image labeling tool Search Results


90
MetaMorph Inc 6.2 image processing software
6.2 Image Processing Software, supplied by MetaMorph Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/6+2+image+processing+software/pmc02672813-68-13-12
Average 90 stars, based on 1 article reviews
6.2 image processing software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Transnetyx smpd3 floxed mice
<t>Smpd3</t> modulates pancreatic tumor growth. A) Immortalized human pancreatic duct cells (hTERT-HPNE and HPDE6c7), human and murine PDA cell lines, and human patient derived-organoids (PDOs) demonstrate nSMase activity. Values shown are technical replicates of one lysate per cell line. B) SMPD3 expression was analyzed in an existing human pancreas organoid RNA-Seq dataset and is depicted in normal (n=11), primary (n=35), and metastatic (n=9) human organoids. Log of normalized counts of SMPD3 expression are plotted. C) Immunocytochemistry demonstrates nSMase2 expression in two pancreatic metastatic PDOs. Scale bar is 100uM. D) Nanoparticle tracking analysis of CD63 + sEVs upon GW4869 and vehicle treatment is depicted. E) IVIS imaging results at Day 7, 14, and 19 are graphed. Eight animals were injected with each cell line. F) Images depict bioluminescence signal during IVIS imaging at day 19. G) Pancreas weight/body weight at day 19 is graphed. Average values for the KPC scrambled shRNA are 0.04540 ± 0.001635 (n=8) and KPC Smpd3 shRNA 1 are 0.02817 ± 0.0008858 (n=7). H) Rag 1 KO mice injected orthotopically with KPC Smpd3 shRNA1 and KPC Smpd3 shRNA2 cell lines lived significantly longer than Rag1 KO mice injected orthotopically with KPC scrambled shRNA cells ( P =0.0013 using log-rank test and P =0.0001 using log-rank test, respectively). The median survival of Rag 1 KO mice injected orthotopically with KPC scrambled shRNA cells (n=12) is 19 days, KPC Smpd3 shRNA 1 cells (n=6) is 31.50 days, and KPC Smpd3 shRNA 2 cells (n=6) is 36.50 days.
Smpd3 Floxed Mice, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/Automated+Genotyping/bio_rxiv__2024__09__23__614610-550-8-16
Average 99 stars, based on 1 article reviews
smpd3 floxed mice - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

92
AutoMate Scientific Inc kettle
<t>Smpd3</t> modulates pancreatic tumor growth. A) Immortalized human pancreatic duct cells (hTERT-HPNE and HPDE6c7), human and murine PDA cell lines, and human patient derived-organoids (PDOs) demonstrate nSMase activity. Values shown are technical replicates of one lysate per cell line. B) SMPD3 expression was analyzed in an existing human pancreas organoid RNA-Seq dataset and is depicted in normal (n=11), primary (n=35), and metastatic (n=9) human organoids. Log of normalized counts of SMPD3 expression are plotted. C) Immunocytochemistry demonstrates nSMase2 expression in two pancreatic metastatic PDOs. Scale bar is 100uM. D) Nanoparticle tracking analysis of CD63 + sEVs upon GW4869 and vehicle treatment is depicted. E) IVIS imaging results at Day 7, 14, and 19 are graphed. Eight animals were injected with each cell line. F) Images depict bioluminescence signal during IVIS imaging at day 19. G) Pancreas weight/body weight at day 19 is graphed. Average values for the KPC scrambled shRNA are 0.04540 ± 0.001635 (n=8) and KPC Smpd3 shRNA 1 are 0.02817 ± 0.0008858 (n=7). H) Rag 1 KO mice injected orthotopically with KPC Smpd3 shRNA1 and KPC Smpd3 shRNA2 cell lines lived significantly longer than Rag1 KO mice injected orthotopically with KPC scrambled shRNA cells ( P =0.0013 using log-rank test and P =0.0001 using log-rank test, respectively). The median survival of Rag 1 KO mice injected orthotopically with KPC scrambled shRNA cells (n=12) is 19 days, KPC Smpd3 shRNA 1 cells (n=6) is 31.50 days, and KPC Smpd3 shRNA 2 cells (n=6) is 36.50 days.
