kca3.1− Search Results


94
Alomone Labs ik alomone apc 064
Ik Alomone Apc 064, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/Anti-KCNN4+(KCa3%2E1%2C+SK4)+Antibody/pm37963195-233-29-30
Average 94 stars, based on 1 article reviews
ik alomone apc 064 - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

93
Proteintech kca3 1
Kca3 1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/KCNN4+Antibody/pmc10877089-83-40-45
Average 93 stars, based on 1 article reviews
kca3 1 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

93
Alomone Labs ikca extracellular domain
FIGURE 2 Stiff substrates upregulate the <t>IKCa</t> channel expression in A7r5 VSMCs. (a, b) Representative images showing the IKCa mRNA expression using RT‐PCR and IKCa protein cell surface expression using flow cytometry. (c) Summary of the mean data from 4 independent experiments. *p < .05; **p < .01. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; IKCa, intermediate‐conductance Ca2+‐activated K+; mRNA, messenger RNA; RT‐PCR, reverse‐transcription polymerase chain reaction;VSMC, vascular smooth muscle cell
Ikca Extracellular Domain, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/Mouse+Anti-KCNN4+(KCa3%2E1%2C+SK4)+(extracellular)+Antibody/pm33650160-84-17-22
Average 93 stars, based on 1 article reviews
ikca extracellular domain - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

90
OriGene ik rescue plasmids
FIGURE 2 Stiff substrates upregulate the <t>IKCa</t> channel expression in A7r5 VSMCs. (a, b) Representative images showing the IKCa mRNA expression using RT‐PCR and IKCa protein cell surface expression using flow cytometry. (c) Summary of the mean data from 4 independent experiments. *p < .05; **p < .01. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; IKCa, intermediate‐conductance Ca2+‐activated K+; mRNA, messenger RNA; RT‐PCR, reverse‐transcription polymerase chain reaction;VSMC, vascular smooth muscle cell
Ik Rescue Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/Kcnn4+(NM_008433)+Mouse+Untagged+Clone/pm36302750-58-2-6
Average 90 stars, based on 1 article reviews
ik rescue plasmids - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

91
Alomone Labs blocking peptide
FIGURE 2 Stiff substrates upregulate the <t>IKCa</t> channel expression in A7r5 VSMCs. (a, b) Representative images showing the IKCa mRNA expression using RT‐PCR and IKCa protein cell surface expression using flow cytometry. (c) Summary of the mean data from 4 independent experiments. *p < .05; **p < .01. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; IKCa, intermediate‐conductance Ca2+‐activated K+; mRNA, messenger RNA; RT‐PCR, reverse‐transcription polymerase chain reaction;VSMC, vascular smooth muscle cell
Blocking Peptide, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/KCNN4%2FKCa3%2E1+Blocking+Peptide/pm37996600-261-20-31
Average 91 stars, based on 1 article reviews
blocking peptide - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

90
OriGene k ca 3 1 myc
a Structure of TRAM-34 (left) and synthesis of mitoTRAM-34 (right). Reagents and conditions: (i) LiAlH 4 , THF, Et 2 O, room temperature for 3.5 h, 94% yield; (ii) (1) NaH, DMF, 0 °C for 1 h; (2) benzyl bromide, room temperature for 3.5 h, 94% yield; (iii) (1) n-butyllithium, THF, −70 °C for 1 h; (2) 2-chlorobenzophenone, from −70 °C to room temperature overnight, 80% yield; (iv) acetyl chloride, toluene, reflux for 45 min; (v) pyrazole, CH 3 CN, reflux overnight, 83% yield; (vi) Pd/C, H 2 , EtOAc, room temperature for 75 min, 90% yield; (vii) LiCl, 2,4,6-trimethylpyridine, methanesulfonyl chloride, DMF, room temperature for 15 h, 89% yield; (viii) NaI, PPh 3 , CH 3 CN, 95 °C for 6 h, 81% yield. b Synthesis of rev -mitoTRAM. Reagents and conditions: (i) DMAP, 3-chloropropylamine hydrochloride, DCM, THF, room temperature for 3.5 h, 88% yield; (ii) K 2 CO 3 , benzyl bromide, acetone, 70 °C for 15 h, 92% yield; (iii) (1) n-butyllithium, THF, −70 °C for 1 h; (2) 2-chlorobenzophenone, from −70 °C to room temperature overnight, 50% yield; (iv) acetyl chloride, toluene, 100 °C for 1.5 h; (v) pyrazole, CH 3 CN, 100 °C for 17 h, 68% yield; (vi) Pd/C, H 2 , EtOAc, room temperature for 1.5 h, 87% yield; (vii) DMAP, 8, CH 3 CN, 50 °C for 20 h, 82% yield; (viii) NaI, PPh 3 , CH 3 CN, 95 °C for 6 h, 72% yield. c Levels of rev -mitoTRAM and its hydrolysis product (TRAM-34-OH) in the medium and in B16F10 cells after 2, 4, 6, 8, or 24 h of incubation with 5 µM rev -mitoTRAM. Mean ± SEM, N = 3. d MitoTRAM-34 and TRAM-34-OH block plasma membrane <t>K</t> <t>Ca</t> 3.1 currents in GL-15 cells. Left: Time-course of the current at 0 mV measured from the current ramps obtained by applying linear gradients of potential from −100 to 140 mV (Vh of 0 mV) repeated every 5 s. 0 pA current level is indicated by the dashed line. The K Ca 3.1 current was activated by DC-EBIO (1 mM) and ionomycin (500 nM) (EBIO/ionomycin), and the chamber was then perfused sequentially (in the presence of the activators) with mitoTRAM-34, TRAM-34-OH and finally with TRAM-34 (all 2 µM). Individual data points in the trace represent the current conducted by K Ca 3.1 channels following activation by EBIO/ionomycin and inhibition by the indicated drugs. Center: Representative current ramps recorded at the time points indicated on the left panel (same color code). Right: Mean residual K Ca 3.1 current recorded at 0 mV after mitoTRAM-34 and TRAM-34-OH application, expressed as % of the difference between the current recorded after full activation and after complete block of K Ca 3.1 with 3 µM TRAM-34 ( n = 5). Leak current was not subtracted.
K Ca 3 1 Myc, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/KCNN4+(NM_002250)+Human+Tagged+ORF+Clone/pmc09768205-291-10-13
Average 90 stars, based on 1 article reviews
k ca 3 1 myc - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

93
OriGene kcnn4 myc ddk plasmid
Biotinylation‐based proximity labeling and protein interaction analysis. (A) Cloning strategy for TurboID‐based proximity labeling. The BP reaction transfers the m <t>kcnn4</t> gene from the pDONR221 vector to the entry clone using BP clonase. The LR reaction integrates m Kcnn4 into the destination vector, creating the final expression clone containing m Kcnn4 ‐TurboID for lentiviral expression. Lentiviral transduction and experimental setup. (B) Cells were transduced with either m Kcnn4 ‐FLAG‐TurboID‐V5 or V5‐ TurboID‐FLAG, followed by blasticidin selection. Cells were treated with doxycycline (1 μg/mL for 24 h) to induce expression, followed by biotin labeling (50 μM for 1 h, 3 h, or 5 h) to capture proximal proteins for further analysis. (C) Western blot analysis showing biotinylated proteins detected with α‐Streptavidin‐HRP in TurboID‐Flag and mK Ca 3.1‐Flag‐TurboID expressing cells at different time points (1 h, 3 h, 5 h). Ponceau staining was used as a loading control. (D) PCR validation of transgene integration in the different cell lines. (E) Experimental workflow for biotinylation‐based proximity labeling and protein identification. Cells expressing TurboID vectors were treated with doxycycline (1 μg/mL for 24 h) to induce expression, followed by biotin labeling (50 μM for 3 h). After cell lysis, biotinylated proteins were isolated via streptavidin pull‐down, analyzed by MS, and subjected to GO/KEGG enrichment analysis to identify functional interactions. (F) Validation of protein expression and biotinylation efficiency. Western blot analysis using α‐FLAG confirms expression of TurboID‐tagged constructs. α‐Streptavidin‐HRP detection shows biotinylated proteins upon biotin treatment, with increased biotinylation observed in K Ca 3.1‐Flag‐TurboID samples compared to controls. (G) Volcano Plot. The plot categorizes proteins into different groups based on their statistical significance and fold‐change: Enriched hits (blue circles): proteins with high statistical significance ( p < 0.05) and positive fold‐change (log2FC > 0.58). Hits (orange circles): proteins that meet statistical thresholds but have lower fold‐changes. Enriched candidates (green squares): proteins with moderate fold‐change and significance ( p < 0.05; 0.3 < log2FC ≤ 0.58). Candidates (red diamonds): potentially relevant proteins that do not meet strict thresholds. No hits (purple triangles): proteins with no significant differential biotinylation. Proteins with no significant differential expression that are still plotted (brown stars). Thresholds: The black dashed line represents log2FC = 0 (no change).
Kcnn4 Myc Ddk Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/Kcnn4+(NM_008433)+Mouse+Tagged+ORF+Clone/pmc12435150-43-9-12
Average 93 stars, based on 1 article reviews
kcnn4 myc ddk plasmid - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

