Journal: Hepatology Communications

Article Title: Profiling of cell‐free DNA methylation and histone signatures in pediatric NAFLD: A pilot study

doi: 10.1002/hep4.2082

Figure Lengend Snippet: Comparison of characteristics in children without (no NASH) versus children with NASH

Article Snippet: The patatin‐like phospholipase domain containing 3 (PNPLA3) rs738409, transmembrane 6 superfamily member 2 (TM6SF2) rs58542926, membrane bound O‐acyltransferase domain containing 7 (MBOAT7) rs641738, and klotho‐β (KLB) rs17618244 variants were genotyped by allelic discrimination using TaqMan 5′‐nuclease assays (Life Technologies).

Techniques: Comparison

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: Demographic, anthropometric and clinical features of Hepatology service cohort ( n = 1111) stratified by KLB rs17618244 G > A genotype.

Article Snippet: TaqMan gene assay (Applied Biosystems) for KLB (Hs01573147_m1), αSMA (Hs00909449_m1), collagen type I alpha 1 chain, COL1A1 (Hs00164004_m1), collagen type III alpha 1 chain, COL3A1 (Hs00943809_m1), short heterodimer partner, SHP-1 (Hs00222677_m1) and Transforming Growth Factor-beta (TGF-β) Hs.PT.49.1806981 probe by Integrated DNA Technologies (Coralville, IA, USA) were used.

Techniques:

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: Associations between the KLB rs17618244 variant and the independent predictors of liver damage in patients from the Hepatology Service cohort ( n = 1111).

Article Snippet: TaqMan gene assay (Applied Biosystems) for KLB (Hs01573147_m1), αSMA (Hs00909449_m1), collagen type I alpha 1 chain, COL1A1 (Hs00164004_m1), collagen type III alpha 1 chain, COL3A1 (Hs00943809_m1), short heterodimer partner, SHP-1 (Hs00222677_m1) and Transforming Growth Factor-beta (TGF-β) Hs.PT.49.1806981 probe by Integrated DNA Technologies (Coralville, IA, USA) were used.

Techniques: Variant Assay

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: The KLB rs17618244 variant is associated with fibrosis in patients with MAFLD. Association of the KLB rs17618244 variant with steatosis ( a ), lobular inflammation ( b ) ballooning grade ( c ) and fibrosis stage ( d ) in MAFLD patients from the Hepatology service cohort ( n = 1111). Multivariable ordinal regression analysis adjusted for age, sex, BMI, T2D, presence of PNPLA3 I148M, TM6SF2 E167K and MBOAT7 T alleles at additive model.

Article Snippet: TaqMan gene assay (Applied Biosystems) for KLB (Hs01573147_m1), αSMA (Hs00909449_m1), collagen type I alpha 1 chain, COL1A1 (Hs00164004_m1), collagen type III alpha 1 chain, COL3A1 (Hs00943809_m1), short heterodimer partner, SHP-1 (Hs00222677_m1) and Transforming Growth Factor-beta (TGF-β) Hs.PT.49.1806981 probe by Integrated DNA Technologies (Coralville, IA, USA) were used.

Techniques: Variant Assay

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: The KLB rs17618244 variant is associated with lobular inflammation and fibrosis in patients with obese MAFLD patients. Association of the KLB rs17618244 variant with steatosis, lobular inflammation, ballooning grade and fibrosis stage in MAFLD patients from the Hepatology service cohort ( n = 1111) stratified according to the absence ( a-d ) or presence ( e-h ) of obesity (BMI>35). Multivariable ordinal regression analysis adjusted for age, sex, BMI, T2D, presence of PNPLA3 I148M, TM6SF2 E167K and MBOAT7 T alleles at additive model.

Article Snippet: TaqMan gene assay (Applied Biosystems) for KLB (Hs01573147_m1), αSMA (Hs00909449_m1), collagen type I alpha 1 chain, COL1A1 (Hs00164004_m1), collagen type III alpha 1 chain, COL3A1 (Hs00943809_m1), short heterodimer partner, SHP-1 (Hs00222677_m1) and Transforming Growth Factor-beta (TGF-β) Hs.PT.49.1806981 probe by Integrated DNA Technologies (Coralville, IA, USA) were used.

