Journal: Biomedicines

Article Title: Soluble JAM-C Ectodomain Serves as the Niche for Adipose-Derived Stromal/Stem Cells

doi: 10.3390/biomedicines9030278

Figure Lengend Snippet: Antibodies.

Article Snippet: To prepare the recombinant protein-coated plates, 1 µg of recombinant JAM-B (rJAM-B; 50464-M08H, SinoBiological, Beijing, China), recombinant JAM-C (rJAM-C; 50465-M08H, SinoBiological, Beijing, China), normal mouse IgG (12-371, Merck Millipore, Burlington, MA, USA) or Cellmatrix type I-A collagen (KP-2020, Nitta gelatin, Osaka, Japan) was placed in 12-well plates overnight at 4 °C.

Techniques:

Journal: Biomedicines

Article Title: Soluble JAM-C Ectodomain Serves as the Niche for Adipose-Derived Stromal/Stem Cells

doi: 10.3390/biomedicines9030278

Figure Lengend Snippet: JAM-B and JAM-C are concentrated on cell membranes of mouse adipose-derived stromal/stem cells (ADSCs). RT-PCR ( A ) and Western blot ( B ) for the indicated molecules in ADSCs derived from three mice (#1–3). Mouse kidney (for Jam-4 ) and spleen tissues (for other junctional adhesion molecules; JAMs) are used as positive controls (Ctrl). P, passage. ( C ) Confocal images of ADSCs stained for the indicated markers. Arrowheads show JAM-B- and JAM-C-immunoreactive signals on the cell membranes of ADSCs. Squares indicate the enlarged areas. Scale bar, 50 µm.

Article Snippet: To prepare the recombinant protein-coated plates, 1 µg of recombinant JAM-B (rJAM-B; 50464-M08H, SinoBiological, Beijing, China), recombinant JAM-C (rJAM-C; 50465-M08H, SinoBiological, Beijing, China), normal mouse IgG (12-371, Merck Millipore, Burlington, MA, USA) or Cellmatrix type I-A collagen (KP-2020, Nitta gelatin, Osaka, Japan) was placed in 12-well plates overnight at 4 °C.

Techniques: Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Staining

Journal: Biomedicines

Article Title: Soluble JAM-C Ectodomain Serves as the Niche for Adipose-Derived Stromal/Stem Cells

doi: 10.3390/biomedicines9030278

Figure Lengend Snippet: Fluorescence-activated cell sorting (FACS) profiles of the stromal vascular fraction (SVF) of the mouse adipose tissue. ( A ) Association between the expression of mesenchymal stem cell (MSC) markers CD44, CD105, CD140a and Sca-1 and JAM-B or JAM-C expression. ( B ) The JAM-C expression in the Sca1 /CD31 − /CD45 − /Ter119 − cell lineage.

Article Snippet: To prepare the recombinant protein-coated plates, 1 µg of recombinant JAM-B (rJAM-B; 50464-M08H, SinoBiological, Beijing, China), recombinant JAM-C (rJAM-C; 50465-M08H, SinoBiological, Beijing, China), normal mouse IgG (12-371, Merck Millipore, Burlington, MA, USA) or Cellmatrix type I-A collagen (KP-2020, Nitta gelatin, Osaka, Japan) was placed in 12-well plates overnight at 4 °C.

Techniques: Fluorescence, FACS, Expressing

Journal: Biomedicines

Article Title: Soluble JAM-C Ectodomain Serves as the Niche for Adipose-Derived Stromal/Stem Cells

doi: 10.3390/biomedicines9030278

Figure Lengend Snippet: JAM-C is widely distributed in the fat interstitial tissues. ( A – C ) Confocal images of mouse ADSCs stained for the indicated markers. Asterisks indicate lipid droplets in differentiated adipocytes, and arrowheads show colocalization of JAM-C and ether type III collagen or heparan sulfate proteoglycan (HSPG). Squares show the enlarged areas. Scale bars, 50 µm.

Article Snippet: To prepare the recombinant protein-coated plates, 1 µg of recombinant JAM-B (rJAM-B; 50464-M08H, SinoBiological, Beijing, China), recombinant JAM-C (rJAM-C; 50465-M08H, SinoBiological, Beijing, China), normal mouse IgG (12-371, Merck Millipore, Burlington, MA, USA) or Cellmatrix type I-A collagen (KP-2020, Nitta gelatin, Osaka, Japan) was placed in 12-well plates overnight at 4 °C.

