ire1 Search Results


94
Novus Biologicals ire1
Ire1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ire1/product/Novus Biologicals
Average 94 stars, based on 1 article reviews
ire1 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

96
Novus Biologicals rabbit anti phospho ire1α ser724
Rabbit Anti Phospho Ire1α Ser724, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti phospho ire1α ser724/product/Novus Biologicals
Average 96 stars, based on 1 article reviews
rabbit anti phospho ire1α ser724 - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

96
Novus Biologicals phospho ire1α
Fig. 3. The <t>IRE1α/XBP-1</t> Pathway Is Activated in Adipocytes Exposed to Stearate
Phospho Ire1α, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phospho ire1α/product/Novus Biologicals
Average 96 stars, based on 1 article reviews
phospho ire1α - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

93
novus biologicals nb100-2324
Fig. 3. The <t>IRE1α/XBP-1</t> Pathway Is Activated in Adipocytes Exposed to Stearate
Nb100 2324, supplied by novus biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nb100-2324/product/novus biologicals
Average 93 stars, based on 1 article reviews
nb100-2324 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Novus Biologicals antibody against phospho ire1α ser724
Fig. 3. The <t>IRE1α/XBP-1</t> Pathway Is Activated in Adipocytes Exposed to Stearate
Antibody Against Phospho Ire1α Ser724, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody against phospho ire1α ser724/product/Novus Biologicals
Average 90 stars, based on 1 article reviews
antibody against phospho ire1α ser724 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

92
Novus Biologicals anti ire1 alpha
Fig. 3. The <t>IRE1α/XBP-1</t> Pathway Is Activated in Adipocytes Exposed to Stearate
Anti Ire1 Alpha, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ire1 alpha/product/Novus Biologicals
Average 92 stars, based on 1 article reviews
anti ire1 alpha - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

90
OriGene hp205316 brca1 origene
Figure 1. Increased accumulation of unfolded protein in <t>BRCA1-def</t> cells, localization of BRCA1 protein to the ER, and interaction with ERAD E3 ligase complex components (A) Photomicrographs of MDA-MB-436(+ or def) cells labeled with TPE-MI (light/blue) and concanavalin-A (red). Scale = 20 mm. TPE = TPE-MI. + = BRCA1- replete. def = BRCA1-deficient. (B) Representative flow cytometry dot plots of TPE-high population in BRCA1-def and BRCA1+ cells. (C and D) Quantitative analysis of TPE signal intensity of each cell preparation. (E) Confocal microscopy images of BRCA1-proficient MDA-MB-231 breast cancer cells. Top, cells were immunostained with BRCA1 (red) and DERL1 (DERLIN-1) (yellow) antibodies. Bottom, cells were immunostained with secondary antibodies conjugated with fluorophores as control. All cells were counterstained with DAPI (blue). Scale = 5 mM. Green = GFP-KDEL. (F and G) Immunoprecipitation (IP) of BRCA1 protein pull-downs of DERL1 and SEL1L from MCF7 (F) or MDA-MB-231 (G) cytoplasmic protein extract. IB = immunoblotting. IN = Input. Ig = non-specific immunoglobulin fragments. IgG(H) & IgG(L) = heavy and light chains. BRCA1 IB: ** = truncated BRCA1. *** = delta11q isoform. Data are represented as mean G SD. P value was calculated by Student’s two-tailed, unpaired t-test. *** <0.001. See also Figures S1–S3.
Hp205316 Brca1 Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hp205316 brca1 origene/product/OriGene
Average 90 stars, based on 1 article reviews
hp205316 brca1 origene - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