90
OriGene sirnas targeting sk4
Fig. 1. <t>SK4</t> expression in colorectal cancer. (A) SK4 protein expression in colon cancer and adjacent normal tissues from the CPTAC data portal. Wilcoxon’s signed- rank test was used to compare cancer tissues to their normal counterparts. (B) Immuno-histochemical staining of SK4 in normal colorectal and tumor tissues. Images were downloaded from http://www.proteinatlas.org. (C-E) KCNN4 expression profile in colorectal cancer according to the mutational status of TP53 (C), BRAF (D), and KRAS (E) genes. Student’s t-test was used to compare KCNN4 expression between mutated and wild-type CRC tissues (* p < 0.05, *** p < 0.001). (F) Boxplot showing the expression of KCNN4 in primary and metastatic CRC tissues alongside normal tissues in the GSE41258 dataset. Student’s t-test was used to compare KCNN4 expression between normal liver (N = 11), normal lung (N = 7), polyps (N = 45), primary tumor (N = 183), liver metastasis (N = 38), lung metastasis (N-18), and normal Colon (N = 53) (***: p ≤0.001).
Sirnas Targeting Sk4, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/Kcnn4+(NM_001163510)+Mouse+Tagged+ORF+Clone/pm33676318-58-7-10
Average 90 stars, based on 1 article reviews
sirnas targeting sk4 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

91
Alomone Labs ik channels
Fig. 1. <t>SK4</t> expression in colorectal cancer. (A) SK4 protein expression in colon cancer and adjacent normal tissues from the CPTAC data portal. Wilcoxon’s signed- rank test was used to compare cancer tissues to their normal counterparts. (B) Immuno-histochemical staining of SK4 in normal colorectal and tumor tissues. Images were downloaded from http://www.proteinatlas.org. (C-E) KCNN4 expression profile in colorectal cancer according to the mutational status of TP53 (C), BRAF (D), and KRAS (E) genes. Student’s t-test was used to compare KCNN4 expression between mutated and wild-type CRC tissues (* p < 0.05, *** p < 0.001). (F) Boxplot showing the expression of KCNN4 in primary and metastatic CRC tissues alongside normal tissues in the GSE41258 dataset. Student’s t-test was used to compare KCNN4 expression between normal liver (N = 11), normal lung (N = 7), polyps (N = 45), primary tumor (N = 183), liver metastasis (N = 38), lung metastasis (N-18), and normal Colon (N = 53) (***: p ≤0.001).
Ik Channels, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/Mouse+Anti-KCNN4+(KCa3%2E1%2C+SK4)+(extracellular)-ATTO+Fluor-488+Antibody/pm37367787-71-33-41
Average 91 stars, based on 1 article reviews
ik channels - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

92
Alomone Labs anti kca3 1
Fig. 1. <t>SK4</t> expression in colorectal cancer. (A) SK4 protein expression in colon cancer and adjacent normal tissues from the CPTAC data portal. Wilcoxon’s signed- rank test was used to compare cancer tissues to their normal counterparts. (B) Immuno-histochemical staining of SK4 in normal colorectal and tumor tissues. Images were downloaded from http://www.proteinatlas.org. (C-E) KCNN4 expression profile in colorectal cancer according to the mutational status of TP53 (C), BRAF (D), and KRAS (E) genes. Student’s t-test was used to compare KCNN4 expression between mutated and wild-type CRC tissues (* p < 0.05, *** p < 0.001). (F) Boxplot showing the expression of KCNN4 in primary and metastatic CRC tissues alongside normal tissues in the GSE41258 dataset. Student’s t-test was used to compare KCNN4 expression between normal liver (N = 11), normal lung (N = 7), polyps (N = 45), primary tumor (N = 183), liver metastasis (N = 38), lung metastasis (N-18), and normal Colon (N = 53) (***: p ≤0.001).
Anti Kca3 1, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/KCNN4+(KCa3%2E1)+Channel+Basic+Research+Pack/pm16641164-74-0-7
Average 92 stars, based on 1 article reviews
anti kca3 1 - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

90
Ribobio co kca3.1 sirna sikca3.1
Fig. 1. <t>SK4</t> expression in colorectal cancer. (A) SK4 protein expression in colon cancer and adjacent normal tissues from the CPTAC data portal. Wilcoxon’s signed- rank test was used to compare cancer tissues to their normal counterparts. (B) Immuno-histochemical staining of SK4 in normal colorectal and tumor tissues. Images were downloaded from http://www.proteinatlas.org. (C-E) KCNN4 expression profile in colorectal cancer according to the mutational status of TP53 (C), BRAF (D), and KRAS (E) genes. Student’s t-test was used to compare KCNN4 expression between mutated and wild-type CRC tissues (* p < 0.05, *** p < 0.001). (F) Boxplot showing the expression of KCNN4 in primary and metastatic CRC tissues alongside normal tissues in the GSE41258 dataset. Student’s t-test was used to compare KCNN4 expression between normal liver (N = 11), normal lung (N = 7), polyps (N = 45), primary tumor (N = 183), liver metastasis (N = 38), lung metastasis (N-18), and normal Colon (N = 53) (***: p ≤0.001).
Kca3.1 Sirna Sikca3.1, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/kca3+1+sirna+sikca3+1/pm29621746-72-0-11
Average 90 stars, based on 1 article reviews
kca3.1 sirna sikca3.1 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Wulff labs selective kca3.1 channel blocker tram-34
Fig. 1. <t>SK4</t> expression in colorectal cancer. (A) SK4 protein expression in colon cancer and adjacent normal tissues from the CPTAC data portal. Wilcoxon’s signed- rank test was used to compare cancer tissues to their normal counterparts. (B) Immuno-histochemical staining of SK4 in normal colorectal and tumor tissues. Images were downloaded from http://www.proteinatlas.org. (C-E) KCNN4 expression profile in colorectal cancer according to the mutational status of TP53 (C), BRAF (D), and KRAS (E) genes. Student’s t-test was used to compare KCNN4 expression between mutated and wild-type CRC tissues (* p < 0.05, *** p < 0.001). (F) Boxplot showing the expression of KCNN4 in primary and metastatic CRC tissues alongside normal tissues in the GSE41258 dataset. Student’s t-test was used to compare KCNN4 expression between normal liver (N = 11), normal lung (N = 7), polyps (N = 45), primary tumor (N = 183), liver metastasis (N = 38), lung metastasis (N-18), and normal Colon (N = 53) (***: p ≤0.001).
Selective Kca3.1 Channel Blocker Tram 34, supplied by Wulff labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kca3%2E1%E2%88%92/kca3+1+channel/pmc06672279-54-2-10
Average 90 stars, based on 1 article reviews
selective kca3.1 channel blocker tram-34 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


FIGURE 2 Stiff substrates upregulate the IKCa channel expression in A7r5 VSMCs. (a, b) Representative images showing the IKCa mRNA expression using RT‐PCR and IKCa protein cell surface expression using flow cytometry. (c) Summary of the mean data from 4 independent experiments. *p < .05; **p < .01. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; IKCa, intermediate‐conductance Ca2+‐activated K+; mRNA, messenger RNA; RT‐PCR, reverse‐transcription polymerase chain reaction;VSMC, vascular smooth muscle cell

Journal: Journal of cellular physiology

Article Title: Stimulation of vascular smooth muscle cell proliferation by stiff matrix via the IK Ca channel-dependent Ca 2+ signaling.

doi: 10.1002/jcp.30349

Figure Lengend Snippet: FIGURE 2 Stiff substrates upregulate the IKCa channel expression in A7r5 VSMCs. (a, b) Representative images showing the IKCa mRNA expression using RT‐PCR and IKCa protein cell surface expression using flow cytometry. (c) Summary of the mean data from 4 independent experiments. *p < .05; **p < .01. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; IKCa, intermediate‐conductance Ca2+‐activated K+; mRNA, messenger RNA; RT‐PCR, reverse‐transcription polymerase chain reaction;VSMC, vascular smooth muscle cell

Article Snippet: Following three washes with PBS, cells were incubated with a pri- mary mouse antibody specifically against the IKCa extracellular domain (ALM051, 1:100; Alomone Labs) for 40min.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Flow Cytometry, Reverse Transcription, Polymerase Chain Reaction

FIGURE 3 Stiff substrate‐induced IKCa channel upregulation is required for increased A7r5 VSMC proliferation. (a) Summary of the effects of treatment with 100 nM TRAM34 on stiff substrate‐induced cell proliferation from three independent experiments. (b) Representative western blots showing siRNA‐mediated knockdown of the IKCa protein expression (top) and summary of the data from five independent experiments (bottom). (c) Summary of stiff substrate‐induced cell proliferation in siRNA‐transfected cells from three independent experiments. *p < .05 and **p < .01 compared between 0.21 and 1.72 MPa without any treatment or compared between 1.72 MPa with or without treatment with TRAM34, respectively. IKCa, intermediate‐conductance Ca2+‐activated K+; siRNA, small interfering RNA; VSMC, vascular smooth muscle cell

Journal: Journal of cellular physiology

Article Title: Stimulation of vascular smooth muscle cell proliferation by stiff matrix via the IK Ca channel-dependent Ca 2+ signaling.

doi: 10.1002/jcp.30349

Figure Lengend Snippet: FIGURE 3 Stiff substrate‐induced IKCa channel upregulation is required for increased A7r5 VSMC proliferation. (a) Summary of the effects of treatment with 100 nM TRAM34 on stiff substrate‐induced cell proliferation from three independent experiments. (b) Representative western blots showing siRNA‐mediated knockdown of the IKCa protein expression (top) and summary of the data from five independent experiments (bottom). (c) Summary of stiff substrate‐induced cell proliferation in siRNA‐transfected cells from three independent experiments. *p < .05 and **p < .01 compared between 0.21 and 1.72 MPa without any treatment or compared between 1.72 MPa with or without treatment with TRAM34, respectively. IKCa, intermediate‐conductance Ca2+‐activated K+; siRNA, small interfering RNA; VSMC, vascular smooth muscle cell

Article Snippet: Following three washes with PBS, cells were incubated with a pri- mary mouse antibody specifically against the IKCa extracellular domain (ALM051, 1:100; Alomone Labs) for 40min.