Techniques: Staining

Journal: Biomedicines

Article Title: Soluble JAM-C Ectodomain Serves as the Niche for Adipose-Derived Stromal/Stem Cells

doi: 10.3390/biomedicines9030278

Figure Lengend Snippet: The cleaved JAM-C ectodomain is accumulated in the fat interstitial tissues. ( A ) Schematic illustration for detecting full-length JAM-C (fJAM-C) and/or soluble JAM-C (sJAM-C) using JAM-C (N) and JAM-C (C) antibodies (Abs) targeting the N- and C-termini, respectively. ( B ) Knockdown of the Jam3 gene encoding mouse JAM-C in ADSCs using the CRISPR method. ( C ) Western blot for the indicated proteins in the whole-cell lysates and supernatants of the revealed ADSCs. ( D ) Western blot for the indicated proteins in the whole-cell lysates of mouse adult spleen tissue (control), adipose tissue and ADSCs. ( E ) Confocal images of mouse adipose tissue stained with JAM-C (N) and JAM-C (C) Abs. Asterisks indicate lipid droplets in differentiated adipocytes. Squares show the enlarged areas. Scale bar, 50 µm.

Article Snippet: To prepare the recombinant protein-coated plates, 1 µg of recombinant JAM-B (rJAM-B; 50464-M08H, SinoBiological, Beijing, China), recombinant JAM-C (rJAM-C; 50465-M08H, SinoBiological, Beijing, China), normal mouse IgG (12-371, Merck Millipore, Burlington, MA, USA) or Cellmatrix type I-A collagen (KP-2020, Nitta gelatin, Osaka, Japan) was placed in 12-well plates overnight at 4 °C.

Techniques: CRISPR, Western Blot, Staining

Journal: Biomedicines

Article Title: Soluble JAM-C Ectodomain Serves as the Niche for Adipose-Derived Stromal/Stem Cells

doi: 10.3390/biomedicines9030278

Figure Lengend Snippet: Soluble JAM-C functions as the niche for ADSCs. ( A ) Schematic illustration of recombinant JAM-B (rJAM-B) and rJAM-C. S, signal domain; EC, extracellular domain; TM, transmembrane domain; C, cytoplasmic domain. ( B ) Cell adhesion assay for ADSCs grown on culture dishes coated with the indicated proteins. The relative levels are shown in histograms (mean ± SD; n = 5). ( C ) BrdU assay for ADSCs grown on culture plates coated with the indicated proteins. The BrdU/DAPI levels are shown in histograms (mean ± SD; n = 12). Scale bar, 100 µm. ( D ) RT-qPCR for the indicated MSC markers in ADSCs grown on culture dishes coated with the indicated proteins. The relative expression levels are shown in the histograms (mean ± SD; n = 4). * p < 0.05; ** p < 0.01; *** p < 0.001.

Article Snippet: To prepare the recombinant protein-coated plates, 1 µg of recombinant JAM-B (rJAM-B; 50464-M08H, SinoBiological, Beijing, China), recombinant JAM-C (rJAM-C; 50465-M08H, SinoBiological, Beijing, China), normal mouse IgG (12-371, Merck Millipore, Burlington, MA, USA) or Cellmatrix type I-A collagen (KP-2020, Nitta gelatin, Osaka, Japan) was placed in 12-well plates overnight at 4 °C.

Techniques: Recombinant, Cell Adhesion Assay, BrdU Staining, Quantitative RT-PCR, Expressing

Journal: Biomedicines

Article Title: Soluble JAM-C Ectodomain Serves as the Niche for Adipose-Derived Stromal/Stem Cells

doi: 10.3390/biomedicines9030278

Figure Lengend Snippet: Association between soluble JAM-C and full-length JAM-B on ADSCs. Whole-cell lysates (1% of the input protein samples) and the samples immunoprecipitated (IP) with IgG or JAM-B Ab were immunoblotted (IB) with the indicated Abs. N.S., nonspecific signals.

Article Snippet: To prepare the recombinant protein-coated plates, 1 µg of recombinant JAM-B (rJAM-B; 50464-M08H, SinoBiological, Beijing, China), recombinant JAM-C (rJAM-C; 50465-M08H, SinoBiological, Beijing, China), normal mouse IgG (12-371, Merck Millipore, Burlington, MA, USA) or Cellmatrix type I-A collagen (KP-2020, Nitta gelatin, Osaka, Japan) was placed in 12-well plates overnight at 4 °C.