96
Proteintech 1 ap
Figure 1. Increased accumulation of unfolded protein in <t>BRCA1-def</t> cells, localization of BRCA1 protein to the ER, and interaction with ERAD E3 ligase complex components (A) Photomicrographs of MDA-MB-436(+ or def) cells labeled with TPE-MI (light/blue) and concanavalin-A (red). Scale = 20 mm. TPE = TPE-MI. + = BRCA1- replete. def = BRCA1-deficient. (B) Representative flow cytometry dot plots of TPE-high population in BRCA1-def and BRCA1+ cells. (C and D) Quantitative analysis of TPE signal intensity of each cell preparation. (E) Confocal microscopy images of BRCA1-proficient MDA-MB-231 breast cancer cells. Top, cells were immunostained with BRCA1 (red) and DERL1 (DERLIN-1) (yellow) antibodies. Bottom, cells were immunostained with secondary antibodies conjugated with fluorophores as control. All cells were counterstained with DAPI (blue). Scale = 5 mM. Green = GFP-KDEL. (F and G) Immunoprecipitation (IP) of BRCA1 protein pull-downs of DERL1 and SEL1L from MCF7 (F) or MDA-MB-231 (G) cytoplasmic protein extract. IB = immunoblotting. IN = Input. Ig = non-specific immunoglobulin fragments. IgG(H) & IgG(L) = heavy and light chains. BRCA1 IB: ** = truncated BRCA1. *** = delta11q isoform. Data are represented as mean G SD. P value was calculated by Student’s two-tailed, unpaired t-test. *** <0.001. See also Figures S1–S3.
1 Ap, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 ap/product/Proteintech
Average 96 stars, based on 1 article reviews
1 ap - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

90
OriGene ire1
BRCA1 protein interacts with and ubiquitinates PERK and <t>IRE1</t> (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: ∗ = hyperphosphorylated BRCA1, ∗∗ = truncated BRCA1. ∗∗∗ = delta11q isoform. IRE1 IB: ∗ = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean ± SD. P value was calculated by Student’s two-tailed, unpaired t -test. ∗ <0.05. See also <xref ref-type=Figures S4–S6 . " width="250" height="auto" />
Ire1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ire1/product/OriGene
Average 90 stars, based on 1 article reviews
ire1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

92
Sino Biological ire1α kinase
BRCA1 protein interacts with and ubiquitinates PERK and <t>IRE1</t> (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: ∗ = hyperphosphorylated BRCA1, ∗∗ = truncated BRCA1. ∗∗∗ = delta11q isoform. IRE1 IB: ∗ = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean ± SD. P value was calculated by Student’s two-tailed, unpaired t -test. ∗ <0.05. See also <xref ref-type=Figures S4–S6 . " width="250" height="auto" />
Ire1α Kinase, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ire1α kinase/product/Sino Biological
Average 92 stars, based on 1 article reviews
ire1α kinase - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

93
Novus Biologicals total ire 1
BRCA1 protein interacts with and ubiquitinates PERK and <t>IRE1</t> (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: ∗ = hyperphosphorylated BRCA1, ∗∗ = truncated BRCA1. ∗∗∗ = delta11q isoform. IRE1 IB: ∗ = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean ± SD. P value was calculated by Student’s two-tailed, unpaired t -test. ∗ <0.05. See also <xref ref-type=Figures S4–S6 . " width="250" height="auto" />
Total Ire 1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/total ire 1/product/Novus Biologicals
Average 93 stars, based on 1 article reviews
total ire 1 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Novus Biologicals rabbit polyclonal anti phospho ire1 ser724
BRCA1 protein interacts with and ubiquitinates PERK and <t>IRE1</t> (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: ∗ = hyperphosphorylated BRCA1, ∗∗ = truncated BRCA1. ∗∗∗ = delta11q isoform. IRE1 IB: ∗ = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean ± SD. P value was calculated by Student’s two-tailed, unpaired t -test. ∗ <0.05. See also <xref ref-type=Figures S4–S6 . " width="250" height="auto" />
Rabbit Polyclonal Anti Phospho Ire1 Ser724, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal anti phospho ire1 ser724/product/Novus Biologicals
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti phospho ire1 ser724 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Fig. 3. The IRE1α/XBP-1 Pathway Is Activated in Adipocytes Exposed to Stearate

Journal: Biological & pharmaceutical bulletin

Article Title: Exposure to Stearate Activates the IRE1α/XBP-1 Pathway in 3T3-L1 Adipocytes.

