Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 1. Increased accumulation of unfolded protein in BRCA1-def cells, localization of BRCA1 protein to the ER, and interaction with ERAD E3 ligase complex components (A) Photomicrographs of MDA-MB-436(+ or def) cells labeled with TPE-MI (light/blue) and concanavalin-A (red). Scale = 20 mm. TPE = TPE-MI. + = BRCA1- replete. def = BRCA1-deficient. (B) Representative flow cytometry dot plots of TPE-high population in BRCA1-def and BRCA1+ cells. (C and D) Quantitative analysis of TPE signal intensity of each cell preparation. (E) Confocal microscopy images of BRCA1-proficient MDA-MB-231 breast cancer cells. Top, cells were immunostained with BRCA1 (red) and DERL1 (DERLIN-1) (yellow) antibodies. Bottom, cells were immunostained with secondary antibodies conjugated with fluorophores as control. All cells were counterstained with DAPI (blue). Scale = 5 mM. Green = GFP-KDEL. (F and G) Immunoprecipitation (IP) of BRCA1 protein pull-downs of DERL1 and SEL1L from MCF7 (F) or MDA-MB-231 (G) cytoplasmic protein extract. IB = immunoblotting. IN = Input. Ig = non-specific immunoglobulin fragments. IgG(H) & IgG(L) = heavy and light chains. BRCA1 IB: ** = truncated BRCA1. *** = delta11q isoform. Data are represented as mean G SD. P value was calculated by Student’s two-tailed, unpaired t-test. *** <0.001. See also Figures S1–S3.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: Labeling, Cytometry, Confocal Microscopy, Control, Immunoprecipitation, Western Blot, Two Tailed Test

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 2. BRCA1 protein interacts with and ubiquitinates PERK and IRE1 (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: * = hyperphosphorylated BRCA1, ** = truncated BRCA1. *** = delta11q isoform. IRE1 IB: * = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean G SD. P value was calculated by Student’s two-tailed, unpaired t-test. * <0.05. See also Figures S4–S6.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: Isolation, Control, Expressing, Immunoprecipitation, Ubiquitin Proteomics, Transfection, In Vitro, Two Tailed Test

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 3. Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 30UTR siRNA or (iv) PPIB/pCMV and CypB 30UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figures S7 and S8.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: Transfection, Control, Western Blot, Plasmid Preparation, Two Tailed Test

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 4. Cyclophilin inhibitor treatment increases unfolded proteins and PDI aggregates formation in BRCA1-def cancer cells (A) Photomicrographs of DMSO- or CsA-treated MDA-MB-436 (+ or def) cells labeled with TPE-MI (light/blue) and quantitative analysis of TPE signal intensity of each cell preparation. Scale = 20 mm. TPE = TPE-MI. + = BRCA1-replete. def = BRCA1-deficient. (B) Representative flow dot plots of TPE signals in DMSO- or CsA-treated MDA-MB-436 (+ or def) breast cancer cells and quantitative analysis of TPE-high cell population of each cell preparation. (C and D) Quantitative analysis of TPE signal intensity of each cell preparation. (E) Confocal microscopy images of DMSO- or CsA-treated MDA-MB-436 (+ or def) breast cancer cells. Cells were co-immunostained with CypB (red) and PDI (green) antibodies. Top, 2 days post-treatment. Bottom, 3 days post-treatment. All cells were counterstained with DAPI (blue). Scale = 5 mM. Bar charts are quantitative analyses of cell populations with PDI aggregate formation. (F) Depletion of PDI induced severe synthetic lethality in MDA-MB-436 BRCA1-def cancer cells. Top, Western blot analysis. Middle, representative images of colony forming units (CFUs) from control or CypB knock-down cancer cells after 14 days culturing. Bottom, quantitative analysis of the clonal colony formation assay. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figure S8.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: Labeling, Confocal Microscopy, Western Blot, Control, Knockdown, Colony Assay, Two Tailed Test