Techniques: Western Blot, Knockdown, Expressing, Transfection, Small Interfering RNA

FIGURE 4 Stiff substrate induces IKCa‐ dependent increase in [Ca2+]i in A7r5 VSMCs. (a) Representative single‐cell images showing intracellular Ca2+ concentration in cells cultured on the soft and stiff substrate under indicated conditions. Treatment with 100 nM TRAM34 was made during culture media and also in extracellular recording solution. (b) Summary of the relative Fluo4 fluorescence intensity, indicative of the [Ca2+]i, in individual cells under the condition shown in (a), with 375 cells examined for each case. **p < .01. IKCa, intermediate‐conductance Ca2+‐activated K+; VSMC, vascular smooth muscle cell

Journal: Journal of cellular physiology

Article Title: Stimulation of vascular smooth muscle cell proliferation by stiff matrix via the IK Ca channel-dependent Ca 2+ signaling.

doi: 10.1002/jcp.30349

Figure Lengend Snippet: FIGURE 4 Stiff substrate induces IKCa‐ dependent increase in [Ca2+]i in A7r5 VSMCs. (a) Representative single‐cell images showing intracellular Ca2+ concentration in cells cultured on the soft and stiff substrate under indicated conditions. Treatment with 100 nM TRAM34 was made during culture media and also in extracellular recording solution. (b) Summary of the relative Fluo4 fluorescence intensity, indicative of the [Ca2+]i, in individual cells under the condition shown in (a), with 375 cells examined for each case. **p < .01. IKCa, intermediate‐conductance Ca2+‐activated K+; VSMC, vascular smooth muscle cell

Article Snippet: Following three washes with PBS, cells were incubated with a pri- mary mouse antibody specifically against the IKCa extracellular domain (ALM051, 1:100; Alomone Labs) for 40min.

Techniques: Concentration Assay, Cell Culture, Fluorescence

FIGURE 5 Stiff substrate‐induced IKCa channel‐dependent increases in [Ca2+]i is essential for increased A7r5 VSMC proliferation. Summary of cell proliferation on substrates in culture media containing (a) 1 mM EGTA or (b) 10 μM BAPTA‐AM, from three independent experiments for each case. **p < .01. EGTA, ethylene glycol‐bis(β‐aminoethyl ether)‐N,N,N′,N′‐tetraacetic acid; IKCa, intermediate‐conductance Ca2+‐activated K+; VSMC, vascular smooth muscle cell

Journal: Journal of cellular physiology

Article Title: Stimulation of vascular smooth muscle cell proliferation by stiff matrix via the IK Ca channel-dependent Ca 2+ signaling.

doi: 10.1002/jcp.30349

Figure Lengend Snippet: FIGURE 5 Stiff substrate‐induced IKCa channel‐dependent increases in [Ca2+]i is essential for increased A7r5 VSMC proliferation. Summary of cell proliferation on substrates in culture media containing (a) 1 mM EGTA or (b) 10 μM BAPTA‐AM, from three independent experiments for each case. **p < .01. EGTA, ethylene glycol‐bis(β‐aminoethyl ether)‐N,N,N′,N′‐tetraacetic acid; IKCa, intermediate‐conductance Ca2+‐activated K+; VSMC, vascular smooth muscle cell

Article Snippet: Following three washes with PBS, cells were incubated with a pri- mary mouse antibody specifically against the IKCa extracellular domain (ALM051, 1:100; Alomone Labs) for 40min.

Techniques:

a Structure of TRAM-34 (left) and synthesis of mitoTRAM-34 (right). Reagents and conditions: (i) LiAlH 4 , THF, Et 2 O, room temperature for 3.5 h, 94% yield; (ii) (1) NaH, DMF, 0 °C for 1 h; (2) benzyl bromide, room temperature for 3.5 h, 94% yield; (iii) (1) n-butyllithium, THF, −70 °C for 1 h; (2) 2-chlorobenzophenone, from −70 °C to room temperature overnight, 80% yield; (iv) acetyl chloride, toluene, reflux for 45 min; (v) pyrazole, CH 3 CN, reflux overnight, 83% yield; (vi) Pd/C, H 2 , EtOAc, room temperature for 75 min, 90% yield; (vii) LiCl, 2,4,6-trimethylpyridine, methanesulfonyl chloride, DMF, room temperature for 15 h, 89% yield; (viii) NaI, PPh 3 , CH 3 CN, 95 °C for 6 h, 81% yield. b Synthesis of rev -mitoTRAM. Reagents and conditions: (i) DMAP, 3-chloropropylamine hydrochloride, DCM, THF, room temperature for 3.5 h, 88% yield; (ii) K 2 CO 3 , benzyl bromide, acetone, 70 °C for 15 h, 92% yield; (iii) (1) n-butyllithium, THF, −70 °C for 1 h; (2) 2-chlorobenzophenone, from −70 °C to room temperature overnight, 50% yield; (iv) acetyl chloride, toluene, 100 °C for 1.5 h; (v) pyrazole, CH 3 CN, 100 °C for 17 h, 68% yield; (vi) Pd/C, H 2 , EtOAc, room temperature for 1.5 h, 87% yield; (vii) DMAP, 8, CH 3 CN, 50 °C for 20 h, 82% yield; (viii) NaI, PPh 3 , CH 3 CN, 95 °C for 6 h, 72% yield. c Levels of rev -mitoTRAM and its hydrolysis product (TRAM-34-OH) in the medium and in B16F10 cells after 2, 4, 6, 8, or 24 h of incubation with 5 µM rev -mitoTRAM. Mean ± SEM, N = 3. d MitoTRAM-34 and TRAM-34-OH block plasma membrane K Ca 3.1 currents in GL-15 cells. Left: Time-course of the current at 0 mV measured from the current ramps obtained by applying linear gradients of potential from −100 to 140 mV (Vh of 0 mV) repeated every 5 s. 0 pA current level is indicated by the dashed line. The K Ca 3.1 current was activated by DC-EBIO (1 mM) and ionomycin (500 nM) (EBIO/ionomycin), and the chamber was then perfused sequentially (in the presence of the activators) with mitoTRAM-34, TRAM-34-OH and finally with TRAM-34 (all 2 µM). Individual data points in the trace represent the current conducted by K Ca 3.1 channels following activation by EBIO/ionomycin and inhibition by the indicated drugs. Center: Representative current ramps recorded at the time points indicated on the left panel (same color code). Right: Mean residual K Ca 3.1 current recorded at 0 mV after mitoTRAM-34 and TRAM-34-OH application, expressed as % of the difference between the current recorded after full activation and after complete block of K Ca 3.1 with 3 µM TRAM-34 ( n = 5). Leak current was not subtracted.

Journal: Cell Death & Disease

Article Title: Pharmacological targeting of the mitochondrial calcium-dependent potassium channel KCa3.1 triggers cell death and reduces tumor growth and metastasis in vivo