doi: 10.1248/bpb.b21-00478

Figure Lengend Snippet: Fig. 3. The IRE1α/XBP-1 Pathway Is Activated in Adipocytes Exposed to Stearate

Article Snippet: Immunoblotting was performed with the following antibodies: IRE1α (NB100–2324, NOVUS; Littleton, CO, U.S.A.), Phospho-IRE1α [Ser724] (NB100–2323, NOVUS), PERK (#3192; CST, Danvers, MA, U.S.A.), Phospho-PERK [Thr980] (#3179, CST), ATF6α (73–505, Bio Academia, Osaka, Japan), and β-actin (#4967, CST).

Techniques:

Figure 1. Increased accumulation of unfolded protein in BRCA1-def cells, localization of BRCA1 protein to the ER, and interaction with ERAD E3 ligase complex components (A) Photomicrographs of MDA-MB-436(+ or def) cells labeled with TPE-MI (light/blue) and concanavalin-A (red). Scale = 20 mm. TPE = TPE-MI. + = BRCA1- replete. def = BRCA1-deficient. (B) Representative flow cytometry dot plots of TPE-high population in BRCA1-def and BRCA1+ cells. (C and D) Quantitative analysis of TPE signal intensity of each cell preparation. (E) Confocal microscopy images of BRCA1-proficient MDA-MB-231 breast cancer cells. Top, cells were immunostained with BRCA1 (red) and DERL1 (DERLIN-1) (yellow) antibodies. Bottom, cells were immunostained with secondary antibodies conjugated with fluorophores as control. All cells were counterstained with DAPI (blue). Scale = 5 mM. Green = GFP-KDEL. (F and G) Immunoprecipitation (IP) of BRCA1 protein pull-downs of DERL1 and SEL1L from MCF7 (F) or MDA-MB-231 (G) cytoplasmic protein extract. IB = immunoblotting. IN = Input. Ig = non-specific immunoglobulin fragments. IgG(H) & IgG(L) = heavy and light chains. BRCA1 IB: ** = truncated BRCA1. *** = delta11q isoform. Data are represented as mean G SD. P value was calculated by Student’s two-tailed, unpaired t-test. *** <0.001. See also Figures S1–S3.

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 1. Increased accumulation of unfolded protein in BRCA1-def cells, localization of BRCA1 protein to the ER, and interaction with ERAD E3 ligase complex components (A) Photomicrographs of MDA-MB-436(+ or def) cells labeled with TPE-MI (light/blue) and concanavalin-A (red). Scale = 20 mm. TPE = TPE-MI. + = BRCA1- replete. def = BRCA1-deficient. (B) Representative flow cytometry dot plots of TPE-high population in BRCA1-def and BRCA1+ cells. (C and D) Quantitative analysis of TPE signal intensity of each cell preparation. (E) Confocal microscopy images of BRCA1-proficient MDA-MB-231 breast cancer cells. Top, cells were immunostained with BRCA1 (red) and DERL1 (DERLIN-1) (yellow) antibodies. Bottom, cells were immunostained with secondary antibodies conjugated with fluorophores as control. All cells were counterstained with DAPI (blue). Scale = 5 mM. Green = GFP-KDEL. (F and G) Immunoprecipitation (IP) of BRCA1 protein pull-downs of DERL1 and SEL1L from MCF7 (F) or MDA-MB-231 (G) cytoplasmic protein extract. IB = immunoblotting. IN = Input. Ig = non-specific immunoglobulin fragments. IgG(H) & IgG(L) = heavy and light chains. BRCA1 IB: ** = truncated BRCA1. *** = delta11q isoform. Data are represented as mean G SD. P value was calculated by Student’s two-tailed, unpaired t-test. *** <0.001. See also Figures S1–S3.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: Labeling, Cytometry, Confocal Microscopy, Control, Immunoprecipitation, Western Blot, Two Tailed Test

Figure 2. BRCA1 protein interacts with and ubiquitinates PERK and IRE1 (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: * = hyperphosphorylated BRCA1, ** = truncated BRCA1. *** = delta11q isoform. IRE1 IB: * = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean G SD. P value was calculated by Student’s two-tailed, unpaired t-test. * <0.05. See also Figures S4–S6.