Kettle, supplied by AutoMate Scientific Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/Droso-Plugs+%2C+Wide+Vials/10__1038_slash_nprot__2016__112-172-37-30
Average 92 stars, based on 1 article reviews
kettle - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

99
Sartorius AG health n a incucyte zoom v2018a essen biosciences n a prism v8 1 1 graphpad software n a sequential labeling pipeline
KEY RESOURCES TABLE
Health N A Incucyte Zoom V2018a Essen Biosciences N A Prism V8 1 1 Graphpad Software N A Sequential Labeling Pipeline, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/Live+Cell+Analysis+Instruments/pmc06810872-824-134-139
Average 99 stars, based on 1 article reviews
health n a incucyte zoom v2018a essen biosciences n a prism v8 1 1 graphpad software n a sequential labeling pipeline - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
OriGene pcmv6 entry mouse mlh1 origene
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Pcmv6 Entry Mouse Mlh1 Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/Mlh1+(NM_026810)+Mouse+Tagged+ORF+Clone+Lentiviral+Particle/pm33338427-205-151-153
Average 90 stars, based on 1 article reviews
pcmv6 entry mouse mlh1 origene - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Bio-Rad algorithms image lab 6 0 1 bio rad
Figure 1. <t>MLH1</t> Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.
Algorithms Image Lab 6 0 1 Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/Image+Lab+Software+for+PC+Version+6%2E0%2E1/pm37060569-199-135-139
Average 99 stars, based on 1 article reviews
algorithms image lab 6 0 1 bio rad - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Oxford Instruments imagej software
Functional analysis of human fetal and adult single-donor human renal vascular-tubular units (hRVTU). A) hRVTU created from human fetal renal cortical epithelial cells and kidney microvascular endothelial cells from the same donor sets were used for permeability assessment. Texas Red-labeled 70 kDa dextran was perfused into the epithelial channel during real-time imaging with 10 µm FITC-labeled 70 kDa dextran perfused into the endothelial 2 minutes later. (i) Epithelial channel is shown ~1 minute into perfusion and (ii) endothelial channel ~3 minutes into perfusion. (ii and iv) Fluorescent intensity over distance was calculated for the ROI shown in each image (dashed yellow lines) at two time-points using <t>imageJ</t> <t>software</t> (U.S. National Institute of Health, Bethesda, Maryland), demonstrating relatively little increase in width during the measured period. B) Blood from healthy volunteers was perfused into the endothelial channel of a hRVTU constructed as in A, under real-time imaging. No blood components can be seen within epithelial channels throughout ten minutes of blood perfusion. Left panel at 4× magnification, right panel at 10× magnification. C) hRVTU were created from adult renal cortical epithelial cells and human kidney microvascular endothelial cells from the same donor sets. After four days in culture device epithelial inlets were perfused with rhodamine-labeled human serum albumin and FITC-labeled inulin under real-time imaging. Following perfusion, devices were decellularized with trypsin, and perfusion repeated as an internal control. (i) Devices shown 15 minutes into perfusion show albumin (red) accumulating within cells. Yellow arrows highlight intracellular albumin accumulation within cells both on the top and side walls of vessels. (ii) Magnified image of a channel 30 minutes into perfusion shows albumin accumulating within cells, while inulin (iii) is not seen to accumulate intracellularly. Effluent was collected at one hour and run on a spectrophotometer, with albumin reabsorption calculated as noted in the main text. A two-tailed paired T test was done comparing albumin reabsorption in cellularized versus decellularized vessels (n = 3, bars indicate SEM and ** indicates P < 0.01).
Imagej Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/Imaris/pmc06478624-251-14-31
Average 99 stars, based on 1 article reviews
imagej software - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Bio-Rad image lab 4 1 software
Functional analysis of human fetal and adult single-donor human renal vascular-tubular units (hRVTU). A) hRVTU created from human fetal renal cortical epithelial cells and kidney microvascular endothelial cells from the same donor sets were used for permeability assessment. Texas Red-labeled 70 kDa dextran was perfused into the epithelial channel during real-time imaging with 10 µm FITC-labeled 70 kDa dextran perfused into the endothelial 2 minutes later. (i) Epithelial channel is shown ~1 minute into perfusion and (ii) endothelial channel ~3 minutes into perfusion. (ii and iv) Fluorescent intensity over distance was calculated for the ROI shown in each image (dashed yellow lines) at two time-points using <t>imageJ</t> <t>software</t> (U.S. National Institute of Health, Bethesda, Maryland), demonstrating relatively little increase in width during the measured period. B) Blood from healthy volunteers was perfused into the endothelial channel of a hRVTU constructed as in A, under real-time imaging. No blood components can be seen within epithelial channels throughout ten minutes of blood perfusion. Left panel at 4× magnification, right panel at 10× magnification. C) hRVTU were created from adult renal cortical epithelial cells and human kidney microvascular endothelial cells from the same donor sets. After four days in culture device epithelial inlets were perfused with rhodamine-labeled human serum albumin and FITC-labeled inulin under real-time imaging. Following perfusion, devices were decellularized with trypsin, and perfusion repeated as an internal control. (i) Devices shown 15 minutes into perfusion show albumin (red) accumulating within cells. Yellow arrows highlight intracellular albumin accumulation within cells both on the top and side walls of vessels. (ii) Magnified image of a channel 30 minutes into perfusion shows albumin accumulating within cells, while inulin (iii) is not seen to accumulate intracellularly. Effluent was collected at one hour and run on a spectrophotometer, with albumin reabsorption calculated as noted in the main text. A two-tailed paired T test was done comparing albumin reabsorption in cellularized versus decellularized vessels (n = 3, bars indicate SEM and ** indicates P < 0.01).