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 5. Cyclophilin inhibitors induce severe synthetic lethality in BRCA1-def cancer cells in vitro and in vivo (A) BRCA1-def cancer cells (MDA-MB-436, HCC1937, SUM149PT or UWB1.289), BRCA1-proficient cancer cells (MDA-MB-436, MDA-MB-231 or MCF7) and non-tumorigenic mammary epithelial cells (MCF10A) were seeded one day prior to drug treatment. A single continuous dose of CsA, NIM811 or Alisporivir was added to the corresponding cell lines. Quantitative analysis of each survival curve is shown in graphs. CsA = Cyclosporin A. CFU = Colony forming units. DMSO = dimethyl sulfoxide vehicle. (B) CsA treatment of human BRCA1-def breast cancer cells in a murine model. Representative luciferase images of each treated subject were taken by an In Vivo Imaging systems (IVIS). Animals were either treated with vehicle (control) or CsA (treatment) for 6 weeks post-tumor formation. (C) Quantitative analysis of tumor progression from each group was summarized in graph. (D) Schematic diagram depicts the model of wildtype and mutant BRCA1 regulation of the ERAD and UPR signaling pathways to maintain protein homeostasis in the ER. Wt = wildtype. def = deficient. Ub = ubiquitin. P = phosphate. Dashed arrow = less favored pathway. Ubiquitination and phosphorylation modifications in the diagram are simplified for clarity. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: In Vitro, In Vivo, Luciferase, In Vivo Imaging, Control, Mutagenesis, Protein-Protein interactions, Ubiquitin Proteomics, Phospho-proteomics, Two Tailed Test

Journal: Acta Neuropathologica

Article Title: Granulovacuolar degeneration bodies are neuron-selective lysosomal structures induced by intracellular tau pathology

doi: 10.1007/s00401-019-02046-4

Figure Lengend Snippet: Overview of the primary antibodies used in the present study

Article Snippet: pIRE1α , Ser724 , Rabbit polyclonal , 1:1250 , , 1:50 , , , , Novus Biologicals , NB100-2323.

Techniques: In Vitro, Transduction

Journal: Communications biology

Article Title: Low-dose ethanol consumption inhibits neutrophil extracellular traps formation to alleviate rheumatoid arthritis.

doi: 10.1038/s42003-023-05473-y

Figure Lengend Snippet: Fig. 3 Ethanol treatment may be associated with the inhibition of ERS and upregulation of IRE1-NETs. a Immunofluorescence staining of MPO (green) and p-IRE1 (red) in the ankle joints of mice. MPO and p-IRE1, which indicate NETs and ERS, respectively, are co-localized in the ankle joints of CIA mice (Scale Bar: 200 μm and 50 μm). b Immunohistochemical staining of MPO in the joint synovium of patients with OA and RA (Scale Bar: 100 μm and 50 μm). c Western blot detection of neutrophils in peripheral blood of healthy volunteers and RA patients. Data are representative of three independent experiments. d Immunofluorescence staining of MPO (green) and p-IRE1 (red) in the synovium of OA and RA patients. ERS is observed in neutrophils of the synovium of RA patients (Scale Bar: 25 μm).

Article Snippet: Slides were stained overnight at 4 °C with the following primary antibodies: MPO (66177-1-lg 90, Proteintech) and/or p-IRE1 (Ser724) (R24754, Zen BioScience) and/or H3cit (ab219407, Abcam).

Techniques: Inhibition, Staining, Immunohistochemical staining, Western Blot

Journal: Communications biology

Article Title: Low-dose ethanol consumption inhibits neutrophil extracellular traps formation to alleviate rheumatoid arthritis.

doi: 10.1038/s42003-023-05473-y

Figure Lengend Snippet: Fig. 6 Acetate reduces ERS in neutrophils and inhibits the formation of NETs. a Scanning electron microscopy observation of treated neutrophils (Scale Bar: 2 μm). i: Neutrophil-like differentiation of HL-60 (dHL-60) cells that developed NETs after 4 h of PMA treatment in vitro. ii: There were no NETs in dHL-60 cells treated with acetate and PMA. b Immunofluorescence staining of Sytox-green (green) and MPO (red) in dHL-60 cells, showing that NETs are reduced under sodium acetate treatment (Scale Bar: 50 μm and 25 μm). c Immunofluorescence staining of MPO (green) and p-IRE1 (red) in dHL-60 cells, showing that MPO and p-IRE1 co-localization is reduced under sodium acetate treatment (Scale Bar: 10 μm and 50 μm). d The effects of GRP78/p-IRE1/ IRE1/CHOP/ATF6/XBP1/H3cit/MPO in dHL-60 cells exposed to different concentrations of acetate. Data are representative of three independent experiments. e The effects of H3cit/MPO in dHL-60 cells exposed to different concentrations of ethanol. Data are representative of three independent experiments. f The effects of acetate receptor GPR43 and its downstream proteins in dHL-60 cells after stimulated by TG. Data are representative of three independent experiments. g The effects of GRP78/p-IRE1/IRE1/CHOP/ATF6/XBP1/H3cit/MPO in dHL-60 cells after stimulated by TG. Data are representative of three independent experiments. h Immunoprecipitation analysis of ubiquitination of endogenous GRK2 in dHL-60 cells. Data are representative of three independent experiments.