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 2. BRCA1 protein interacts with and ubiquitinates PERK and IRE1 (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: * = hyperphosphorylated BRCA1, ** = truncated BRCA1. *** = delta11q isoform. IRE1 IB: * = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean G SD. P value was calculated by Student’s two-tailed, unpaired t-test. * <0.05. See also Figures S4–S6.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: Isolation, Control, Expressing, Immunoprecipitation, Ubiquitin Proteomics, Transfection, In Vitro, Two Tailed Test

Figure 3. Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 30UTR siRNA or (iv) PPIB/pCMV and CypB 30UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figures S7 and S8.

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 3. Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 30UTR siRNA or (iv) PPIB/pCMV and CypB 30UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figures S7 and S8.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: Transfection, Control, Western Blot, Plasmid Preparation, Two Tailed Test

Figure 4. Cyclophilin inhibitor treatment increases unfolded proteins and PDI aggregates formation in BRCA1-def cancer cells (A) Photomicrographs of DMSO- or CsA-treated MDA-MB-436 (+ or def) cells labeled with TPE-MI (light/blue) and quantitative analysis of TPE signal intensity of each cell preparation. Scale = 20 mm. TPE = TPE-MI. + = BRCA1-replete. def = BRCA1-deficient. (B) Representative flow dot plots of TPE signals in DMSO- or CsA-treated MDA-MB-436 (+ or def) breast cancer cells and quantitative analysis of TPE-high cell population of each cell preparation. (C and D) Quantitative analysis of TPE signal intensity of each cell preparation. (E) Confocal microscopy images of DMSO- or CsA-treated MDA-MB-436 (+ or def) breast cancer cells. Cells were co-immunostained with CypB (red) and PDI (green) antibodies. Top, 2 days post-treatment. Bottom, 3 days post-treatment. All cells were counterstained with DAPI (blue). Scale = 5 mM. Bar charts are quantitative analyses of cell populations with PDI aggregate formation. (F) Depletion of PDI induced severe synthetic lethality in MDA-MB-436 BRCA1-def cancer cells. Top, Western blot analysis. Middle, representative images of colony forming units (CFUs) from control or CypB knock-down cancer cells after 14 days culturing. Bottom, quantitative analysis of the clonal colony formation assay. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figure S8.

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 4. Cyclophilin inhibitor treatment increases unfolded proteins and PDI aggregates formation in BRCA1-def cancer cells (A) Photomicrographs of DMSO- or CsA-treated MDA-MB-436 (+ or def) cells labeled with TPE-MI (light/blue) and quantitative analysis of TPE signal intensity of each cell preparation. Scale = 20 mm. TPE = TPE-MI. + = BRCA1-replete. def = BRCA1-deficient. (B) Representative flow dot plots of TPE signals in DMSO- or CsA-treated MDA-MB-436 (+ or def) breast cancer cells and quantitative analysis of TPE-high cell population of each cell preparation. (C and D) Quantitative analysis of TPE signal intensity of each cell preparation. (E) Confocal microscopy images of DMSO- or CsA-treated MDA-MB-436 (+ or def) breast cancer cells. Cells were co-immunostained with CypB (red) and PDI (green) antibodies. Top, 2 days post-treatment. Bottom, 3 days post-treatment. All cells were counterstained with DAPI (blue). Scale = 5 mM. Bar charts are quantitative analyses of cell populations with PDI aggregate formation. (F) Depletion of PDI induced severe synthetic lethality in MDA-MB-436 BRCA1-def cancer cells. Top, Western blot analysis. Middle, representative images of colony forming units (CFUs) from control or CypB knock-down cancer cells after 14 days culturing. Bottom, quantitative analysis of the clonal colony formation assay. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test. See also Figure S8.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: Labeling, Confocal Microscopy, Western Blot, Control, Knockdown, Colony Assay, Two Tailed Test