Techniques: Immunoprecipitation

Journal: Biomedicines

Article Title: Soluble JAM-C Ectodomain Serves as the Niche for Adipose-Derived Stromal/Stem Cells

doi: 10.3390/biomedicines9030278

Figure Lengend Snippet: A Soluble JAM-C couples with JAM-B to promote the ADSC adhesion and niche function. ( A ) Knockdown of the Jam2 gene encoding mouse JAM-B in ADSCs using the CRISPR method. ( B ) Western blot for the indicated proteins in the whole-cell lysates of the revealed ADSCs. ( C ) Cell adhesion assay for ADSCs grown in the indicated culture conditions. The relative levels are shown in histograms (mean ± SD; n = 8). ( D ) RT-qPCR for the indicated MSC markers in ADSCs cultivated in the indicated culture conditions. The relative expression levels are shown in the histograms (mean ± SD; n = 4). * p < 0.05; ** p < 0.01; *** p < 0.001.

Article Snippet: To prepare the recombinant protein-coated plates, 1 µg of recombinant JAM-B (rJAM-B; 50464-M08H, SinoBiological, Beijing, China), recombinant JAM-C (rJAM-C; 50465-M08H, SinoBiological, Beijing, China), normal mouse IgG (12-371, Merck Millipore, Burlington, MA, USA) or Cellmatrix type I-A collagen (KP-2020, Nitta gelatin, Osaka, Japan) was placed in 12-well plates overnight at 4 °C.

Techniques: CRISPR, Western Blot, Cell Adhesion Assay, Quantitative RT-PCR, Expressing

Journal: Biomedicines

Article Title: Soluble JAM-C Ectodomain Serves as the Niche for Adipose-Derived Stromal/Stem Cells

doi: 10.3390/biomedicines9030278

Figure Lengend Snippet: Schematic model for the regulation of ADSC functions by soluble JAM-C. The soluble JAM-C (sJAM-C) deposited on the extracellular matrix interacts with JAM-B and partly with JAM-C on ADSC. sJAM-C/JAM-B signaling reaches the nucleus (dashed arrow) and stimulates cellular proliferation and expression of MSC markers (arrows). MSC, mesenchymal stromal/stem cell.

Article Snippet: To prepare the recombinant protein-coated plates, 1 µg of recombinant JAM-B (rJAM-B; 50464-M08H, SinoBiological, Beijing, China), recombinant JAM-C (rJAM-C; 50465-M08H, SinoBiological, Beijing, China), normal mouse IgG (12-371, Merck Millipore, Burlington, MA, USA) or Cellmatrix type I-A collagen (KP-2020, Nitta gelatin, Osaka, Japan) was placed in 12-well plates overnight at 4 °C.

Techniques: Expressing

Journal: PLoS ONE

Article Title: A novel immunotoxin reveals a new role for CD321 in endothelial cells

doi: 10.1371/journal.pone.0181502

Figure Lengend Snippet: (A) Expression profile in endothelial cell lines. Indicated endothelial cell lines were tested by staining with control (gray) or 90G4 antibodies (black). Data of FITC fluorescent intensity (FL1) indicated in histogram. Data presents three independent experiments. (B) Biochemical profiling of the molecular weight of the putative antigen. SVEC4-10 cells were surface-biotinylated with Sulfo-NHS-Biotin and lysed in NP40 buffer, followed by immunoprecipitation with 90G4 or IgG2a, к control antibodies. After SDS-polyacrylamide gel electrophoresis (PAGE), the putative antigen was visualized by probing the streptavidin-HRP (Str-HRP) conjugate by chemiluminescence. The molecular weight of the detected protein was 35 kDa. (C) Identification of 90G4 antigen. Amino acid sequence of CD321 proteins were indicated with the two of underlined peptide sequences that are detected by LC-MS/MS analysis. (D) Specific immunoreactivity of 90G4 antibody against CD321. The expression vectors encoding CD321, CD322, or CD323 cDNA were transfected into CHO cells, which were then subjected to flow cytometry analysis. Data are presented in contour plot (top) or overlaid in histogram (bottom) of FITC signal intensity of sample (black) or control (gray).

Article Snippet: The pCMV6-C-terminal Myc-DDK-tagged ORF clones of mouse CD322 (Jam2, MR204155) and CD323 (Jam3, MR204404) were purchased from OriGene Technologies, Inc. (Rockville, MD USA).