Article Snippet: Slides were stained overnight at 4 °C with the following primary antibodies: MPO (66177-1-lg 90, Proteintech) and/or p-IRE1 (Ser724) (R24754, Zen BioScience) and/or H3cit (ab219407, Abcam).

Techniques: Electron Microscopy, In Vitro, Staining, Immunoprecipitation, Ubiquitin Proteomics

Journal: Communications biology

Article Title: Low-dose ethanol consumption inhibits neutrophil extracellular traps formation to alleviate rheumatoid arthritis.

doi: 10.1038/s42003-023-05473-y

Figure Lengend Snippet: Fig. 8 Response process after low-dose ethanol treatment. Low-does ethanol treatment alters the gut microbiota, among which Muribaculaceae increases significantly, and the levels of SCFAs especially acetate in serum increases accordingly. Acetate affects the activity of neutrophils by acting on GPR43 on neutrophils, inhibits the formation of NETs by inhibiting the activation of IRE1 phosphorylation and reducing ERS in neutrophils, thereby alleviating the severity of RA.

Article Snippet: Slides were stained overnight at 4 °C with the following primary antibodies: MPO (66177-1-lg 90, Proteintech) and/or p-IRE1 (Ser724) (R24754, Zen BioScience) and/or H3cit (ab219407, Abcam).

Techniques: Activity Assay, Activation Assay, Phospho-proteomics

Journal: Cell stress & chaperones

Article Title: The Protective Role of the IRE1α/XBP1 Signaling Cascade in Autophagy During Ischemic Stress and Acute Kidney Injury.

doi: 10.1016/j.cstres.2025.02.004

Figure Lengend Snippet: Figure 2. Effects of IRE1α/XBP1 overexpression and inhibition on autophagy in HK-2 cells. (A)

Article Snippet: The following antibodies were utilized for western blotting: anti-β-actin (Wuhan Doctor De Biological Engineering Co., LTD, BM0627, 1:1000), anti-rabbit GRP78 (Abcam, ab108615, 1:500), anti-mouse P62 (Abcam, ab56416, 1:500), anti-rabbit LC3I/II (14/16 kDa) (Cell signaling technology, 12741T, 1:500), anti-rabbit IRE1α (Novus, NB100-2324, 1:300), anti-rabbit XBP1 (Abcam, ab37152, 1:500), anti-rabbit XBP1s (Cell signaling technology, 40435, 1:500), anti-rabbit Beclin1 (Abcam, ab210498, 1:500), and anti-rabbit Kim1 (is also known as Tim1) (Abcam, ab47635, 1:400).

Techniques: Over Expression, Inhibition

Journal: Cell stress & chaperones

Article Title: The Protective Role of the IRE1α/XBP1 Signaling Cascade in Autophagy During Ischemic Stress and Acute Kidney Injury.

doi: 10.1016/j.cstres.2025.02.004

Figure Lengend Snippet: Figure 3. Effects of XBP1 overexpression and IRE1α inhibition on GRP78 and autophagy-related

Article Snippet: The following antibodies were utilized for western blotting: anti-β-actin (Wuhan Doctor De Biological Engineering Co., LTD, BM0627, 1:1000), anti-rabbit GRP78 (Abcam, ab108615, 1:500), anti-mouse P62 (Abcam, ab56416, 1:500), anti-rabbit LC3I/II (14/16 kDa) (Cell signaling technology, 12741T, 1:500), anti-rabbit IRE1α (Novus, NB100-2324, 1:300), anti-rabbit XBP1 (Abcam, ab37152, 1:500), anti-rabbit XBP1s (Cell signaling technology, 40435, 1:500), anti-rabbit Beclin1 (Abcam, ab210498, 1:500), and anti-rabbit Kim1 (is also known as Tim1) (Abcam, ab47635, 1:400).