doi: 10.1038/s41419-022-05463-8

Figure Lengend Snippet: a Structure of TRAM-34 (left) and synthesis of mitoTRAM-34 (right). Reagents and conditions: (i) LiAlH 4 , THF, Et 2 O, room temperature for 3.5 h, 94% yield; (ii) (1) NaH, DMF, 0 °C for 1 h; (2) benzyl bromide, room temperature for 3.5 h, 94% yield; (iii) (1) n-butyllithium, THF, −70 °C for 1 h; (2) 2-chlorobenzophenone, from −70 °C to room temperature overnight, 80% yield; (iv) acetyl chloride, toluene, reflux for 45 min; (v) pyrazole, CH 3 CN, reflux overnight, 83% yield; (vi) Pd/C, H 2 , EtOAc, room temperature for 75 min, 90% yield; (vii) LiCl, 2,4,6-trimethylpyridine, methanesulfonyl chloride, DMF, room temperature for 15 h, 89% yield; (viii) NaI, PPh 3 , CH 3 CN, 95 °C for 6 h, 81% yield. b Synthesis of rev -mitoTRAM. Reagents and conditions: (i) DMAP, 3-chloropropylamine hydrochloride, DCM, THF, room temperature for 3.5 h, 88% yield; (ii) K 2 CO 3 , benzyl bromide, acetone, 70 °C for 15 h, 92% yield; (iii) (1) n-butyllithium, THF, −70 °C for 1 h; (2) 2-chlorobenzophenone, from −70 °C to room temperature overnight, 50% yield; (iv) acetyl chloride, toluene, 100 °C for 1.5 h; (v) pyrazole, CH 3 CN, 100 °C for 17 h, 68% yield; (vi) Pd/C, H 2 , EtOAc, room temperature for 1.5 h, 87% yield; (vii) DMAP, 8, CH 3 CN, 50 °C for 20 h, 82% yield; (viii) NaI, PPh 3 , CH 3 CN, 95 °C for 6 h, 72% yield. c Levels of rev -mitoTRAM and its hydrolysis product (TRAM-34-OH) in the medium and in B16F10 cells after 2, 4, 6, 8, or 24 h of incubation with 5 µM rev -mitoTRAM. Mean ± SEM, N = 3. d MitoTRAM-34 and TRAM-34-OH block plasma membrane K Ca 3.1 currents in GL-15 cells. Left: Time-course of the current at 0 mV measured from the current ramps obtained by applying linear gradients of potential from −100 to 140 mV (Vh of 0 mV) repeated every 5 s. 0 pA current level is indicated by the dashed line. The K Ca 3.1 current was activated by DC-EBIO (1 mM) and ionomycin (500 nM) (EBIO/ionomycin), and the chamber was then perfused sequentially (in the presence of the activators) with mitoTRAM-34, TRAM-34-OH and finally with TRAM-34 (all 2 µM). Individual data points in the trace represent the current conducted by K Ca 3.1 channels following activation by EBIO/ionomycin and inhibition by the indicated drugs. Center: Representative current ramps recorded at the time points indicated on the left panel (same color code). Right: Mean residual K Ca 3.1 current recorded at 0 mV after mitoTRAM-34 and TRAM-34-OH application, expressed as % of the difference between the current recorded after full activation and after complete block of K Ca 3.1 with 3 µM TRAM-34 ( n = 5). Leak current was not subtracted.

Article Snippet: The following day, they were transfected with a plasmid codifying K Ca 3.1-myc (Origene #RC204457) or BirA-myc (pcDNA3.1 mycBioID was a gift from Kyle Roux (Addgene plasmid # 35700; http://n2t.net/addgene:35700 )).

Techniques: Reflux, Incubation, Blocking Assay, Clinical Proteomics, Membrane, Activation Assay, Inhibition

a Representative Western Blot showing the mitochondrial localization of K Ca 3.1 in B16F10 cells. f1: whole-cell extract; f2: membrane-enriched fraction; f3: mitochondria-enriched fraction; m1 and m2: Percoll-purified mitochondrial fractions (see “Materials/subjects and methods”). Plasma membrane marker PMCA and mitochondrial membrane markers VDAC-1 and TOM-20 are also shown. b , c Images showing mitochondrial membrane potential changes ( b ) and superoxide production ( c ) in B16F10 cells, as visualized by changes in TMRM ( b ) or mitoSOX ( c ) fluorescence upon addition of mitoTRAM-34 (mitoT.), rev -mitoTRAM ( rev -m.) or TRAM-34 at the indicated time points. FCCP ( b ) and Antimycin A ( c ) were used as controls (not shown). The quantification of the fluorescence signal is shown on the right. Fluorescence is expressed as percentage of the initial intensity (mean + SEM; Two-Way Anova with Dunnett’s multiple comparison test. N = 4. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to control). Scale bar is 100 µm. d Representative images (left) and analysis (right) of mitochondrial ultrastructure assessed by transmission electron microscopy (TEM) after treatment of B16F10 cells with 1.5 µM mitoTRAM (mitoT.) or 7.5 µM rev -mitoTRAM ( rev -m.) for 30 min. The mitochondrial circularity and number of cristae/area were calculated with ImageJ. For each replicate, mitochondria from at least 5 cells were analyzed (mean + SEM, One-Way Anova with Dunnett’s posttest. N = 3. **** p < 0.0001 compared to control). Scale bar is 1 µm. e As in ( d ), but cells were treated for 24 h with sublethal doses of mitoTRAM-34 (0.5 µM) and rev -mitoTRAM (5 µM). f Representative confocal images of B16F10 cells treated as in ( e ) showing a fragmented mitochondrial network after 24 h of treatment with mitoTRAM-34 (mitoT.) or rev -mitoTRAM ( rev -m.) compared to control cells. Cells were stained for mitochondrial marker TOM-20 (magenta) and DAPI (cyan). Scale bar is 5 µm.

Journal: Cell Death & Disease

Article Title: Pharmacological targeting of the mitochondrial calcium-dependent potassium channel KCa3.1 triggers cell death and reduces tumor growth and metastasis in vivo

doi: 10.1038/s41419-022-05463-8

Figure Lengend Snippet: a Representative Western Blot showing the mitochondrial localization of K Ca 3.1 in B16F10 cells. f1: whole-cell extract; f2: membrane-enriched fraction; f3: mitochondria-enriched fraction; m1 and m2: Percoll-purified mitochondrial fractions (see “Materials/subjects and methods”). Plasma membrane marker PMCA and mitochondrial membrane markers VDAC-1 and TOM-20 are also shown. b , c Images showing mitochondrial membrane potential changes ( b ) and superoxide production ( c ) in B16F10 cells, as visualized by changes in TMRM ( b ) or mitoSOX ( c ) fluorescence upon addition of mitoTRAM-34 (mitoT.), rev -mitoTRAM ( rev -m.) or TRAM-34 at the indicated time points. FCCP ( b ) and Antimycin A ( c ) were used as controls (not shown). The quantification of the fluorescence signal is shown on the right. Fluorescence is expressed as percentage of the initial intensity (mean + SEM; Two-Way Anova with Dunnett’s multiple comparison test. N = 4. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to control). Scale bar is 100 µm. d Representative images (left) and analysis (right) of mitochondrial ultrastructure assessed by transmission electron microscopy (TEM) after treatment of B16F10 cells with 1.5 µM mitoTRAM (mitoT.) or 7.5 µM rev -mitoTRAM ( rev -m.) for 30 min. The mitochondrial circularity and number of cristae/area were calculated with ImageJ. For each replicate, mitochondria from at least 5 cells were analyzed (mean + SEM, One-Way Anova with Dunnett’s posttest. N = 3. **** p < 0.0001 compared to control). Scale bar is 1 µm. e As in ( d ), but cells were treated for 24 h with sublethal doses of mitoTRAM-34 (0.5 µM) and rev -mitoTRAM (5 µM). f Representative confocal images of B16F10 cells treated as in ( e ) showing a fragmented mitochondrial network after 24 h of treatment with mitoTRAM-34 (mitoT.) or rev -mitoTRAM ( rev -m.) compared to control cells. Cells were stained for mitochondrial marker TOM-20 (magenta) and DAPI (cyan). Scale bar is 5 µm.

Article Snippet: The following day, they were transfected with a plasmid codifying K Ca 3.1-myc (Origene #RC204457) or BirA-myc (pcDNA3.1 mycBioID was a gift from Kyle Roux (Addgene plasmid # 35700; http://n2t.net/addgene:35700 )).

Techniques: Western Blot, Membrane, Purification, Clinical Proteomics, Marker, Fluorescence, Comparison, Control, Transmission Assay, Electron Microscopy, Staining

a MTS assays showing the sensitivity of B16F10 cells to different doses of mitoTRAM-34 and rev -mitoTRAM (24 h). Shown are means + SEM of N = 3–5 (One Sample T Test, *** p -value < 0.001, ** p -value < 0.01, * p -value < 0.05). b Dose-response curves showing the sensitivity of the cancer cell lines B16F10, MDA-MB-231, and COLO-357 and non-tumoral cell lines from the same tissues (Melan-A, MCF-10A, and HPDE, respectively) to mitoTRAM-34, as assessed by MTS assays. The concentrations applied (µM) are plotted on a logarithmic scale. The concentration at which 50% of cells were viable (EC 50 ) is indicated by the dotted line. Shown are means + SEM and nonlinear fit curves of N = 3–5. Statistical differences between curves were analyzed with Two-Way Anova. c EC 50 values for mitoTRAM-34 treatment of different human pancreatic cancer cell lines and a non-tumoral pancreatic epithelial cell line (HPDE) of mitoTRAM-34 treatment assessed with MTS assays plotted against the expression of K Ca 3.1 in the same cells, analyzed with qRT-PCR. The correlation was analyzed with a simple linear regression. Plot of mean ± SEM EC 50 values vs. normalized expression relative to HPDE cells ( N = 3). On the right, representative images of Annexin V-FITC stainings of HPDE and COLO-357 cells treated for 24 h with 1.5 µM mitoTRAM-34. Bright field images, FITC fluorescence and merge are shown. Scale bar is 100 µm. d Quantification of Annexin V-FITC staining shown in ( e ). The fraction of Annexin V-positive cells on total cell count is shown (mean + SEM, One-Way Anova with Dunnett’s posttest. N = 3. * p < 0.05). e Representative images of an Annexin V-FITC cell death assay. B16F10 cells were treated for 24 h with mitoTRAM-34 (mitoT.) or rev -mitoTRAM ( rev -m.) at the indicated concentrations were stained with Annexin V-FITC. Bright field images, FITC fluorescence, Hoechst staining and the merged images are shown. Scale bar is 25 µm. f Sensitivity of HEK-293 cells overexpressing either K Ca 3.1 or the control protein BirA to mitoTRAM-34 or rev -mitoTRAM treatment analyzed with MTS assays. The concentration at which 50% of cells were viable (EC 50 ) is indicated by the dotted line. Shown are mean + SEM and nonlinear fit curves of N = 4. Statistical differences between curves were analyzed using Two-Way Anova. g Cell viability of WT and K Ca 3.1 KO primary breast cancer cells after 24 h of treatment with 2 µM mitoTRAM-34 (mitoT.) or 7.5 µM rev -mitoTRAM ( rev -m.), analyzed by MTS assays. For both WT and KO cells, data from 2 separate primary cultures were put together (mean + SEM, Two-Way Anova with Sidak’s multiple comparisons tests. N = 3. *** p < 0.001).