Techniques: Expressing, Staining, Molecular Weight, Immunoprecipitation, Polyacrylamide Gel Electrophoresis, Sequencing, Liquid Chromatography with Mass Spectroscopy, Transfection, Flow Cytometry

Journal: Journal of Cellular and Molecular Medicine

Article Title: Downregulation of JAM3 occurs in cholangiocarcinoma by hypermethylation: A potential molecular marker for diagnosis and prognosis

doi: 10.1111/jcmm.18038

Figure Lengend Snippet: (A) Junctional adhesion molecular 3 mRNA high expressed in RBE, low expressed in HCCC‐9810 and lost in HuCCT1. (B) GAPDH used as an internal control. (C) JAM3 mRNA expression was restored by treatment of 5‐AZA in HCCC‐9810 and HuCCT1, no change in RBE. (D) GAPDH used as an internal control.

Article Snippet: The sequences were JAM3 siRNA sense 5′‐UUCACUUGCACAGUUAACUCGAUCA‐3′ and antisense, 5′‐UGAUCGAGUUAACUGUGCAAGUGAA‐3′; nontargeting siRNA (siNC) control sense, 5′‐UUCUCCGAACGUGUCACGUTT‐3′ and control antisense 5′‐ACGUGACCGUUCGGAGAATT‐3′. siRNA synthesis was conducted by Sangon Biotech Company (Sangon Biotech).

Techniques: Control, Expressing

Journal: Journal of Cellular and Molecular Medicine

Article Title: Downregulation of JAM3 occurs in cholangiocarcinoma by hypermethylation: A potential molecular marker for diagnosis and prognosis

doi: 10.1111/jcmm.18038

Figure Lengend Snippet: Bisulfite treated DNA direct sequencing (BSP) of RBE, HCCC‐9810, HuCCT1 CCA cell lines, and CCA tissues. (A) There are 3 CpG islands in the promoter related region of JAM3. BSP primer set was located around transcript start site (ATG). (B) There are 8 CG sites in the amplicon. (C) No methylated CG site was detected in RBE cells. (D, E) Methylated CG sites were detected in HCCC‐9810 and HuCCT1. Representative examples of BSP results correspond to immunohistochemical staining results of JAM3 in CCA tissues. (F, G, H) Methylated CG sites were detected in CCA tissues with negative staining of JAM3. (I) Both of methylated and unmethylated DNAs were detected in CCA tissue with positive staining of JAM3.

Article Snippet: The sequences were JAM3 siRNA sense 5′‐UUCACUUGCACAGUUAACUCGAUCA‐3′ and antisense, 5′‐UGAUCGAGUUAACUGUGCAAGUGAA‐3′; nontargeting siRNA (siNC) control sense, 5′‐UUCUCCGAACGUGUCACGUTT‐3′ and control antisense 5′‐ACGUGACCGUUCGGAGAATT‐3′. siRNA synthesis was conducted by Sangon Biotech Company (Sangon Biotech).

Techniques: Sequencing, Amplification, Methylation, Immunohistochemical staining, Staining, Negative Staining

Journal: Journal of Cellular and Molecular Medicine

Article Title: Downregulation of JAM3 occurs in cholangiocarcinoma by hypermethylation: A potential molecular marker for diagnosis and prognosis

doi: 10.1111/jcmm.18038

Figure Lengend Snippet: Biological function studies of JAM3 were carried out on RBE, HCCC‐9810 and HuCCT1 CCA cell lines with transfection of siRNA and pCMV3‐JAM3 plasmid. JAM3 depletion by transfection of targeting siRNA in RBE cells significantly increased the proliferation, invasion and migration and suppressed apoptosis (A–D). Transfection of pCMV3‐JAM3 plasmid significantly suppressed the proliferation, invasion and migration and induced apoptosis (3E–H) of HCCC‐9810 and HuCCT1 cells after transfected with pCMV3‐JAM3 plasmid compared to the corresponding control. (Magnification × 200). * p < 0.05, ** p 0.01, *** p < 0.001.

Article Snippet: The sequences were JAM3 siRNA sense 5′‐UUCACUUGCACAGUUAACUCGAUCA‐3′ and antisense, 5′‐UGAUCGAGUUAACUGUGCAAGUGAA‐3′; nontargeting siRNA (siNC) control sense, 5′‐UUCUCCGAACGUGUCACGUTT‐3′ and control antisense 5′‐ACGUGACCGUUCGGAGAATT‐3′. siRNA synthesis was conducted by Sangon Biotech Company (Sangon Biotech).