Techniques: Variant Assay

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: Associations between the allelic risk variants and the independent predictors of liver damage in the Hepatology service cohort stratified according to the presence of obesity ( n = 403 no obese patients and n = 708 obese patients).

Article Snippet: TaqMan gene assay (Applied Biosystems) for KLB (Hs01573147_m1), αSMA (Hs00909449_m1), collagen type I alpha 1 chain, COL1A1 (Hs00164004_m1), collagen type III alpha 1 chain, COL3A1 (Hs00943809_m1), short heterodimer partner, SHP-1 (Hs00222677_m1) and Transforming Growth Factor-beta (TGF-β) Hs.PT.49.1806981 probe by Integrated DNA Technologies (Coralville, IA, USA) were used.

Techniques:

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: KLB mRNA levels are higher in patients who carry the at risk A allele and correlate with the expression of genes involved in fibrogenesis. KLB ( a ) and CYP7A1 ( b ) mRNA levels in carriers of the rs17618244 A allele compared to non-carriers. Correlation analyses between hepatic KLB gene expression and CYP7A1 ( c ), TGF-β ( d ), COL1A1 ( e ) and COL3A1 ( f ) mRNA levels evaluated by transcriptome analysis on liver biopsies ( n = 125). Circulating levels of KLB ( g ) and FGF19 ( h ) in 175 NAFLD adult patients. Bar graphs represents KLB and FGF serum levels stratified according to the presence of the KLB at risk A allele (GG=59; GA/AA=116). Data were logarithmically transformed and analyzed by 2-tailed T-tests, Adjusted * p <0.05.

Article Snippet: TaqMan gene assay (Applied Biosystems) for KLB (Hs01573147_m1), αSMA (Hs00909449_m1), collagen type I alpha 1 chain, COL1A1 (Hs00164004_m1), collagen type III alpha 1 chain, COL3A1 (Hs00943809_m1), short heterodimer partner, SHP-1 (Hs00222677_m1) and Transforming Growth Factor-beta (TGF-β) Hs.PT.49.1806981 probe by Integrated DNA Technologies (Coralville, IA, USA) were used.

Techniques: Expressing, Gene Expression, Transformation Assay

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: Analysis of KLB gene/proteinr expression in LX-2 cells under normal or fasting condition. In this experimental setting LX-2 cells were cultured in fasting (0.5% and 2% FBS) or normal medium (10% FBS) for 24 h. Analysis of relative KLB gene expression evaluated by qRT-PCR (a) . Relative expression of KLB protein levels against α-tubulin determined by densitometric analysis of Western blots. The intensity of the bands was analyzed by ImageJ software (b) . Representative immunofluorescence images of cellular distribution of KLB (green) and αSMA (red). Nuclei are reported in blue. Magnification 60X (c) . Cell proliferation evaluated by a BrdU incorporation and expressed as Europium (Eu) counts (d) . Expressions of αSMA, TGF-β, COL1A1 and COL3A1 genes were measured by qRT-PCR (e) . Data are the mean ± SD of 2 independent experiments repeated at least in triplicate. Data were analyzed by 2-tailed t tests, Adjusted * p <0.05; ** p <0.01; *** p <0.001.

Article Snippet: TaqMan gene assay (Applied Biosystems) for KLB (Hs01573147_m1), αSMA (Hs00909449_m1), collagen type I alpha 1 chain, COL1A1 (Hs00164004_m1), collagen type III alpha 1 chain, COL3A1 (Hs00943809_m1), short heterodimer partner, SHP-1 (Hs00222677_m1) and Transforming Growth Factor-beta (TGF-β) Hs.PT.49.1806981 probe by Integrated DNA Technologies (Coralville, IA, USA) were used.