Journal: Cell Death & Disease

Article Title: Pharmacological targeting of the mitochondrial calcium-dependent potassium channel KCa3.1 triggers cell death and reduces tumor growth and metastasis in vivo

doi: 10.1038/s41419-022-05463-8

Figure Lengend Snippet: a MTS assays showing the sensitivity of B16F10 cells to different doses of mitoTRAM-34 and rev -mitoTRAM (24 h). Shown are means + SEM of N = 3–5 (One Sample T Test, *** p -value < 0.001, ** p -value < 0.01, * p -value < 0.05). b Dose-response curves showing the sensitivity of the cancer cell lines B16F10, MDA-MB-231, and COLO-357 and non-tumoral cell lines from the same tissues (Melan-A, MCF-10A, and HPDE, respectively) to mitoTRAM-34, as assessed by MTS assays. The concentrations applied (µM) are plotted on a logarithmic scale. The concentration at which 50% of cells were viable (EC 50 ) is indicated by the dotted line. Shown are means + SEM and nonlinear fit curves of N = 3–5. Statistical differences between curves were analyzed with Two-Way Anova. c EC 50 values for mitoTRAM-34 treatment of different human pancreatic cancer cell lines and a non-tumoral pancreatic epithelial cell line (HPDE) of mitoTRAM-34 treatment assessed with MTS assays plotted against the expression of K Ca 3.1 in the same cells, analyzed with qRT-PCR. The correlation was analyzed with a simple linear regression. Plot of mean ± SEM EC 50 values vs. normalized expression relative to HPDE cells ( N = 3). On the right, representative images of Annexin V-FITC stainings of HPDE and COLO-357 cells treated for 24 h with 1.5 µM mitoTRAM-34. Bright field images, FITC fluorescence and merge are shown. Scale bar is 100 µm. d Quantification of Annexin V-FITC staining shown in ( e ). The fraction of Annexin V-positive cells on total cell count is shown (mean + SEM, One-Way Anova with Dunnett’s posttest. N = 3. * p < 0.05). e Representative images of an Annexin V-FITC cell death assay. B16F10 cells were treated for 24 h with mitoTRAM-34 (mitoT.) or rev -mitoTRAM ( rev -m.) at the indicated concentrations were stained with Annexin V-FITC. Bright field images, FITC fluorescence, Hoechst staining and the merged images are shown. Scale bar is 25 µm. f Sensitivity of HEK-293 cells overexpressing either K Ca 3.1 or the control protein BirA to mitoTRAM-34 or rev -mitoTRAM treatment analyzed with MTS assays. The concentration at which 50% of cells were viable (EC 50 ) is indicated by the dotted line. Shown are mean + SEM and nonlinear fit curves of N = 4. Statistical differences between curves were analyzed using Two-Way Anova. g Cell viability of WT and K Ca 3.1 KO primary breast cancer cells after 24 h of treatment with 2 µM mitoTRAM-34 (mitoT.) or 7.5 µM rev -mitoTRAM ( rev -m.), analyzed by MTS assays. For both WT and KO cells, data from 2 separate primary cultures were put together (mean + SEM, Two-Way Anova with Sidak’s multiple comparisons tests. N = 3. *** p < 0.001).

Article Snippet: The following day, they were transfected with a plasmid codifying K Ca 3.1-myc (Origene #RC204457) or BirA-myc (pcDNA3.1 mycBioID was a gift from Kyle Roux (Addgene plasmid # 35700; http://n2t.net/addgene:35700 )).

Techniques: Concentration Assay, Expressing, Quantitative RT-PCR, Fluorescence, Staining, Cell Counting, Control

Biotinylation‐based proximity labeling and protein interaction analysis. (A) Cloning strategy for TurboID‐based proximity labeling. The BP reaction transfers the m kcnn4 gene from the pDONR221 vector to the entry clone using BP clonase. The LR reaction integrates m Kcnn4 into the destination vector, creating the final expression clone containing m Kcnn4 ‐TurboID for lentiviral expression. Lentiviral transduction and experimental setup. (B) Cells were transduced with either m Kcnn4 ‐FLAG‐TurboID‐V5 or V5‐ TurboID‐FLAG, followed by blasticidin selection. Cells were treated with doxycycline (1 μg/mL for 24 h) to induce expression, followed by biotin labeling (50 μM for 1 h, 3 h, or 5 h) to capture proximal proteins for further analysis. (C) Western blot analysis showing biotinylated proteins detected with α‐Streptavidin‐HRP in TurboID‐Flag and mK Ca 3.1‐Flag‐TurboID expressing cells at different time points (1 h, 3 h, 5 h). Ponceau staining was used as a loading control. (D) PCR validation of transgene integration in the different cell lines. (E) Experimental workflow for biotinylation‐based proximity labeling and protein identification. Cells expressing TurboID vectors were treated with doxycycline (1 μg/mL for 24 h) to induce expression, followed by biotin labeling (50 μM for 3 h). After cell lysis, biotinylated proteins were isolated via streptavidin pull‐down, analyzed by MS, and subjected to GO/KEGG enrichment analysis to identify functional interactions. (F) Validation of protein expression and biotinylation efficiency. Western blot analysis using α‐FLAG confirms expression of TurboID‐tagged constructs. α‐Streptavidin‐HRP detection shows biotinylated proteins upon biotin treatment, with increased biotinylation observed in K Ca 3.1‐Flag‐TurboID samples compared to controls. (G) Volcano Plot. The plot categorizes proteins into different groups based on their statistical significance and fold‐change: Enriched hits (blue circles): proteins with high statistical significance ( p < 0.05) and positive fold‐change (log2FC > 0.58). Hits (orange circles): proteins that meet statistical thresholds but have lower fold‐changes. Enriched candidates (green squares): proteins with moderate fold‐change and significance ( p < 0.05; 0.3 < log2FC ≤ 0.58). Candidates (red diamonds): potentially relevant proteins that do not meet strict thresholds. No hits (purple triangles): proteins with no significant differential biotinylation. Proteins with no significant differential expression that are still plotted (brown stars). Thresholds: The black dashed line represents log2FC = 0 (no change).

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: Biotinylation‐based proximity labeling and protein interaction analysis. (A) Cloning strategy for TurboID‐based proximity labeling. The BP reaction transfers the m kcnn4 gene from the pDONR221 vector to the entry clone using BP clonase. The LR reaction integrates m Kcnn4 into the destination vector, creating the final expression clone containing m Kcnn4 ‐TurboID for lentiviral expression. Lentiviral transduction and experimental setup. (B) Cells were transduced with either m Kcnn4 ‐FLAG‐TurboID‐V5 or V5‐ TurboID‐FLAG, followed by blasticidin selection. Cells were treated with doxycycline (1 μg/mL for 24 h) to induce expression, followed by biotin labeling (50 μM for 1 h, 3 h, or 5 h) to capture proximal proteins for further analysis. (C) Western blot analysis showing biotinylated proteins detected with α‐Streptavidin‐HRP in TurboID‐Flag and mK Ca 3.1‐Flag‐TurboID expressing cells at different time points (1 h, 3 h, 5 h). Ponceau staining was used as a loading control. (D) PCR validation of transgene integration in the different cell lines. (E) Experimental workflow for biotinylation‐based proximity labeling and protein identification. Cells expressing TurboID vectors were treated with doxycycline (1 μg/mL for 24 h) to induce expression, followed by biotin labeling (50 μM for 3 h). After cell lysis, biotinylated proteins were isolated via streptavidin pull‐down, analyzed by MS, and subjected to GO/KEGG enrichment analysis to identify functional interactions. (F) Validation of protein expression and biotinylation efficiency. Western blot analysis using α‐FLAG confirms expression of TurboID‐tagged constructs. α‐Streptavidin‐HRP detection shows biotinylated proteins upon biotin treatment, with increased biotinylation observed in K Ca 3.1‐Flag‐TurboID samples compared to controls. (G) Volcano Plot. The plot categorizes proteins into different groups based on their statistical significance and fold‐change: Enriched hits (blue circles): proteins with high statistical significance ( p < 0.05) and positive fold‐change (log2FC > 0.58). Hits (orange circles): proteins that meet statistical thresholds but have lower fold‐changes. Enriched candidates (green squares): proteins with moderate fold‐change and significance ( p < 0.05; 0.3 < log2FC ≤ 0.58). Candidates (red diamonds): potentially relevant proteins that do not meet strict thresholds. No hits (purple triangles): proteins with no significant differential biotinylation. Proteins with no significant differential expression that are still plotted (brown stars). Thresholds: The black dashed line represents log2FC = 0 (no change).

