insert construct plus 3rd generation packaging plasmids Search Results


94
PackGene Biotech lnc plasmid for lentivirus lv construction
Plasmid For Lentivirus Lv Construction, supplied by PackGene Biotech lnc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/pmc09184653-291-4-13?v=PackGene+Biotech+lnc
Average 94 stars, based on 1 article reviews
plasmid for lentivirus lv construction - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Addgene inc generation lentiviral packaging constructs
Generation Lentiviral Packaging Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/pm30318470-59-12-24?v=Addgene+inc
Average 96 stars, based on 1 article reviews
generation lentiviral packaging constructs - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

94
Addgene inc 3rd generation lentivirus vector
3rd Generation Lentivirus Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/pmc10814814-111-11-16?v=Addgene+inc
Average 94 stars, based on 1 article reviews
3rd generation lentivirus vector - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
Addgene inc generation transfer plasmid plko 1 trc cloning vector
Generation Transfer Plasmid Plko 1 Trc Cloning Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/bio_rxiv__2024__06__29__601287-313-9-15?v=Addgene+inc
Average 96 stars, based on 1 article reviews
generation transfer plasmid plko 1 trc cloning vector - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

98
Addgene inc 3rd generation lentiviral packaging constructs
3rd Generation Lentiviral Packaging Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/pmc08127617-83-52-60?v=Addgene+inc
Average 98 stars, based on 1 article reviews
3rd generation lentiviral packaging constructs - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

95
Addgene inc generation lentiviral vector prrlsin cppt pgk gfp wpre backbone
A. Schematic of PEX6-Tomato. The Tomato ORF was inserted between the CDS and 3’UTR of human PEX6 and in-frame to PEX6 to produce a PEX6-Tomato fusion protein, as indicated. The construct was expressed under a constitutive ubiquitin promoter. Lengths of each segment are marked in base pairs. B. PEX6-Tomato can rescue a peroxisome mutant phenotype. PEX6mut cells were transiently co-transfected with plasmids expressing either PEX6-Tomato and a GFP-tagged peroxisomal marker, GFP-SKL, or a control construct expressing tdTomato alone along with GFP-SKL. Images were taken 72hrs post transfection. Scale bar: 10 µm. C. Over-expression level of PEX6-Tomato mRNA. Stable PEX6-Tomato HEK293T cells were created by <t>lentiviral</t> infection. PEX6 and PEX6-Tomato gene expression was quantified by RT-qPCR. 18S gene expression served as endogenous control. Data is shown as the mean of three replicates and the corresponding SEMs. ****: P<0.0001
Generation Lentiviral Vector Prrlsin Cppt Pgk Gfp Wpre Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/bio_rxiv__2024__11__06__622258-184-9-26?v=Addgene+inc
Average 95 stars, based on 1 article reviews
generation lentiviral vector prrlsin cppt pgk gfp wpre backbone - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

91
Addgene inc human sox9 overexpression vector
Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) <t>SOX9</t> labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.
Human Sox9 Overexpression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/pm31433983-223-250-248?v=Addgene+inc
Average 91 stars, based on 1 article reviews
human sox9 overexpression vector - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