Techniques: Expressing, Cell Culture, Gene Expression, Quantitative RT-PCR, Western Blot, Software, Immunofluorescence, BrdU Incorporation Assay

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: Analysis of the effect of wild-type and mutant KLB overexpression in LX-2 cells. In this experimental setting LX-2 cells were transiently transfected with pCMV6 plasmid (LX-2_Vector), KLB wild-type plasmid (LX-2_KLBwt), or KLB mutant plasmid (LX-2_KLBmut), and all analyses were performed after 48 h. Relative expression of KLB protein levels was determined by densitometric analysis of Western blots. The intensity of the bands was analyzed by ImageJ software (a) . Representative immunofluorescence images of cellular distribution of KLB (green) and αSMA (red). Nuclei are reported in blue. Magnification 60X (b) . Multiple sequence alignment around the site of the Arg728Gln variant among orthologues of KLB and the human Klotho paralogue. Consensus and similar residues are respectively in black and gray background. The consensus residues NxS/T (where “x” can be any residue except proline) for the N-glycosylation of Asn611 are indicated (c) . The structure of the KLB GH2 domain isolated from the Protein Data Bank entry 5VAN and the modelled to show the position of Arg728, the N-glycosylable Asn611 (d) . Same KLB GH2 domain structure as in D represented as molecular surface colored by residue hydrophobicity, highlighting the surface-exposed protein hydrophobic patch (left) and showing a modelled mannose(x3)-GlcNAc(x2) glycan N-linked to Asn611 ( e ). Cell proliferation was evaluated by a BrdU incorporation kit and expressed as Eu counts ( f ). mRNA levels of αSMA, TGF-β, COL1A1 and COL3A1 were evaluated by qRT-PCR (g) . Hypothesis of mechanism by which KLB exert the inhibition of pro-fibrogenic genes after LX-2 cells stimulation with FGF19 ( h ). mRNA levels of SHP-1 and COL1A1 were evaluated by qRT-PCR ( i ). Representative immunofluorescence images of cellular distribution of SMAD3 (red). Magnification 40X ( j) . Quantitative data are the mean ± SD of 2 independent experiments repeated at least in triplicate. Data were analyzed by two-way ANOVA with Bonferroni post hoc test for multiple comparisons. Adjusted * p <0.05; ** p <0.01; *** p <0.001.

Article Snippet: TaqMan gene assay (Applied Biosystems) for KLB (Hs01573147_m1), αSMA (Hs00909449_m1), collagen type I alpha 1 chain, COL1A1 (Hs00164004_m1), collagen type III alpha 1 chain, COL3A1 (Hs00943809_m1), short heterodimer partner, SHP-1 (Hs00222677_m1) and Transforming Growth Factor-beta (TGF-β) Hs.PT.49.1806981 probe by Integrated DNA Technologies (Coralville, IA, USA) were used.

Techniques: Mutagenesis, Over Expression, Transfection, Plasmid Preparation, Expressing, Western Blot, Software, Immunofluorescence, Sequencing, Variant Assay, Residue, Glycoproteomics, Isolation, BrdU Incorporation Assay, Quantitative RT-PCR, Inhibition

Journal: EBioMedicine

Article Title: Intestinal epithelial β Klotho is a critical protective factor in alcohol-induced intestinal barrier dysfunction and liver injury.

doi: 10.1016/j.ebiom.2022.104181

Figure Lengend Snippet: Figure 6. TRPV6 regulates the protein stability of Occludin and ZO-1 via the endocytic pathway. (a) The interactions between KLB, TRPV6 and Occludin/ZO-1 were detected by Co-IP (n=3). (b) Representative confocal images of co-localization (yellow point, indicated with white arrow) between KLB (red) and Occludin/ZO-1 (green), (i, ii) or the co-localization between TRPV6 (red) and Occludin/ZO-1 (green), (iii, iv), n=4. (c) The interaction between TRPV6 and Occludin/ZO-1 was detected by Co-IP in KLBOE or KLBi cells (n=3). # P<0.05 vs. KLB NC; * P<0.05 vs. KLB NCi. (d) The protein stabilities of Occludin and ZO-1 in the TRPV6OE cells or TRPV6i cells (n=6). * P<0.05 vs. TRPV6OE(-); # P<0.05 vs. TRPV6i(-). (e) The protein stability assays of Occludin and ZO-1 in TRPV6i cells treated with or without Dynasore (n=6). 4 P<0.05 vs. (-)dynasore. (f) Representative confocal images of co-localizations (yellow) between Occludin/ ZO-1 (green) and Rab5 (red) in NCi (i-iv)/TRPV6i (v-viii) or NC (ix-xii)/TRPV6OE cells (xiii-xvi), n=4. Statistical analy- sis was performed using one-way/two-way ANOVA followed with Tukey post-hoc test or t-test. Data are mean § SEM. NC, negative control; NCi, negative control for RNA interference; KLBOE, KLB overexpression; KLBi. inhibition of KLB; TRPV6OE, TRPV6 overexpres- sion; TRPV6i, inhibition of TRPV6.