Figure 5. Cyclophilin inhibitors induce severe synthetic lethality in BRCA1-def cancer cells in vitro and in vivo (A) BRCA1-def cancer cells (MDA-MB-436, HCC1937, SUM149PT or UWB1.289), BRCA1-proficient cancer cells (MDA-MB-436, MDA-MB-231 or MCF7) and non-tumorigenic mammary epithelial cells (MCF10A) were seeded one day prior to drug treatment. A single continuous dose of CsA, NIM811 or Alisporivir was added to the corresponding cell lines. Quantitative analysis of each survival curve is shown in graphs. CsA = Cyclosporin A. CFU = Colony forming units. DMSO = dimethyl sulfoxide vehicle. (B) CsA treatment of human BRCA1-def breast cancer cells in a murine model. Representative luciferase images of each treated subject were taken by an In Vivo Imaging systems (IVIS). Animals were either treated with vehicle (control) or CsA (treatment) for 6 weeks post-tumor formation. (C) Quantitative analysis of tumor progression from each group was summarized in graph. (D) Schematic diagram depicts the model of wildtype and mutant BRCA1 regulation of the ERAD and UPR signaling pathways to maintain protein homeostasis in the ER. Wt = wildtype. def = deficient. Ub = ubiquitin. P = phosphate. Dashed arrow = less favored pathway. Ubiquitination and phosphorylation modifications in the diagram are simplified for clarity. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test.

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1.

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Figure 5. Cyclophilin inhibitors induce severe synthetic lethality in BRCA1-def cancer cells in vitro and in vivo (A) BRCA1-def cancer cells (MDA-MB-436, HCC1937, SUM149PT or UWB1.289), BRCA1-proficient cancer cells (MDA-MB-436, MDA-MB-231 or MCF7) and non-tumorigenic mammary epithelial cells (MCF10A) were seeded one day prior to drug treatment. A single continuous dose of CsA, NIM811 or Alisporivir was added to the corresponding cell lines. Quantitative analysis of each survival curve is shown in graphs. CsA = Cyclosporin A. CFU = Colony forming units. DMSO = dimethyl sulfoxide vehicle. (B) CsA treatment of human BRCA1-def breast cancer cells in a murine model. Representative luciferase images of each treated subject were taken by an In Vivo Imaging systems (IVIS). Animals were either treated with vehicle (control) or CsA (treatment) for 6 weeks post-tumor formation. (C) Quantitative analysis of tumor progression from each group was summarized in graph. (D) Schematic diagram depicts the model of wildtype and mutant BRCA1 regulation of the ERAD and UPR signaling pathways to maintain protein homeostasis in the ER. Wt = wildtype. def = deficient. Ub = ubiquitin. P = phosphate. Dashed arrow = less favored pathway. Ubiquitination and phosphorylation modifications in the diagram are simplified for clarity. Data are displayed as mean G SD. P values were calculated by Student’s two-tailed, unpaired t-test.

Article Snippet: HEK293 ATCC Cat# CRL-1573; RRID: CVCL_0045 MCF10A ATCC Cat# CRL-10317; RRID: CVCL_0598 Experimental models: Organisms/strains Athymic nude mice Jackson Laboratories Cat# 002019; RRID: IMSR_JAX:002019 Oligonucleotides EIF1AK3 OriGene Cat# HP208096 ERN1 OriGene Cat# HP205316 BRCA1 OriGene Cat# HP210038 BARD1 OriGene Cat# HP200444 GAPDH OriGene Cat# HP205798 sp XBP1 forward primer, 50- TGCTGAGTCCGCAGCAGGTG -30; reverse primer, 50- GCTGGCAGGCTCTGGGGAAG -30 NM_001079539.1 Fung et al., 2014 Total XBP1 forward primer, TTGTCACCCCTCCAGAACATC. reverse primer, TCCAGAATGCCCAACAGGAT Control siRNA Dhamarcon Cat# D-001810-10-20 BRCA1 siRNA Dhamarcon Cat# sL0034610000 CypB siRNA (pooled) Santa Cruz Biotech Cat# sc-35145 CypB-A siRNA Santa Cruz Biotech Cat# sc-35145a CypB-B siRNA Santa Cruz Biotech Cat# sc-35145b CypB 30UTR siRNA Horizon Discovery Cat# CTM-710441 DERLIN-1 siRNA Santa Cruz Biotech Cat# sc-60519 IRE1 siRNA Santa Cruz Biotech Cat# sc-40705 BiP siRNA Santa Cruz Biotech Cat# sc-29338 GRP94 siRNA Santa Cruz Biotech Cat# sc-35523 HSP70 siRNA Santa Cruz Biotech Cat# sc-29352 (Continued on next page) iScience 25, 105626, December 22, 2022 15