86
Routledge Ltd vedio,3rd ed
Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) <t>SOX9</t> labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.
Vedio,3rd Ed, supplied by Routledge Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/10__35560_slash_jcofarts1155-77-6-8?v=Routledge+Ltd
Average 86 stars, based on 1 article reviews
vedio,3rd ed - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
NeurOp Inc hoechst 33342 labeled cells
Bone Marrow-Derived Stromal Cells – BMSC – Mesenchymal Stem Cells The stromal cells from the bone marrow are isolated and separated from the hematopoetic cell fraction of the bone marrow by their predilection to adhere to plastic. Some authors exclude the contamination by hematopoetic cells (which are CD 34 positive) by FACS. BMSCs are hence a crude mixture of stromal cells which support the growth of hematopoetic stem cells and mesenchymal stem cells. Some authors provide some additional (somewhat unspecific) markers to characterize these mesenchymal stem cells. Hence the actual stromal versus mesenchymal stem cell nature of the transplanted cells is unclear in many studies.
Hoechst 33342 Labeled Cells, supplied by NeurOp Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/pmc03143488-1718-36-1?v=NeurOp+Inc
Average 90 stars, based on 1 article reviews
hoechst 33342 labeled cells - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
ReproCELL stemrna 3rd gen reprogramming kit
Bone Marrow-Derived Stromal Cells – BMSC – Mesenchymal Stem Cells The stromal cells from the bone marrow are isolated and separated from the hematopoetic cell fraction of the bone marrow by their predilection to adhere to plastic. Some authors exclude the contamination by hematopoetic cells (which are CD 34 positive) by FACS. BMSCs are hence a crude mixture of stromal cells which support the growth of hematopoetic stem cells and mesenchymal stem cells. Some authors provide some additional (somewhat unspecific) markers to characterize these mesenchymal stem cells. Hence the actual stromal versus mesenchymal stem cell nature of the transplanted cells is unclear in many studies.
Stemrna 3rd Gen Reprogramming Kit, supplied by ReproCELL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/bio_rxiv__2023__08__09__552621-36-17-23?v=ReproCELL
Average 90 stars, based on 1 article reviews
stemrna 3rd gen reprogramming kit - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
VACUUMSCHMELZE GmbH Co KG magnetically-shielded room
Bone Marrow-Derived Stromal Cells – BMSC – Mesenchymal Stem Cells The stromal cells from the bone marrow are isolated and separated from the hematopoetic cell fraction of the bone marrow by their predilection to adhere to plastic. Some authors exclude the contamination by hematopoetic cells (which are CD 34 positive) by FACS. BMSCs are hence a crude mixture of stromal cells which support the growth of hematopoetic stem cells and mesenchymal stem cells. Some authors provide some additional (somewhat unspecific) markers to characterize these mesenchymal stem cells. Hence the actual stromal versus mesenchymal stem cell nature of the transplanted cells is unclear in many studies.
Magnetically Shielded Room, supplied by VACUUMSCHMELZE GmbH Co KG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/pmc03408548-92-24-21?v=VACUUMSCHMELZE+GmbH+Co+KG
Average 90 stars, based on 1 article reviews
magnetically-shielded room - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
MR Solutions rd-1005-3
Bone Marrow-Derived Stromal Cells – BMSC – Mesenchymal Stem Cells The stromal cells from the bone marrow are isolated and separated from the hematopoetic cell fraction of the bone marrow by their predilection to adhere to plastic. Some authors exclude the contamination by hematopoetic cells (which are CD 34 positive) by FACS. BMSCs are hence a crude mixture of stromal cells which support the growth of hematopoetic stem cells and mesenchymal stem cells. Some authors provide some additional (somewhat unspecific) markers to characterize these mesenchymal stem cells. Hence the actual stromal versus mesenchymal stem cell nature of the transplanted cells is unclear in many studies.
Rd 1005 3, supplied by MR Solutions, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insert+construct+plus+3rd+generation+packaging+plasmids/us08066567-112-8-13?v=MR+Solutions
Average 90 stars, based on 1 article reviews
rd-1005-3 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


A. Schematic of PEX6-Tomato. The Tomato ORF was inserted between the CDS and 3’UTR of human PEX6 and in-frame to PEX6 to produce a PEX6-Tomato fusion protein, as indicated. The construct was expressed under a constitutive ubiquitin promoter. Lengths of each segment are marked in base pairs. B. PEX6-Tomato can rescue a peroxisome mutant phenotype. PEX6mut cells were transiently co-transfected with plasmids expressing either PEX6-Tomato and a GFP-tagged peroxisomal marker, GFP-SKL, or a control construct expressing tdTomato alone along with GFP-SKL. Images were taken 72hrs post transfection. Scale bar: 10 µm. C. Over-expression level of PEX6-Tomato mRNA. Stable PEX6-Tomato HEK293T cells were created by lentiviral infection. PEX6 and PEX6-Tomato gene expression was quantified by RT-qPCR. 18S gene expression served as endogenous control. Data is shown as the mean of three replicates and the corresponding SEMs. ****: P<0.0001

