyclonal goat α-LAMP-2, AF6228; R&D Systems, Minneapolis, USA), EGFR (monoclonal mouse α-EGFR, sc-120, Santa Cruz Biotechnology), and CD63 (monoclonal mouse α-CD63, ab59479, Abcam) were incubated as previously described ( ).

Techniques: Infection, Confocal Microscopy, Microscopy, Western Blot, Quantitative RT-PCR, Control, Comparison

Journal: Journal of Virology

Article Title: Antagonism of epidermal growth factor receptor signaling favors hepatitis E virus life cycle

doi: 10.1128/jvi.00580-24

Figure Lengend Snippet: EGFR inhibition promotes the endosomal system used by HEV for viral release. Uninfected and persistently HEV-infected A549 cells were treated with erlotinib (25 µM) for 48 h and fixed with EtOH. ( A ) Representative confocal microscopy images immunostained for HEV pORF2 (green), CD63 (red), and LAMP2 (cyan). Nuclei were counterstained with DAPI (blue). Cell shown in the zoom section is indicated within the merge image. Scale bar: 40 µm. Microscopy was performed on Leica TCS SP8 system with 100× objective (numerical aperture 1.4). ( B ) Quantification of CD63 CTCF per cell in panel A; n ≥ 17. ( C ) Quantification of colocalization (tMOC) per cell for green HEV pORF2 signal present in red CD63 areas in panel A; n ≥ 14. ( D ) Quantification of colocalization (tMOC) per cell for red CD63 signal present in cyan LAMP2 areas in panel A for uninfected and persistently HEV-infected cells; n ≥ 10. ( E ) Relative change in amount of intracellular syntaxin 17 (STX17) mRNA after erlotinib treatment (12.5 µM or 25 µM) for 48 h in uninfected and persistently HEV-infected A549 cells. Values refer to untreated control and were normalized toward the respective reference gene hRPL27; N = 5. All statistical analyses were performed using unpaired t -test related to respective untreated A549 cells (DMSO): * P < 0.05, ** P < 0.01, and **** P < 0.0001. ( F–H ) Volcano plot for predicted kinase activity. Shown are significantly up- (red dots) or downregulated (blue dots) kinases either upon 48 h erlotinib treatment (25 µM) in uninfected ( F ) and persistently HEV-infected ( G ) A549 cells compared to the untreated control (DMSO) or upon HEV infection comparing untreated persistently HEV-infected A549 cells with respective uninfected control ( H ). A mean final score above 1.3 was considered to be significant. Several autophagy-related kinases that were significantly changed in their activity were labeled by name. ( I ) Schematic representation of HEV- and erlotinib-based induction of the autophagy pathway. HEV impairment of lysosomal acidification changes the fate of autophagosomal structures.

Article Snippet: Primary antibodies against pORF2 (HCD3K129, polyclonal rabbit α-pORF2, raised against aa112-608 of recombinant pORF2 protein), pORF3 (HPO3.1A6, purified polyclonal rabbit α-pORF3, raised against recombinant pORF3 protein), LAMP2 (polyclonal goat α-LAMP-2, AF6228; R&D Systems, Minneapolis, USA), EGFR (monoclonal mouse α-EGFR, sc-120, Santa Cruz Biotechnology), and CD63 (monoclonal mouse α-CD63, ab59479, Abcam) were incubated as previously described ( ).

Techniques: Inhibition, Infection, Confocal Microscopy, Microscopy, Control, Activity Assay, Labeling

Journal: Cell reports

Article Title: Aging disrupts sympathetic innervation of the thymus

doi: 10.1016/j.celrep.2026.117126

Figure Lengend Snippet: (A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).

Article Snippet: qPCR Primer – Lamp2 FW: GAGCAGGTGCTTTCTGTGTCTAG Rev: GCCTGAAAGACCAGCACCAACT , Origene , SKU: MP222524.

Techniques: Labeling, MANN-WHITNEY