Techniques: In Vitro, In Vivo, Luciferase, In Vivo Imaging, Control, Mutagenesis, Protein-Protein interactions, Ubiquitin Proteomics, Phospho-proteomics, Two Tailed Test

BRCA1 protein interacts with and ubiquitinates PERK and IRE1 (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: ∗ = hyperphosphorylated BRCA1, ∗∗ = truncated BRCA1. ∗∗∗ = delta11q isoform. IRE1 IB: ∗ = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean ± SD. P value was calculated by Student’s two-tailed, unpaired t -test. ∗ <0.05. See also <xref ref-type=Figures S4–S6 . " width="100%" height="100%">

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: BRCA1 protein interacts with and ubiquitinates PERK and IRE1 (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: ∗ = hyperphosphorylated BRCA1, ∗∗ = truncated BRCA1. ∗∗∗ = delta11q isoform. IRE1 IB: ∗ = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean ± SD. P value was calculated by Student’s two-tailed, unpaired t -test. ∗ <0.05. See also Figures S4–S6 .

Article Snippet: IRE1 , OriGene , Cat# RC215023.

Techniques: Isolation, Control, Expressing, Immunoprecipitation, Ubiquitin Proteomics, Transfection, In Vitro, Two Tailed Test

Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 3′UTR siRNA or (iv) PPIB/pCMV and CypB 3′UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean ± SD. P values were calculated by Student’s two-tailed, unpaired t -test. See also <xref ref-type=Figures S7 and . " width="100%" height="100%">

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet: Depleting UPR components is lethal to the BRCA1-def cancer cells (A) MDA-MB-436 (BRCA1-def or +), HCC1937 BRCA1-def and SUMPT149 BRCA1-def breast cancer cells were transfected with control, CypB, IRE1, GRP94, HSP70, BiP, PERK or DERL1 siRNA and assessed for cell survival. (B) HCC1937 BRCA1+, MDA-MB-231, MCF7, and MCF10A cells were transfected with CypB siRNA and assessed for cell survival. (C) MDA-MB-436 (+ or def) and HCC1937 (+ or def) breast cancer cells were transfected with control, CypB-A or CypB-B siRNA. Top, western blot analysis. Bottom, clonal cell survival analysis. (D) MDA-MB-436 BRCA1-def cells were transfected with either (i) pCMV vector and siRNA control, (ii) PPIB/pCMV and siRNA control, (iii) pCMV control and CypB 3′UTR siRNA or (iv) PPIB/pCMV and CypB 3′UTR siRNA for cell survival and Western blot analysis. N.S. = not significant. F-CypB = Flag-tagged cyclophilin B. Bar charts are the summary of the quantitative analysis of the colony forming units (CFU) from each siRNA transfection experiment. Data are displayed as mean ± SD. P values were calculated by Student’s two-tailed, unpaired t -test. See also Figures S7 and .

Article Snippet: IRE1 , OriGene , Cat# RC215023.

Techniques: Transfection, Control, Western Blot, Plasmid Preparation, Two Tailed Test

Journal: iScience

Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1

doi: 10.1016/j.isci.2022.105626

Figure Lengend Snippet:

Article Snippet: IRE1 , OriGene , Cat# RC215023.

Techniques: Virus, Recombinant, Ubiquitin Proteomics, Extraction, SYBR Green Assay, Isolation, Control, Plasmid Preparation, Software