Journal: bioRxiv

Article Title: Complementation of a human disease phenotype in vitro by intercellular mRNA transfer

doi: 10.1101/2024.11.06.622258

Figure Lengend Snippet: A. Schematic of PEX6-Tomato. The Tomato ORF was inserted between the CDS and 3’UTR of human PEX6 and in-frame to PEX6 to produce a PEX6-Tomato fusion protein, as indicated. The construct was expressed under a constitutive ubiquitin promoter. Lengths of each segment are marked in base pairs. B. PEX6-Tomato can rescue a peroxisome mutant phenotype. PEX6mut cells were transiently co-transfected with plasmids expressing either PEX6-Tomato and a GFP-tagged peroxisomal marker, GFP-SKL, or a control construct expressing tdTomato alone along with GFP-SKL. Images were taken 72hrs post transfection. Scale bar: 10 µm. C. Over-expression level of PEX6-Tomato mRNA. Stable PEX6-Tomato HEK293T cells were created by lentiviral infection. PEX6 and PEX6-Tomato gene expression was quantified by RT-qPCR. 18S gene expression served as endogenous control. Data is shown as the mean of three replicates and the corresponding SEMs. ****: P<0.0001

Article Snippet: The entire construct was then transferred to the 3rd generation lentiviral vector pRRLSIN.cPPT.PGK-GFP.WPRE backbone (a gift from Didier Trono, Swiss Federal Institute of Technology Lausanne, Switzerland; Addgene # 12252).

Techniques: Construct, Mutagenesis, Transfection, Expressing, Marker, Control, Over Expression, Infection, Quantitative RT-PCR

Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) SOX9 labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.

Journal: Cell reports

Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

doi: 10.1016/j.celrep.2019.07.071

Figure Lengend Snippet: Figure 1. Constitutive RAS-ERK1/2 Activation Induces a Neurogenic-Gliogenic Switch during Astrocytoma Formation (A and B) BrdU (2 h) pulse identified proliferative activity in the V-SVZ (red rectangle) and the proximal rostral migratory stream (RMS; blue box) in the dorsal aspect of the anterior V-SVZ of P30 wild-type (WT) (A) and G-Ras (B) mice. Scale bar: 50 mm. (C and D) Quantification (means ± SEMs, n = 3, *p < 0.05; Student’s t test) of BrdU+ cells in the V-SVZ (C) and proximal RMS (D) at P10 and P30 in WT versus G-Ras mice. (E and F) Co-expression of PAX6, DCX, and PSA-NCAM in P30 WT (E) and G-Ras (F) mice (arrows). Scale bar: 40 mm. (G and H) DCX expressed in neuroblasts incorporating BrdU in the V-SVZ of P30 WT (G) and G-Ras (H) mice. Scale bar: 40 mm. (I and J) Distribution of V-SVZ cells expressing OLIG2 and GFAP in P30 WT (I) and G-Ras (J) mice. Scale bar: 100 mm. (K) Quantification (means ± SEMs, n = 3, *p < 0.05 and **p < 0.01; Student’s t test) of the percentage of BrdU+ incorporating cells expressing DCX and GFAP in WT versus G-Ras mice at P30. (L) Quantification (means ± SEMs, n = 3, *p < 0.05 and ***p < 0.001; Student’s t test) of the percentage of GFAP+BrdU+ or GFAP+BrdU cells within the OLIG2 population in WT versus G-Ras mice at P30. (M) SOX9 labeling in the V-SVZ of P30 G-Ras mouse. Scale bar: 10 mm. (N and O) Parasagittal sections showing the distribution of DCX+ (arrows) and BrdU+ cells in the V-SVZ and proximal RMS of P60 WT (N) and G-Ras (O) mice. Scale bar: 100 mm. (P and Q) BrdU+ tumor lesion co-express GFAP and OLIG2 (P). G-Ras tumor composed of SOX9+ and OLIG2+ tumor cells (Q). Scale bar: 50 mm. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