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Labeling, Cloning, Plasmid Preparation, Expressing, Transduction, Selection, Western Blot, Staining, Control, Biomarker Discovery, Lysis, Isolation, Functional Assay, Construct, Quantitative Proteomics

Functional enrichment and protein–protein interaction network analysis of identified K Ca 3.1 interactors. (A) Heatmap displaying the log2 ratio of gene expression across different experimental conditions. The color scale represents expression changes, where red indicates higher expression levels (log2 ratio > 0) and blue represents lower expression levels. The biotinylated conditions show a marked increase in expression for specific genes compared to the no‐biotin conditions (refer to the attached S2 for high resolution table). (B) Gene Ontology (GO) enrichment analysis highlighting the most significant Biological Processes (BP), Cellular Components (CC), and Molecular Functions (MF) associated with the data set. The enrichment score quantifies the relative representation of each GO term. (C) Correlation between KCNN4 expression and key interactors in pancreatic cancer using correlation analysis. Scatter plots illustrate the correlation between log2(KCNN4 TPM) and the expression levels (log2(TPM)) of selected interacting proteins. The Pearson correlation coefficient ( R ) and p value for each correlation are displayed in the plots. A significant positive correlation was observed with MET ( R = 0.41, p = 1.3e−08), TSG101 ( R = 0.39, p = 1e−07), and CDH1 ( R = 0.36, p = 2.6e−07). (D) PPI network of the 138 membrane proteins identified among the interactors. Functional enrichment analysis of STRING MP network. The figure highlights key biological processes and signaling pathways associated with the analyzed data set. GO:0051049—Regulation of transport (red): 29 of 1998 genes; enrichment score = 0.36; fold change = 0.43; p value = 0.0047. GO: 0005789 Endoplasmic reticulum membrane (yellow): 27 of 1100 genes; enrichment score = 0.59; fold change = 1.0; p value = 1.09e−07. ReacTome: MMU‐194315—Signaling by Rho GTPases (blue): 28 of 603 genes; enrichment score = 0.87; fold change = 1.86; p value = 1.89e−13. WP488–Alpha 6 beta 4 integrin signaling pathway (green): 7 of 66 genes; enrichment score = 1.23; fold change = 1.04; p value = 7.22e−05. Each pathway is color‐coded according to its classification, indicating significant involvement in cellular signaling and transport regulation.

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: Functional enrichment and protein–protein interaction network analysis of identified K Ca 3.1 interactors. (A) Heatmap displaying the log2 ratio of gene expression across different experimental conditions. The color scale represents expression changes, where red indicates higher expression levels (log2 ratio > 0) and blue represents lower expression levels. The biotinylated conditions show a marked increase in expression for specific genes compared to the no‐biotin conditions (refer to the attached S2 for high resolution table). (B) Gene Ontology (GO) enrichment analysis highlighting the most significant Biological Processes (BP), Cellular Components (CC), and Molecular Functions (MF) associated with the data set. The enrichment score quantifies the relative representation of each GO term. (C) Correlation between KCNN4 expression and key interactors in pancreatic cancer using correlation analysis. Scatter plots illustrate the correlation between log2(KCNN4 TPM) and the expression levels (log2(TPM)) of selected interacting proteins. The Pearson correlation coefficient ( R ) and p value for each correlation are displayed in the plots. A significant positive correlation was observed with MET ( R = 0.41, p = 1.3e−08), TSG101 ( R = 0.39, p = 1e−07), and CDH1 ( R = 0.36, p = 2.6e−07). (D) PPI network of the 138 membrane proteins identified among the interactors. Functional enrichment analysis of STRING MP network. The figure highlights key biological processes and signaling pathways associated with the analyzed data set. GO:0051049—Regulation of transport (red): 29 of 1998 genes; enrichment score = 0.36; fold change = 0.43; p value = 0.0047. GO: 0005789 Endoplasmic reticulum membrane (yellow): 27 of 1100 genes; enrichment score = 0.59; fold change = 1.0; p value = 1.09e−07. ReacTome: MMU‐194315—Signaling by Rho GTPases (blue): 28 of 603 genes; enrichment score = 0.87; fold change = 1.86; p value = 1.89e−13. WP488–Alpha 6 beta 4 integrin signaling pathway (green): 7 of 66 genes; enrichment score = 1.23; fold change = 1.04; p value = 7.22e−05. Each pathway is color‐coded according to its classification, indicating significant involvement in cellular signaling and transport regulation.

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Functional Assay, Gene Expression, Expressing, Membrane, Protein-Protein interactions

K Ca 3.1 physically interacts with ITGB4 and promotes cytoskeletal remodeling: (A) K Ca 3.1 immunoprecipitates with ITGB4 in K Ca 3.1 over‐expressing cell line. Immunoprecipitation was performed using an anti‐myc antibody to pull down myc‐tagged K Ca 3.1 in KPCY cells. Western Blot analysis revealed the presence of ITGB4, indicating a physical interaction between K Ca 3.1 and ITGB4. (B) Gene expression correlation analysis between KCNN4 and ITGB4. Scatter plot illustrating a significant positive correlation between KCNN4 and ITGB4 expression levels (Pearson's R = 0.6, p < 0.0001), indicating a potential coregulation or functional association between the two genes. (C) Confocal images of phalloidin staining in KPCY cells over‐expressing K Ca 3.1‐GFP‐myc. Overexpression of K Ca 3.1 in KPCY cells leads to actin cytoskeletal remodeling, characterized by multiple filopodial extensions and well‐defined stress fibers that, in contrast, are largely lacking in the KPCY WT cell line.

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: K Ca 3.1 physically interacts with ITGB4 and promotes cytoskeletal remodeling: (A) K Ca 3.1 immunoprecipitates with ITGB4 in K Ca 3.1 over‐expressing cell line. Immunoprecipitation was performed using an anti‐myc antibody to pull down myc‐tagged K Ca 3.1 in KPCY cells. Western Blot analysis revealed the presence of ITGB4, indicating a physical interaction between K Ca 3.1 and ITGB4. (B) Gene expression correlation analysis between KCNN4 and ITGB4. Scatter plot illustrating a significant positive correlation between KCNN4 and ITGB4 expression levels (Pearson's R = 0.6, p < 0.0001), indicating a potential coregulation or functional association between the two genes. (C) Confocal images of phalloidin staining in KPCY cells over‐expressing K Ca 3.1‐GFP‐myc. Overexpression of K Ca 3.1 in KPCY cells leads to actin cytoskeletal remodeling, characterized by multiple filopodial extensions and well‐defined stress fibers that, in contrast, are largely lacking in the KPCY WT cell line.

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Expressing, Immunoprecipitation, Western Blot, Gene Expression, Functional Assay, Staining, Over Expression

Expression of the KCNN4 gene in tumor and normal samples from the TCGA‐PAAD data set: association with disease progression and survival outcomes. (A) KCNN4 expression in TCGA‐PAAD RNA‐seq data: comparison between normal tissues ( n = 4, blue) and primary tumor samples ( n = 178, red). (B) KCNN4 expression in TCGA‐PAAD samples stratified by nodal metastasis status: normal ( n = 4), N0 ( n = 49), and N1 ( n = 124). (C) KCNN4 expression stratified by ethnicity: Caucasian ( n = 156), African American ( n = 6), and Asian ( n = 11), compared to normal samples ( n = 4). (D) Kaplan–Meier survival analysis of TCGA‐PAAD patients stratified by KCNN4 expression (high vs. low); high expression is associated with significantly worse prognosis ( p = 0.0117, HR = 1.31). (E) KCNN4 expression across tumor stages I–IV in TCGA‐PAAD, compared to normal tissues. (F) KCNN4 expression in TCGA‐PAAD samples with TP53 mutation ( n = 82), non‐mutated TP53 ( n = 93), and normal tissues ( n = 4). (G) TP53 mutations are associated with elevated KCNN4 expression across multiple cancer types. Heatmap shows the log2 fold change in KCNN4 expression in TP53‐mutant cancers from TCGA; asterisks (*) indicate statistically significant differences (adjusted p < 0.05). Statistical comparisons in panels (A, B, C, E, and F) were performed using the Kruskal–Wallis test, followed by Dunn's post hoc test for multiple pairwise comparisons. Sample numbers are indicated below each group. Abbreviation: TPM, Transcripts Per Million.

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: Expression of the KCNN4 gene in tumor and normal samples from the TCGA‐PAAD data set: association with disease progression and survival outcomes. (A) KCNN4 expression in TCGA‐PAAD RNA‐seq data: comparison between normal tissues ( n = 4, blue) and primary tumor samples ( n = 178, red). (B) KCNN4 expression in TCGA‐PAAD samples stratified by nodal metastasis status: normal ( n = 4), N0 ( n = 49), and N1 ( n = 124). (C) KCNN4 expression stratified by ethnicity: Caucasian ( n = 156), African American ( n = 6), and Asian ( n = 11), compared to normal samples ( n = 4). (D) Kaplan–Meier survival analysis of TCGA‐PAAD patients stratified by KCNN4 expression (high vs. low); high expression is associated with significantly worse prognosis ( p = 0.0117, HR = 1.31). (E) KCNN4 expression across tumor stages I–IV in TCGA‐PAAD, compared to normal tissues. (F) KCNN4 expression in TCGA‐PAAD samples with TP53 mutation ( n = 82), non‐mutated TP53 ( n = 93), and normal tissues ( n = 4). (G) TP53 mutations are associated with elevated KCNN4 expression across multiple cancer types. Heatmap shows the log2 fold change in KCNN4 expression in TP53‐mutant cancers from TCGA; asterisks (*) indicate statistically significant differences (adjusted p < 0.05). Statistical comparisons in panels (A, B, C, E, and F) were performed using the Kruskal–Wallis test, followed by Dunn's post hoc test for multiple pairwise comparisons. Sample numbers are indicated below each group. Abbreviation: TPM, Transcripts Per Million.