Techniques: Over Expression, Inhibition

Journal: The Journal of biological chemistry

Article Title: Activation of the canonical ER stress IRE1-XBP1 pathway by insulin regulates glucose and lipid metabolism.

doi: 10.1016/j.jbc.2022.102283

Figure Lengend Snippet: Figure 3. Insulin activates IRE1-XBP1s signaling in cultured hepatocytes. A, mice were subjected to a 24-h fast, then refed for 1.5 h, blood glucose levels (n = 5) and plasma insulin levels (n = 6 7). B–E, Hepa1-6 cells were cultured in 4- or 25-mM glucose for 1 h, then treated with 10 nM insulin for 2 h. The protein levels of XBP1 and phosphorylation levels of mediators in the insulin signaling pathway and MEK-ERK-p38 signaling were determined (B). Densitometric analysis of the protein levels of XBP1s and XBP1u (C), phosphorylation levels of AKT, GSK, and IRE1 (D), and MEK, ERK, and p38 (E) (n = 3). F, primary hepatocytes were subjected to 3 h serum starvation, then treated with 10 nM of insulin for the indicated time. G, Hepa1-6 cells were subjected to 3-h serum starvation, then treated with 10 nM of insulin for the indicated time. *p < 0.05, Student’s t test. IRE1, inositol-requiring enzyme; XBP1, X-box binding protein 1; XBP1u, XBP1 from an unspliced form; XBP1s, XBP1 from a spliced form.

Article Snippet: For the phosphorylation of IRE1 by AKT1, 0.4 μg of human IRE1 (OriGene) was added to the reaction containing 25 mM Tris–HCl (pH7.5), 5 mM beta-glycerophosphate, 2 mM DTT, 0.1 mM Na3VO4, 10 mM MgCl2, and 0.1 μg of AKT1 (abcam) with or without 0.2 mM ATP.

Techniques: Cell Culture, Clinical Proteomics, Phospho-proteomics, Binding Assay

Journal: The Journal of biological chemistry

Article Title: Activation of the canonical ER stress IRE1-XBP1 pathway by insulin regulates glucose and lipid metabolism.

doi: 10.1016/j.jbc.2022.102283

Figure Lengend Snippet: Figure 4. Insulin activates IRE1-XBP1s signaling in the liver of fasted mice. A–D, after 12 h of fasting, mice were treated with vehicle or 1 unit/kg of insulin for 15 or 30 min, then liver tissues were collected. The protein levels of XBP1 and phosphorylation levels of mediators in the insulin signaling pathway, canonical ER stress pathway, and MEK-ERK-p38 signaling were determined in immunoblots (A). Densitometric analysis of the phosphorylation levels of AKT, GSK, IRE1, and protein levels of XBP1s (B), phosphorylation levels of MEK, ERK, and p38 (C), phosphorylation levels of pPERK and eIF2a and ATF6 protein levels (D) (n = 3 5). E, the mRNA levels of XBP1s and XBP1u in the liver. Densitometric analysis of the mRNA levels of XBP1s and XBP1u (n = 3 5). Each lane represents an individual mouse sample (A, E). F and G, forty-eight hours after the addition of adenoviral expression vectors of XBP1s or XBP1u, Hepa1-6 cells were treated with cycloheximide (CHX; 50 μg/ml) and harvested at the indicated time point. *p < 0.05, Student’s t test. ER, endo- plasmic reticulum; IRE1, inositol-requiring enzyme; XBP1, X-box binding protein 1; XBP1u, XBP1 from an unspliced form; XBP1s, XBP1 from a spliced form; ER, endoplasmic reticulum.

Article Snippet: For the phosphorylation of IRE1 by AKT1, 0.4 μg of human IRE1 (OriGene) was added to the reaction containing 25 mM Tris–HCl (pH7.5), 5 mM beta-glycerophosphate, 2 mM DTT, 0.1 mM Na3VO4, 10 mM MgCl2, and 0.1 μg of AKT1 (abcam) with or without 0.2 mM ATP.