Article Snippet: Primary antibodies used were: F4/80 (Abcam cat#ab6640, MA, USA, RRID: AB_1140040, dilution ratio 1:50), Escherichia coli (E. coli, Abcam cat#ab137967, RRID: AB_2917966. dilution ratio1:100), MUC2 (Proteintech cat#27675-1-AP, Wuhan, CHN, RRID: AB_2880943. dilution ratio1:100), Occludin (Proteintech cat#27260-1-AP, RRID: AB_2880820, dilution ratio1:100), ZO-1 (Proteintech cat#21773-1-AP, RRID: AB_10733242, dilution ratio1:100), TRPV6 (Proteintech cat#13411-1-AP, RRID: AB_2272390, dilution ratio1:100), Flag (DYKDDDDK Tag) (Cell Signaling Technology cat#14793, Danvers, USA, RRID:AB_2572291 dilution ratio1:100), KLB (Aviva Systems cat#ARP53325_P050, Santiago, USA, RRID: AB_10640493, dilution ratio1:100), Rab5 (Santa Cruz cat#sc-46692, CA, USA, RRID:AB_628191, dilution ratio1:100).

Techniques: Co-Immunoprecipitation Assay, Negative Control, Over Expression, Inhibition

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: KLB mRNA levels are higher in patients who carry the at risk A allele and correlate with the expression of genes involved in fibrogenesis. KLB ( a ) and CYP7A1 ( b ) mRNA levels in carriers of the rs17618244 A allele compared to non-carriers. Correlation analyses between hepatic KLB gene expression and CYP7A1 ( c ), TGF-β ( d ), COL1A1 ( e ) and COL3A1 ( f ) mRNA levels evaluated by transcriptome analysis on liver biopsies ( n = 125). Circulating levels of KLB ( g ) and FGF19 ( h ) in 175 NAFLD adult patients. Bar graphs represents KLB and FGF serum levels stratified according to the presence of the KLB at risk A allele (GG=59; GA/AA=116). Data were logarithmically transformed and analyzed by 2-tailed T-tests, Adjusted * p <0.05.

Article Snippet: Two complimentary oligonucleotides containing the rs17618244 mutation (Forward: CTGGCGCCTCTACGACCAGCAGTTCAGGCCCTCAC; Reverse: GTGAGGGCCTGAACTGCTGGTCGTAGAGGCGCCAG) were designed to mutate specified nucleotides of a sequence within a plasmid vector containing a wild type (WT) sequence of KLB gene (RG211186, OriGene Technologies, Inc. Rockville, MD USA).

Techniques: Expressing, Transformation Assay

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: Analysis of KLB gene/proteinr expression in LX-2 cells under normal or fasting condition. In this experimental setting LX-2 cells were cultured in fasting (0.5% and 2% FBS) or normal medium (10% FBS) for 24 h. Analysis of relative KLB gene expression evaluated by qRT-PCR (a) . Relative expression of KLB protein levels against α-tubulin determined by densitometric analysis of Western blots. The intensity of the bands was analyzed by ImageJ software (b) . Representative immunofluorescence images of cellular distribution of KLB (green) and αSMA (red). Nuclei are reported in blue. Magnification 60X (c) . Cell proliferation evaluated by a BrdU incorporation and expressed as Europium (Eu) counts (d) . Expressions of αSMA, TGF-β, COL1A1 and COL3A1 genes were measured by qRT-PCR (e) . Data are the mean ± SD of 2 independent experiments repeated at least in triplicate. Data were analyzed by 2-tailed t tests, Adjusted * p <0.05; ** p <0.01; *** p <0.001.