Techniques: Activation Assay, Activity Assay, Expressing, Labeling

Figure 4. miR-124 Overexpression Induces Neuronal Differentiation in Human GBM Cells (A) Schematics of doxycycline (Dox)-regulable lentiviral KRAB system based on two vectors with a dsRED reporter gene to track tumor cells and GFP to monitor miR-124 levels. (B) In the absence of Dox, the tetracycline repressor fused to the Kr€uppel-associated box (tTR-KRAB) binds to tetracycline operator (tetO) sequences and suppresses transcription. In the presence of Dox, tTR-KRAB cannot bind tetO, which allows expression of the transgenes (miR-124 and GFP). (C) Quantitative real-time PCR for miR-124 expression in GBM43 and GBM43.miR-124 cultures following Dox treatment (DDCt ± SEM, n = 3, ***p < 0.001; ANOVA Tukey’s post hoc test). (D) Immunoblotting for SOX9 protein levels following Dox-mediated (0–10 mg/mL) miR-124 induction in GBM14.miR-124 tumorsphere cultures. (E) Luciferase assay in 293T cells for the miR-124 target site in the 30 UTR of SOX9 demonstrating efficient repression by miR-124 48 h after co-transfection compared to non-targeting let-7 or miR-302 constructs (means ± SEMs, n = 3, ***p < 0.001 and ****p < 0.0001; Student’s test). (F) Quantification (means ± SEMs, n = 3, **p < 0.01 and ***p < 0.001; ANOVA Dunnett’s post hoc test) of proliferation (# Cells) following Dox treatment (Dox: 0–10 mg/mL) of GBM43.miR-124 tumorsphere cultures. (G and H) Cleaved caspase 3-expressing after 48 h in untreated control (G) cells (arrow) or following Dox-mediated miR-124 overexpression (H) in GBM43.miR- 124 tumorsphere cultures. Scale bar: 20 mm. (I and J) Map2ab expression (arrows) after 10 days in untreated control cells (I) following Dox-mediated miR-124 overexpression (J) in GBM43.miR-124 tumorsphere cultures. Scale bar: 40 mm. See also Figure S3.

Journal: Cell reports

Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

doi: 10.1016/j.celrep.2019.07.071

Figure Lengend Snippet: Figure 4. miR-124 Overexpression Induces Neuronal Differentiation in Human GBM Cells (A) Schematics of doxycycline (Dox)-regulable lentiviral KRAB system based on two vectors with a dsRED reporter gene to track tumor cells and GFP to monitor miR-124 levels. (B) In the absence of Dox, the tetracycline repressor fused to the Kr€uppel-associated box (tTR-KRAB) binds to tetracycline operator (tetO) sequences and suppresses transcription. In the presence of Dox, tTR-KRAB cannot bind tetO, which allows expression of the transgenes (miR-124 and GFP). (C) Quantitative real-time PCR for miR-124 expression in GBM43 and GBM43.miR-124 cultures following Dox treatment (DDCt ± SEM, n = 3, ***p < 0.001; ANOVA Tukey’s post hoc test). (D) Immunoblotting for SOX9 protein levels following Dox-mediated (0–10 mg/mL) miR-124 induction in GBM14.miR-124 tumorsphere cultures. (E) Luciferase assay in 293T cells for the miR-124 target site in the 30 UTR of SOX9 demonstrating efficient repression by miR-124 48 h after co-transfection compared to non-targeting let-7 or miR-302 constructs (means ± SEMs, n = 3, ***p < 0.001 and ****p < 0.0001; Student’s test). (F) Quantification (means ± SEMs, n = 3, **p < 0.01 and ***p < 0.001; ANOVA Dunnett’s post hoc test) of proliferation (# Cells) following Dox treatment (Dox: 0–10 mg/mL) of GBM43.miR-124 tumorsphere cultures. (G and H) Cleaved caspase 3-expressing after 48 h in untreated control (G) cells (arrow) or following Dox-mediated miR-124 overexpression (H) in GBM43.miR- 124 tumorsphere cultures. Scale bar: 20 mm. (I and J) Map2ab expression (arrows) after 10 days in untreated control cells (I) following Dox-mediated miR-124 overexpression (J) in GBM43.miR-124 tumorsphere cultures. Scale bar: 40 mm. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

Techniques: Over Expression, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Luciferase, Cotransfection, Construct, Control