Techniques: Transfection, Plasmid Preparation, Migration, Control

Journal: Journal of Cellular and Molecular Medicine

Article Title: Downregulation of JAM3 occurs in cholangiocarcinoma by hypermethylation: A potential molecular marker for diagnosis and prognosis

doi: 10.1111/jcmm.18038

Figure Lengend Snippet: JAM3 protein was positive expressed in normal bile duct cells and differentially expressed in tumour cells of CCA. (A) JAM3 was positively expressed in normal bile duct cells. (magnification 400×) (B) JAM3 was positively expressed in tumour cells of CCA. (magnification 400×) (C) JAM3 was moderately expressed in tumour cells of CCA. (magnification 400×) (D) JAM3 was weakly expressed in tumour cells of CCA. (magnification 400×) (E, F, G) JAM3 was negatively expressed in tumour cells of CCA. (magnification 400×) (H) JAM3 was positively expressed normal bile duct cells (red arrow) and negatively expressed in tumour cells of CCA (black arrow). (magnification 100×).

Article Snippet: The sequences were JAM3 siRNA sense 5′‐UUCACUUGCACAGUUAACUCGAUCA‐3′ and antisense, 5′‐UGAUCGAGUUAACUGUGCAAGUGAA‐3′; nontargeting siRNA (siNC) control sense, 5′‐UUCUCCGAACGUGUCACGUTT‐3′ and control antisense 5′‐ACGUGACCGUUCGGAGAATT‐3′. siRNA synthesis was conducted by Sangon Biotech Company (Sangon Biotech).

Techniques:

Journal: Journal of Cellular and Molecular Medicine

Article Title: Downregulation of JAM3 occurs in cholangiocarcinoma by hypermethylation: A potential molecular marker for diagnosis and prognosis

doi: 10.1111/jcmm.18038

Figure Lengend Snippet: Association of JAM3 expression and hypermethylation with clinicopathological parameters.

Article Snippet: The sequences were JAM3 siRNA sense 5′‐UUCACUUGCACAGUUAACUCGAUCA‐3′ and antisense, 5′‐UGAUCGAGUUAACUGUGCAAGUGAA‐3′; nontargeting siRNA (siNC) control sense, 5′‐UUCUCCGAACGUGUCACGUTT‐3′ and control antisense 5′‐ACGUGACCGUUCGGAGAATT‐3′. siRNA synthesis was conducted by Sangon Biotech Company (Sangon Biotech).

Techniques: Expressing, Significance Assay

Journal: Journal of Cellular and Molecular Medicine

Article Title: Downregulation of JAM3 occurs in cholangiocarcinoma by hypermethylation: A potential molecular marker for diagnosis and prognosis

doi: 10.1111/jcmm.18038

Figure Lengend Snippet: Methylation of JAM3 in cfDNA of CCA and biliary diseases.

Article Snippet: The sequences were JAM3 siRNA sense 5′‐UUCACUUGCACAGUUAACUCGAUCA‐3′ and antisense, 5′‐UGAUCGAGUUAACUGUGCAAGUGAA‐3′; nontargeting siRNA (siNC) control sense, 5′‐UUCUCCGAACGUGUCACGUTT‐3′ and control antisense 5′‐ACGUGACCGUUCGGAGAATT‐3′. siRNA synthesis was conducted by Sangon Biotech Company (Sangon Biotech).

Techniques: Methylation, Significance Assay

Journal: Journal of Cellular and Molecular Medicine

Article Title: Downregulation of JAM3 occurs in cholangiocarcinoma by hypermethylation: A potential molecular marker for diagnosis and prognosis

doi: 10.1111/jcmm.18038

Figure Lengend Snippet: Survival analysis based on GSCA (Gene Set Cancer Analysis) database. (A) No significant difference was found between low and high expression of JAM3 in CCA patient's overall survival ( p = 0.36). (B) Progression‐Free Survival (PFS) was significantly longer in patients with JAM3 high expression ( p = 0.045). (C) No difference in overall survival for patients in methylation status ( p = 0.62). (D) CCA patients with hypermethylation of JAM3 had a poor progression‐free survival than those with unmethylated ( p = 0.034).

Article Snippet: The sequences were JAM3 siRNA sense 5′‐UUCACUUGCACAGUUAACUCGAUCA‐3′ and antisense, 5′‐UGAUCGAGUUAACUGUGCAAGUGAA‐3′; nontargeting siRNA (siNC) control sense, 5′‐UUCUCCGAACGUGUCACGUTT‐3′ and control antisense 5′‐ACGUGACCGUUCGGAGAATT‐3′. siRNA synthesis was conducted by Sangon Biotech Company (Sangon Biotech).

Techniques: Expressing, Methylation