Techniques: Phospho-proteomics, Western Blot, Expressing, Binding Assay

Journal: The Journal of biological chemistry

Article Title: Activation of the canonical ER stress IRE1-XBP1 pathway by insulin regulates glucose and lipid metabolism.

doi: 10.1016/j.jbc.2022.102283

Figure Lengend Snippet: Figure 5. AKT directly phosphorylates IRE1. A, Hepa1-6 cells were cultured in Dulbecco’s modified Eagle’s medium without serum for 1 h, then 50 μM of LY294002 or 10 μM of AKT inhibitor II were added. After 1 h of incubation, 10 nM of insulin was added and cells were harvested 3 h later. Each lane represents an individual sample. B, 0.4 μg of IRE1 was incubated with 0.1 μg of AKT1 for 1 h at 37 C in the presence or absence of ATP. The phosphorylation levels of IRE1 at S724 was examined using anti-IRE1S724 phosphorylation-specific antibody. C, AKT1/2 inhibitor was incubated with 0.4 μg of IRE1 for 10 min, then 0.1 μg of AKT1 was added and incubated for 1 h at 37 C. The phosphorylation levels of IRE1 at S724 were examined as in (B). IRE1, inositol- requiring enzyme.

Article Snippet: For the phosphorylation of IRE1 by AKT1, 0.4 μg of human IRE1 (OriGene) was added to the reaction containing 25 mM Tris–HCl (pH7.5), 5 mM beta-glycerophosphate, 2 mM DTT, 0.1 mM Na3VO4, 10 mM MgCl2, and 0.1 μg of AKT1 (abcam) with or without 0.2 mM ATP.

Techniques: Cell Culture, Incubation, Phospho-proteomics

Journal: The Journal of biological chemistry

Article Title: Activation of the canonical ER stress IRE1-XBP1 pathway by insulin regulates glucose and lipid metabolism.

doi: 10.1016/j.jbc.2022.102283

Figure Lengend Snippet: Figure 7. XBP1u stimulates gluconeogenesis in cultured primary hepatocytes and liver. A–D, liver tissues of C57BL6 mice were collected at fed and fasted (24 h) states. Immunoblots (A), densitometric analysis of the phosphorylation levels of IRE1 (B), and protein levels of XBP1s (C) and XBP1u (D) (n = 5). E, XBP1u augmented PKA-stimulated reporter activity in Hepa1-6 cells cotransfected with 100 ng of XBP1u and XBP1s plasmids and 30 ng of CRE-Luciferase reporter plasmid (n = 3). F, Hepa1-6 cells were cotransfected with 150 ng of pFR-Luciferase reporter plasmid, 20 ng of pFA-CREB, 100 ng of XBP1u, XBP1s, and PKA plasmids (n = 3). G–I, twenty-four hours after the seeding of primary hepatocytes, adenoviral expression vectors of GFP and XBP1u were added. Forty-eight hours later, primary hepatocytes were subjected to 3 h serum starvation, followed by washing with PBS, and addition of glucose production medium and/or 0.2 mM cAMP for 3 h (G) (n = 3). One set of hepatocytes were harvested in TRIzol reagent for the determination of mRNA levels of G6pc (H) and Pck1(I) (n = 3). J, primary hepatocytes were treated with adenoviral shRNA of XBP1 together with adenoviral expression vectors of GFP or XBP1u. Cells were treated as in (G) (n = 3). K–P, three-month-old WT mice were injected (jugular vein) with AAV8-XBP1shRNA (shXBP1-3) (4 × 10

Article Snippet: For the phosphorylation of IRE1 by AKT1, 0.4 μg of human IRE1 (OriGene) was added to the reaction containing 25 mM Tris–HCl (pH7.5), 5 mM beta-glycerophosphate, 2 mM DTT, 0.1 mM Na3VO4, 10 mM MgCl2, and 0.1 μg of AKT1 (abcam) with or without 0.2 mM ATP.

Techniques: Cell Culture, Western Blot, Phospho-proteomics, Activity Assay, Luciferase, Plasmid Preparation, Expressing, shRNA, Injection