Figure 5. PD0325901-Induced Neuronal Differentiation Requires miR-124 Induction and SOX9 Depletion in EGFRvIII-Driven GBM Models (A) Design of mouse GBM model based on V-SVZ neurospheres isolated from postnatal Ink4a/Arf null mice, lentivirally transduced with hEGFRvIII (vIII cells), mCherry, and firefly luciferase (LUC), followed by allografting into the frontal cortex of recipient adult FVBN mice. (B) Mice developing GBMs were administered vehicle or the MEK inhibitor PD0325901 (PD; 5 mg/kg/day) for 10 days. (C and D) Expression of SOX9 and cleaved caspase3 in EGFRvIII-driven mouse GBMs after 10 days’ treatment with vehicle (C) or PD0325901 (D). Scale bar: 40 mm. (E) Bioluminescence imaging as readout of tumor growth in mice following treatment with vehicle (F and H) or PD0325901 (G and I) (means ± SEMs, n = 5, **p < 0.01; Student’s t test). (F–I) Expression of post-mitotic neuron marker Map2ab and immature neuron marker Tuj1 following treatment with vehicle or PD0325901. Scale bar: 20 mm. (J) Lentiviral transduction with hSOX9 (vIII.hSOX9) or a lentiviral miR-124 sponge (vIII.124sp) in vIII cells. (K) Design of lentiviral sponge vector to stably inhibit miR-124 function. (L and M) Downregulation of SOX9 and neuronal differentiation (Tuj1) after 6 days in untreated (control) vIII cells (L) or following incubation with PD0325901 (M) (PD, 1 mM). Scale bar: 50 mm. (N) Quantification of Tuj1 expression following PD0325901 (1 mM) in vIII, vIII.124sp, and vIII.SOX9 cultures after 6 days (means ± SEMs, n = 4, **p < 0.01; Student’s t test). (O) Immunoblotting for WT EGFR and EGFRvIII protein in human GBM cultures. (P and Q) Labeling of EGFRvIII mutated GBM6 cells with antibodies against SOX9 and Tuj1 after 6 days following incubation from DMSO (control) (P) or PD0325901 (1 mM) (O). (R) Quantification (means ± SEMs, n = 3, ***p < 0.001; Student’s test) of GBM6 and GBM6.124sp cells following incubation with PD0325901 (1 mM) for 6 days. See also Figure S4.

Journal: Cell reports

Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

doi: 10.1016/j.celrep.2019.07.071

Figure Lengend Snippet: Figure 5. PD0325901-Induced Neuronal Differentiation Requires miR-124 Induction and SOX9 Depletion in EGFRvIII-Driven GBM Models (A) Design of mouse GBM model based on V-SVZ neurospheres isolated from postnatal Ink4a/Arf null mice, lentivirally transduced with hEGFRvIII (vIII cells), mCherry, and firefly luciferase (LUC), followed by allografting into the frontal cortex of recipient adult FVBN mice. (B) Mice developing GBMs were administered vehicle or the MEK inhibitor PD0325901 (PD; 5 mg/kg/day) for 10 days. (C and D) Expression of SOX9 and cleaved caspase3 in EGFRvIII-driven mouse GBMs after 10 days’ treatment with vehicle (C) or PD0325901 (D). Scale bar: 40 mm. (E) Bioluminescence imaging as readout of tumor growth in mice following treatment with vehicle (F and H) or PD0325901 (G and I) (means ± SEMs, n = 5, **p < 0.01; Student’s t test). (F–I) Expression of post-mitotic neuron marker Map2ab and immature neuron marker Tuj1 following treatment with vehicle or PD0325901. Scale bar: 20 mm. (J) Lentiviral transduction with hSOX9 (vIII.hSOX9) or a lentiviral miR-124 sponge (vIII.124sp) in vIII cells. (K) Design of lentiviral sponge vector to stably inhibit miR-124 function. (L and M) Downregulation of SOX9 and neuronal differentiation (Tuj1) after 6 days in untreated (control) vIII cells (L) or following incubation with PD0325901 (M) (PD, 1 mM). Scale bar: 50 mm. (N) Quantification of Tuj1 expression following PD0325901 (1 mM) in vIII, vIII.124sp, and vIII.SOX9 cultures after 6 days (means ± SEMs, n = 4, **p < 0.01; Student’s t test). (O) Immunoblotting for WT EGFR and EGFRvIII protein in human GBM cultures. (P and Q) Labeling of EGFRvIII mutated GBM6 cells with antibodies against SOX9 and Tuj1 after 6 days following incubation from DMSO (control) (P) or PD0325901 (1 mM) (O). (R) Quantification (means ± SEMs, n = 3, ***p < 0.001; Student’s test) of GBM6 and GBM6.124sp cells following incubation with PD0325901 (1 mM) for 6 days. See also Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

Techniques: Isolation, Transduction, Luciferase, Expressing, Imaging, Marker, Plasmid Preparation, Stable Transfection, Control, Incubation, Western Blot, Labeling