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Expressing, Biomarker Discovery, RNA Sequencing, Comparison, Mutagenesis

KCNN4 Expression Correlates with Immune Cell Infiltration and Immune Modulation in PAAD. (A) Heatmap displaying correlations between KCNN4 expression and various immune cell populations in PAAD, indicating heterogeneous immune infiltration. Positive correlations (red) indicate an association with immunosuppressive cells (e.g., Tregs, M0 macrophages), while negative correlations (blue) highlight decreased cytotoxic and effector immune cells (e.g., CD8+ T cells, NK cells). (B) Heatmaps illustrating the correlation of KCNN4 with immune stimulatory and immune inhibitory molecules. KCNN4 demonstrates positive associations with immune checkpoint inhibitors (e.g., PD‐L1, TIM‐3, TGFB1). (C and D) Plots depict changes in immune cell abundance in copy number variation (CNV) groups (C) and mutant vs. wild‐type (D). (E) Correlation analysis between KCNN4 expression and immune cell infiltration in PAAD.

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: KCNN4 Expression Correlates with Immune Cell Infiltration and Immune Modulation in PAAD. (A) Heatmap displaying correlations between KCNN4 expression and various immune cell populations in PAAD, indicating heterogeneous immune infiltration. Positive correlations (red) indicate an association with immunosuppressive cells (e.g., Tregs, M0 macrophages), while negative correlations (blue) highlight decreased cytotoxic and effector immune cells (e.g., CD8+ T cells, NK cells). (B) Heatmaps illustrating the correlation of KCNN4 with immune stimulatory and immune inhibitory molecules. KCNN4 demonstrates positive associations with immune checkpoint inhibitors (e.g., PD‐L1, TIM‐3, TGFB1). (C and D) Plots depict changes in immune cell abundance in copy number variation (CNV) groups (C) and mutant vs. wild‐type (D). (E) Correlation analysis between KCNN4 expression and immune cell infiltration in PAAD.

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Expressing, Mutagenesis

Fig. 1. SK4 expression in colorectal cancer. (A) SK4 protein expression in colon cancer and adjacent normal tissues from the CPTAC data portal. Wilcoxon’s signed- rank test was used to compare cancer tissues to their normal counterparts. (B) Immuno-histochemical staining of SK4 in normal colorectal and tumor tissues. Images were downloaded from http://www.proteinatlas.org. (C-E) KCNN4 expression profile in colorectal cancer according to the mutational status of TP53 (C), BRAF (D), and KRAS (E) genes. Student’s t-test was used to compare KCNN4 expression between mutated and wild-type CRC tissues (* p < 0.05, *** p < 0.001). (F) Boxplot showing the expression of KCNN4 in primary and metastatic CRC tissues alongside normal tissues in the GSE41258 dataset. Student’s t-test was used to compare KCNN4 expression between normal liver (N = 11), normal lung (N = 7), polyps (N = 45), primary tumor (N = 183), liver metastasis (N = 38), lung metastasis (N-18), and normal Colon (N = 53) (***: p ≤0.001).

Journal: Cell calcium

Article Title: SK4 oncochannels regulate calcium entry and promote cell migration in KRAS-mutated colorectal cancer.

doi: 10.1016/j.ceca.2021.102384

Figure Lengend Snippet: Fig. 1. SK4 expression in colorectal cancer. (A) SK4 protein expression in colon cancer and adjacent normal tissues from the CPTAC data portal. Wilcoxon’s signed- rank test was used to compare cancer tissues to their normal counterparts. (B) Immuno-histochemical staining of SK4 in normal colorectal and tumor tissues. Images were downloaded from http://www.proteinatlas.org. (C-E) KCNN4 expression profile in colorectal cancer according to the mutational status of TP53 (C), BRAF (D), and KRAS (E) genes. Student’s t-test was used to compare KCNN4 expression between mutated and wild-type CRC tissues (* p < 0.05, *** p < 0.001). (F) Boxplot showing the expression of KCNN4 in primary and metastatic CRC tissues alongside normal tissues in the GSE41258 dataset. Student’s t-test was used to compare KCNN4 expression between normal liver (N = 11), normal lung (N = 7), polyps (N = 45), primary tumor (N = 183), liver metastasis (N = 38), lung metastasis (N-18), and normal Colon (N = 53) (***: p ≤0.001).

Article Snippet: The next day, cells were transfected with siRNAs targeting SK4 (OriGene Technologies, MD, USA) or KRAS (OriGene Technologies,MD, USA) using lipofectamine (RNAiMax reagent, Invitrogen) according to the supplier’s instructions.

Techniques: Expressing, Staining

Fig. 2. SK4 expression and effect of charybdotoxin on CRC cell lines. (A) KCNN4 mRNA expression level in SW480, HCT116, SW48 and HT29 cells. KCNN4 expression for each cell line was measured by RT-qPCR. (N = 3–6). (B) KRAS and KCNN4 expression in HCT116 cells after transfection with two siRNAs targeting KRAS compared to non-targeting control siRNA. Mann-Whitney test (*** p < 0.001) (N = 3). SK4 channel activity in HCT116 cells: 100 nM of Charybdotoxin were used to inhibit SK4 activity (N = 6). (C) Left panel: Examples and macroscopic currents recorded in HCT116 following voltage-pulses from -100 to +100 mV. Recordings were performed using the whole-cell configuration of patch- clamp technique. Right panel: Histogram showing SK4 inward rectification current inhibition by charybdotoxin at 0 mV(N = 6). Mann-Whitney test (** P < 001). (D) (left) Example of membrane potential recorded using the patch-clamp technique in current-clamp mode in control condition (treated with Niflumic acid (NFA) 100 μM) followed charybdotoxin 100 nM application. (right) Histogram showing membrane potential variations observed between NFA and charybdotoxin conditions. Mann-Whitney test (* P < 0,05, N = 7).

Journal: Cell calcium

Article Title: SK4 oncochannels regulate calcium entry and promote cell migration in KRAS-mutated colorectal cancer.

doi: 10.1016/j.ceca.2021.102384

Figure Lengend Snippet: Fig. 2. SK4 expression and effect of charybdotoxin on CRC cell lines. (A) KCNN4 mRNA expression level in SW480, HCT116, SW48 and HT29 cells. KCNN4 expression for each cell line was measured by RT-qPCR. (N = 3–6). (B) KRAS and KCNN4 expression in HCT116 cells after transfection with two siRNAs targeting KRAS compared to non-targeting control siRNA. Mann-Whitney test (*** p < 0.001) (N = 3). SK4 channel activity in HCT116 cells: 100 nM of Charybdotoxin were used to inhibit SK4 activity (N = 6). (C) Left panel: Examples and macroscopic currents recorded in HCT116 following voltage-pulses from -100 to +100 mV. Recordings were performed using the whole-cell configuration of patch- clamp technique. Right panel: Histogram showing SK4 inward rectification current inhibition by charybdotoxin at 0 mV(N = 6). Mann-Whitney test (** P < 001). (D) (left) Example of membrane potential recorded using the patch-clamp technique in current-clamp mode in control condition (treated with Niflumic acid (NFA) 100 μM) followed charybdotoxin 100 nM application. (right) Histogram showing membrane potential variations observed between NFA and charybdotoxin conditions. Mann-Whitney test (* P < 0,05, N = 7).

Article Snippet: The next day, cells were transfected with siRNAs targeting SK4 (OriGene Technologies, MD, USA) or KRAS (OriGene Technologies,MD, USA) using lipofectamine (RNAiMax reagent, Invitrogen) according to the supplier’s instructions.

Techniques: Expressing, Quantitative RT-PCR, Transfection, Control, MANN-WHITNEY, Activity Assay, Patch Clamp, Inhibition, Membrane

Fig. 3. SK4 inhibition reduces Ca2+ entry in HCT116. (A–B) Effect of SK4 inhibition by TRAM-34 (100 nM) (A) or siKCNN4 B (B) on SOCE in HCT116 cells. Left panels: Fluorescence measurement of SOCE induced by TG in TRAM-34 or siKCNN4. Right panels: Fluorescence measurement of SOCE induced by TG in TRAM-34 and siKCNN4 conditions compared to control on the relative fluorescence of HCT116 cells loaded with Fura2-AM (***: p < 0.001) (N = 4 (n = 18–20 per condition)). (C) Effect of Orai1 and TRPC1 inhibition on CCE using Mn2+ quenching assay. Left: The effects of 2-ABP (10 μM), SKF96365 (40 μM) and Synta66 (10 μM) on Mn2+ quenching rate (***: P < 0.001). Right: Effects of 2-ABP, SKF96365 and Synta66 on normalized Mn2+ quenching slope (***P < 0.001) (N = 4, n = 29−23 per condition). (D) Effect of SK4 inhibition on CCE using Mn2+ quenching assay: Representative intensity of TRAM-34 (100 nM) on Mn2+ quenching rate. Effects of TRAM-34 on normalized Mn2+ quenching slope (***P < 0.001, Mann-Whitney test, N = 5, n = 76 per condition).