Article Snippet: Two complimentary oligonucleotides containing the rs17618244 mutation (Forward: CTGGCGCCTCTACGACCAGCAGTTCAGGCCCTCAC; Reverse: GTGAGGGCCTGAACTGCTGGTCGTAGAGGCGCCAG) were designed to mutate specified nucleotides of a sequence within a plasmid vector containing a wild type (WT) sequence of KLB gene (RG211186, OriGene Technologies, Inc. Rockville, MD USA).

Techniques: Expressing, Cell Culture, Quantitative RT-PCR, Western Blot, Software, Immunofluorescence, BrdU Incorporation Assay

Journal: EBioMedicine

Article Title: The KLB rs17618244 gene variant is associated with fibrosing MAFLD by promoting hepatic stellate cell activation

doi: 10.1016/j.ebiom.2021.103249

Figure Lengend Snippet: Analysis of the effect of wild-type and mutant KLB overexpression in LX-2 cells. In this experimental setting LX-2 cells were transiently transfected with pCMV6 plasmid (LX-2_Vector), KLB wild-type plasmid (LX-2_KLBwt), or KLB mutant plasmid (LX-2_KLBmut), and all analyses were performed after 48 h. Relative expression of KLB protein levels was determined by densitometric analysis of Western blots. The intensity of the bands was analyzed by ImageJ software (a) . Representative immunofluorescence images of cellular distribution of KLB (green) and αSMA (red). Nuclei are reported in blue. Magnification 60X (b) . Multiple sequence alignment around the site of the Arg728Gln variant among orthologues of KLB and the human Klotho paralogue. Consensus and similar residues are respectively in black and gray background. The consensus residues NxS/T (where “x” can be any residue except proline) for the N-glycosylation of Asn611 are indicated (c) . The structure of the KLB GH2 domain isolated from the Protein Data Bank entry 5VAN and the modelled to show the position of Arg728, the N-glycosylable Asn611 (d) . Same KLB GH2 domain structure as in D represented as molecular surface colored by residue hydrophobicity, highlighting the surface-exposed protein hydrophobic patch (left) and showing a modelled mannose(x3)-GlcNAc(x2) glycan N-linked to Asn611 ( e ). Cell proliferation was evaluated by a BrdU incorporation kit and expressed as Eu counts ( f ). mRNA levels of αSMA, TGF-β, COL1A1 and COL3A1 were evaluated by qRT-PCR (g) . Hypothesis of mechanism by which KLB exert the inhibition of pro-fibrogenic genes after LX-2 cells stimulation with FGF19 ( h ). mRNA levels of SHP-1 and COL1A1 were evaluated by qRT-PCR ( i ). Representative immunofluorescence images of cellular distribution of SMAD3 (red). Magnification 40X ( j) . Quantitative data are the mean ± SD of 2 independent experiments repeated at least in triplicate. Data were analyzed by two-way ANOVA with Bonferroni post hoc test for multiple comparisons. Adjusted * p <0.05; ** p <0.01; *** p <0.001.

Article Snippet: Two complimentary oligonucleotides containing the rs17618244 mutation (Forward: CTGGCGCCTCTACGACCAGCAGTTCAGGCCCTCAC; Reverse: GTGAGGGCCTGAACTGCTGGTCGTAGAGGCGCCAG) were designed to mutate specified nucleotides of a sequence within a plasmid vector containing a wild type (WT) sequence of KLB gene (RG211186, OriGene Technologies, Inc. Rockville, MD USA).

Techniques: Mutagenesis, Over Expression, Transfection, Plasmid Preparation, Expressing, Western Blot, Software, Immunofluorescence, Sequencing, Variant Assay, Isolation, BrdU Incorporation Assay, Quantitative RT-PCR, Inhibition