Figure 6. miR-124 Overexpression Induces Neuronal Differentiation and Increases Survival in Human GBM Model (A–H) SOX9, GFAP, map2ab, and cleaved caspase 3 expression in athymic mice orthotopically xenografted with GBM43.miR-124 cells following treatment with regular control chow (A, C, G, and E) or Dox-containing chow (B, D, F, and H). Scale bar: 20 mm. (I) Bioluminescence levels during tumor progression in control and Dox-treated GBM43.miR-124 xenografted mice. (J) Kaplan-Meier survival curve (n = 12–13, **p < 0.01; log-rank Mantel-Cox test) of animals following treatment of GBM43.miR-124 xenografts with control versus Dox-containing chow. (K) Bioluminescence levels during tumor progression in control and Dox-treated GBM14.miR-124 xenografted mice. (L) Kaplan-Meier survival curve (n = 8–9, *p < 0.05; log-rank Mantel-Cox test) of animals following treatment of GBM14.miR-124 xenografts with control versus Dox-containing chow. See also Figures S5 and S6.

Journal: Cell reports

Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

doi: 10.1016/j.celrep.2019.07.071

Figure Lengend Snippet: Figure 6. miR-124 Overexpression Induces Neuronal Differentiation and Increases Survival in Human GBM Model (A–H) SOX9, GFAP, map2ab, and cleaved caspase 3 expression in athymic mice orthotopically xenografted with GBM43.miR-124 cells following treatment with regular control chow (A, C, G, and E) or Dox-containing chow (B, D, F, and H). Scale bar: 20 mm. (I) Bioluminescence levels during tumor progression in control and Dox-treated GBM43.miR-124 xenografted mice. (J) Kaplan-Meier survival curve (n = 12–13, **p < 0.01; log-rank Mantel-Cox test) of animals following treatment of GBM43.miR-124 xenografts with control versus Dox-containing chow. (K) Bioluminescence levels during tumor progression in control and Dox-treated GBM14.miR-124 xenografted mice. (L) Kaplan-Meier survival curve (n = 8–9, *p < 0.05; log-rank Mantel-Cox test) of animals following treatment of GBM14.miR-124 xenografts with control versus Dox-containing chow. See also Figures S5 and S6.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

Techniques: Over Expression, Expressing, Control

Figure 7. miR-124 Overexpression Reduces Radioresistance in Human GBM Cells (A) Schematic drawing depicting Dox-mediated miR-124 overexpression inducing neuronal differentiation leading to reduced radioresistance of GBM cells. (B–G) RAD51 (6 h) and cleaved caspase 3 (24 h) levels post-IR (5 Gy) after 3 days following no treatment (control) (B and E), BMP4-induced astroglial differentiation (C and F), and Dox-mediated (10 mg/mL) neuronal differentiation (D and G). Scale bar: 20 mm.

Journal: Cell reports

Article Title: Driving Neuronal Differentiation through Reversal of an ERK1/2-miR-124-SOX9 Axis Abrogates Glioblastoma Aggressiveness.

doi: 10.1016/j.celrep.2019.07.071

Figure Lengend Snippet: Figure 7. miR-124 Overexpression Reduces Radioresistance in Human GBM Cells (A) Schematic drawing depicting Dox-mediated miR-124 overexpression inducing neuronal differentiation leading to reduced radioresistance of GBM cells. (B–G) RAD51 (6 h) and cleaved caspase 3 (24 h) levels post-IR (5 Gy) after 3 days following no treatment (control) (B and E), BMP4-induced astroglial differentiation (C and F), and Dox-mediated (10 mg/mL) neuronal differentiation (D and G). Scale bar: 20 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nanostring nCounter miRNA expression assay v.1.3 (Table S5) This paper https://doi.org/10.17632/2n6vtt7y3d.2 Semiquantitative miRNA profiling data (Table S6) This paper https://doi.org/10.17632/7n4kjmsbj3.2 Experimental Models: Cell Lines Human GS2 GBM cells Provided from David James, (G€unther et al., 2008) N/A HEK293 cells ATCC ATCC# CRL-1573 Human GBM5 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM6 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM8 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM14 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM34 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM39 cells Provided from David James, (Sarkaria et al., 2006) N/A Human GBM 43 cells Provided from David James, (Sarkaria et al., 2006) N/A Experimental Models: Organisms/Strains Mouse: Athymic Nude: Foxn1nu/Foxn1nu Charler River Laboratories CrSim:NU(NCr)-Foxn1nu, RRID:MGI:5521191 Mouse: G-Ras: GFAP-Ha-V12-Ras-IRESLacZ Provided from Abjit Guha MGI Cat# 5286096, RRID:MGI:5286096 Mouse: FVB/N: inbred wildtype Charles River Laboratories MGI Cat# 3613630, RRID:MGI:3613630 Oligonucleotides LNATM PCR primer: hsa-miR-103a-3p (sequence: 50AGCAGCAUUGUACAGGG CUAUGA) QIAGEN Cat#YP00204063, miRBase#MIMAT0000101 LNATM PCR primer: hsa-miR-124-3p (sequence: 50UAAGGCACGCGGUGAAUGCC) QIAGEN Cat#YP00206026, miRBase#MIMAT0000422 LNATM PCR primer: hsa-miR-9-3p (sequence: 50AUAAAGCUAGAUAACCGAAAGU) QIAGEN Cat#YP00204620, miRBase#MIMAT0000442 Forward human GFAP primer: CTCGCCC TTGCTCACCAT Eurofins (Ding et al., 2001) Reverse human GFAP primer: GTTGGAGA GGAGACGCATCAC Eurofins (Ding et al., 2001) Forward LacZ primer: CGATCGTAATCAC CCGAGTGT Eurofins (Ding et al., 2001) Reverse LacZ primer: CCGTGGCCTGAC TCATTCC Eurofins (Ding et al., 2001) Recombinant DNA miR-125 sponge vector (sequence: TCACAAGTTAGGGTCTCAGGGA) (Åkerblom et al., 2012); Addgene Cat#115974 Human SOX9 overexpression vector (1,530 bp sequence of the human SOX9 gene cloned into a 3rd generation lentiviral vector encoding a CMV promoter).