Journal: Cell calcium

Article Title: SK4 oncochannels regulate calcium entry and promote cell migration in KRAS-mutated colorectal cancer.

doi: 10.1016/j.ceca.2021.102384

Figure Lengend Snippet: Fig. 3. SK4 inhibition reduces Ca2+ entry in HCT116. (A–B) Effect of SK4 inhibition by TRAM-34 (100 nM) (A) or siKCNN4 B (B) on SOCE in HCT116 cells. Left panels: Fluorescence measurement of SOCE induced by TG in TRAM-34 or siKCNN4. Right panels: Fluorescence measurement of SOCE induced by TG in TRAM-34 and siKCNN4 conditions compared to control on the relative fluorescence of HCT116 cells loaded with Fura2-AM (***: p < 0.001) (N = 4 (n = 18–20 per condition)). (C) Effect of Orai1 and TRPC1 inhibition on CCE using Mn2+ quenching assay. Left: The effects of 2-ABP (10 μM), SKF96365 (40 μM) and Synta66 (10 μM) on Mn2+ quenching rate (***: P < 0.001). Right: Effects of 2-ABP, SKF96365 and Synta66 on normalized Mn2+ quenching slope (***P < 0.001) (N = 4, n = 29−23 per condition). (D) Effect of SK4 inhibition on CCE using Mn2+ quenching assay: Representative intensity of TRAM-34 (100 nM) on Mn2+ quenching rate. Effects of TRAM-34 on normalized Mn2+ quenching slope (***P < 0.001, Mann-Whitney test, N = 5, n = 76 per condition).

Article Snippet: The next day, cells were transfected with siRNAs targeting SK4 (OriGene Technologies, MD, USA) or KRAS (OriGene Technologies,MD, USA) using lipofectamine (RNAiMax reagent, Invitrogen) according to the supplier’s instructions.

Techniques: Inhibition, Fluorescence, Control, MANN-WHITNEY

Fig. 4. Effects of SK4 inhibition on cell viability, proliferation and migration. (A) Representative images of spheroids (left) and boxplot (right, N = 4, n = 16) showing the effect of SK4 inhibition by TRAM-34 (100 nM) on HCT116 proliferation in 3D culture model. (B) Effect of SK4 inhibition by TRAM-34 (100 nM) on the proliferation of HCT116 cells in 2D culture. Cell proliferation was measured using MTT assay. (C–D) Effect of SK4 inhibition by TRAM-34 (C) and siRNAs targeting KCNN4 (D) on the cell cycle of HCT116 cells. Untreated cells or cells transfected by non- targeting siRNAs were used as control, respectively. Cell cycle was analysed by flow cytometry following propidium iodide staining. (E–F) Effect of TRAM-34 on cell invasion (E) and migration (F) in HCT116 (N = 3, n = 9). Cell migration and invasion were analyzed using Boyden chamber assay (N = 3, n = 9). (G) Effect of SK4 inhibition by TRAM-34 and siRNAs against KCNN4 on cell migration in real-time condition. (Left) Curves showing the kinetics of normalized cell-index values, measured by xCELLigence cell migration assay. (Right) Boxplots showing the slopes of normalized cell-index from various conditions. Slopes were calculated from data measures between 5 h and 15 h time points. For all experiments except cell cycle and xCELLigence, Mann-Whitney test was used to compare various conditions to respective controls. For cell cycle, two-way ANOVA followed by Student’s t-test was used to compare phases-proportions from various conditions to respective controls. For xCELLigence, one-way ANOVA followed by Student’s t-test was used to compare various conditions to control. (p ≤0.05, **: p ≤0.01, ***: p ≤0.001, N = 3 (n = 5–9 per condition).

Journal: Cell calcium

Article Title: SK4 oncochannels regulate calcium entry and promote cell migration in KRAS-mutated colorectal cancer.

doi: 10.1016/j.ceca.2021.102384

Figure Lengend Snippet: Fig. 4. Effects of SK4 inhibition on cell viability, proliferation and migration. (A) Representative images of spheroids (left) and boxplot (right, N = 4, n = 16) showing the effect of SK4 inhibition by TRAM-34 (100 nM) on HCT116 proliferation in 3D culture model. (B) Effect of SK4 inhibition by TRAM-34 (100 nM) on the proliferation of HCT116 cells in 2D culture. Cell proliferation was measured using MTT assay. (C–D) Effect of SK4 inhibition by TRAM-34 (C) and siRNAs targeting KCNN4 (D) on the cell cycle of HCT116 cells. Untreated cells or cells transfected by non- targeting siRNAs were used as control, respectively. Cell cycle was analysed by flow cytometry following propidium iodide staining. (E–F) Effect of TRAM-34 on cell invasion (E) and migration (F) in HCT116 (N = 3, n = 9). Cell migration and invasion were analyzed using Boyden chamber assay (N = 3, n = 9). (G) Effect of SK4 inhibition by TRAM-34 and siRNAs against KCNN4 on cell migration in real-time condition. (Left) Curves showing the kinetics of normalized cell-index values, measured by xCELLigence cell migration assay. (Right) Boxplots showing the slopes of normalized cell-index from various conditions. Slopes were calculated from data measures between 5 h and 15 h time points. For all experiments except cell cycle and xCELLigence, Mann-Whitney test was used to compare various conditions to respective controls. For cell cycle, two-way ANOVA followed by Student’s t-test was used to compare phases-proportions from various conditions to respective controls. For xCELLigence, one-way ANOVA followed by Student’s t-test was used to compare various conditions to control. (p ≤0.05, **: p ≤0.01, ***: p ≤0.001, N = 3 (n = 5–9 per condition).

Article Snippet: The next day, cells were transfected with siRNAs targeting SK4 (OriGene Technologies, MD, USA) or KRAS (OriGene Technologies,MD, USA) using lipofectamine (RNAiMax reagent, Invitrogen) according to the supplier’s instructions.

Techniques: Inhibition, Migration, MTT Assay, Transfection, Control, Flow Cytometry, Staining, Boyden Chamber Assay, Cell Migration Assay, MANN-WHITNEY

Fig. 5. Effect of SK4 inhibition on intracytoplasmic ROS, NRF2 expression and HIF1α stabilization. (A) Effect of SK4 inhibition by TRAM-34 (100 nM) on intracytoplasmic ROS. Left: Curves representing ROS production kinetics as assessed by DCFDA. (B) ROS production rates in TRAM-34 treated and control HCT116. (N = 5, n = 30–51, Mann-Whitney test, **: p < 0.01) (C) Effect of SK4 inhibition by TRAM-34 (100 nM) on HIF1α stabilization. HIF1α expression was detected by Nanoluc activity under normoxia and hypoxia (1% O2) conditions (N = 4, n = 14 per condition, Mann-Whitney test, **: p < 0.01; ***: p < 0.001). (D) Geneset enrichment analysis (GSEA) of NRF2 target genes in 96 primary CRC tissues from the CPTAC proteomic dataset. (E) Effect of SK4 inhibition by TRAM-34 (100 nM) on NRF2 expression was detected by Nanoluc activity (NFE2L2 C-terminal NanoLuc) under normoxia and hypoxia conditions (N = 4, n = 13–20 per condition, Mann-Whitney test ***: p < 0.001).

Journal: Cell calcium

Article Title: SK4 oncochannels regulate calcium entry and promote cell migration in KRAS-mutated colorectal cancer.

doi: 10.1016/j.ceca.2021.102384

Figure Lengend Snippet: Fig. 5. Effect of SK4 inhibition on intracytoplasmic ROS, NRF2 expression and HIF1α stabilization. (A) Effect of SK4 inhibition by TRAM-34 (100 nM) on intracytoplasmic ROS. Left: Curves representing ROS production kinetics as assessed by DCFDA. (B) ROS production rates in TRAM-34 treated and control HCT116. (N = 5, n = 30–51, Mann-Whitney test, **: p < 0.01) (C) Effect of SK4 inhibition by TRAM-34 (100 nM) on HIF1α stabilization. HIF1α expression was detected by Nanoluc activity under normoxia and hypoxia (1% O2) conditions (N = 4, n = 14 per condition, Mann-Whitney test, **: p < 0.01; ***: p < 0.001). (D) Geneset enrichment analysis (GSEA) of NRF2 target genes in 96 primary CRC tissues from the CPTAC proteomic dataset. (E) Effect of SK4 inhibition by TRAM-34 (100 nM) on NRF2 expression was detected by Nanoluc activity (NFE2L2 C-terminal NanoLuc) under normoxia and hypoxia conditions (N = 4, n = 13–20 per condition, Mann-Whitney test ***: p < 0.001).

Article Snippet: The next day, cells were transfected with siRNAs targeting SK4 (OriGene Technologies, MD, USA) or KRAS (OriGene Technologies,MD, USA) using lipofectamine (RNAiMax reagent, Invitrogen) according to the supplier’s instructions.

Techniques: Inhibition, Expressing, Control, MANN-WHITNEY, Activity Assay