Techniques: Over Expression, Control

Bone Marrow-Derived Stromal Cells – BMSC – Mesenchymal Stem Cells The stromal cells from the bone marrow are isolated and separated from the hematopoetic cell fraction of the bone marrow by their predilection to adhere to plastic. Some authors exclude the contamination by hematopoetic cells (which are CD 34 positive) by FACS. BMSCs are hence a crude mixture of stromal cells which support the growth of hematopoetic stem cells and mesenchymal stem cells. Some authors provide some additional (somewhat unspecific) markers to characterize these mesenchymal stem cells. Hence the actual stromal versus mesenchymal stem cell nature of the transplanted cells is unclear in many studies.

Journal: Journal of Neurotrauma

Article Title: A Systematic Review of Cellular Transplantation Therapies for Spinal Cord Injury

doi: 10.1089/neu.2009.1177

Figure Lengend Snippet: Bone Marrow-Derived Stromal Cells – BMSC – Mesenchymal Stem Cells The stromal cells from the bone marrow are isolated and separated from the hematopoetic cell fraction of the bone marrow by their predilection to adhere to plastic. Some authors exclude the contamination by hematopoetic cells (which are CD 34 positive) by FACS. BMSCs are hence a crude mixture of stromal cells which support the growth of hematopoetic stem cells and mesenchymal stem cells. Some authors provide some additional (somewhat unspecific) markers to characterize these mesenchymal stem cells. Hence the actual stromal versus mesenchymal stem cell nature of the transplanted cells is unclear in many studies.

Article Snippet: Lee Neurop-athology 2003 Model : Adult C57BL/6 mice , 15–20 g Injury : T10 contusion, 0.25 mm at 40 ms using pneumatic impact device ▪ Adherent BMSCs from 5–8 week old C57BL/6 male mice ; 2 nd /3 rd passage; Hoechst 33342 labeled cells suspended in DMEM at 1 × 10 3 cells per μl) and injected directly into (1.5 μl) & 2 mm rostral to the lesion (1.5 μl) @ 1 wk PI • Immunosuppression : None SUBACUTE 1.

Techniques: Isolation, Injection, Labeling, Control, Transplantation Assay, Functional Assay, Modification, Saline, Passaging, IV Injection, Marker, Membrane, Migration, Produced, Western Blot, Clinical Proteomics, Magnetic Resonance Imaging, Immunohistochemistry, Expressing, Suspension, In Vitro, Cell Culture, Ex Vivo, Mouse Assay, Transgenic Assay, Transfection, Sterility, TUNEL Assay, Recombinant, Microscopy, In Vivo, Imaging, Radioactivity, H&E Stain, Staining, In Vivo Imaging, Activity Assay, Immunohistochemical staining, Infection, Light Microscopy, Disruption, Retroviral, Transduction, Enzyme-linked Immunosorbent Assay, Genetically Modified, Plasmid Preparation, Comparison