Image Lab 4 1 Software, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/Image+Lab+Software/10__2147_slash_ott__s173840-60-34-39
Average 99 stars, based on 1 article reviews
image lab 4 1 software - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
Danaher Inc m205 fa epifluorescent microscope
Functional analysis of human fetal and adult single-donor human renal vascular-tubular units (hRVTU). A) hRVTU created from human fetal renal cortical epithelial cells and kidney microvascular endothelial cells from the same donor sets were used for permeability assessment. Texas Red-labeled 70 kDa dextran was perfused into the epithelial channel during real-time imaging with 10 µm FITC-labeled 70 kDa dextran perfused into the endothelial 2 minutes later. (i) Epithelial channel is shown ~1 minute into perfusion and (ii) endothelial channel ~3 minutes into perfusion. (ii and iv) Fluorescent intensity over distance was calculated for the ROI shown in each image (dashed yellow lines) at two time-points using <t>imageJ</t> <t>software</t> (U.S. National Institute of Health, Bethesda, Maryland), demonstrating relatively little increase in width during the measured period. B) Blood from healthy volunteers was perfused into the endothelial channel of a hRVTU constructed as in A, under real-time imaging. No blood components can be seen within epithelial channels throughout ten minutes of blood perfusion. Left panel at 4× magnification, right panel at 10× magnification. C) hRVTU were created from adult renal cortical epithelial cells and human kidney microvascular endothelial cells from the same donor sets. After four days in culture device epithelial inlets were perfused with rhodamine-labeled human serum albumin and FITC-labeled inulin under real-time imaging. Following perfusion, devices were decellularized with trypsin, and perfusion repeated as an internal control. (i) Devices shown 15 minutes into perfusion show albumin (red) accumulating within cells. Yellow arrows highlight intracellular albumin accumulation within cells both on the top and side walls of vessels. (ii) Magnified image of a channel 30 minutes into perfusion shows albumin accumulating within cells, while inulin (iii) is not seen to accumulate intracellularly. Effluent was collected at one hour and run on a spectrophotometer, with albumin reabsorption calculated as noted in the main text. A two-tailed paired T test was done comparing albumin reabsorption in cellularized versus decellularized vessels (n = 3, bars indicate SEM and ** indicates P < 0.01).
M205 Fa Epifluorescent Microscope, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/M205+FA+Fluorescence+Stereo+Microscopes/pmc08389629-183-18-22
Average 96 stars, based on 1 article reviews
m205 fa epifluorescent microscope - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Broad Institute Inc cellprofiler software
Functional analysis of human fetal and adult single-donor human renal vascular-tubular units (hRVTU). A) hRVTU created from human fetal renal cortical epithelial cells and kidney microvascular endothelial cells from the same donor sets were used for permeability assessment. Texas Red-labeled 70 kDa dextran was perfused into the epithelial channel during real-time imaging with 10 µm FITC-labeled 70 kDa dextran perfused into the endothelial 2 minutes later. (i) Epithelial channel is shown ~1 minute into perfusion and (ii) endothelial channel ~3 minutes into perfusion. (ii and iv) Fluorescent intensity over distance was calculated for the ROI shown in each image (dashed yellow lines) at two time-points using <t>imageJ</t> <t>software</t> (U.S. National Institute of Health, Bethesda, Maryland), demonstrating relatively little increase in width during the measured period. B) Blood from healthy volunteers was perfused into the endothelial channel of a hRVTU constructed as in A, under real-time imaging. No blood components can be seen within epithelial channels throughout ten minutes of blood perfusion. Left panel at 4× magnification, right panel at 10× magnification. C) hRVTU were created from adult renal cortical epithelial cells and human kidney microvascular endothelial cells from the same donor sets. After four days in culture device epithelial inlets were perfused with rhodamine-labeled human serum albumin and FITC-labeled inulin under real-time imaging. Following perfusion, devices were decellularized with trypsin, and perfusion repeated as an internal control. (i) Devices shown 15 minutes into perfusion show albumin (red) accumulating within cells. Yellow arrows highlight intracellular albumin accumulation within cells both on the top and side walls of vessels. (ii) Magnified image of a channel 30 minutes into perfusion shows albumin accumulating within cells, while inulin (iii) is not seen to accumulate intracellularly. Effluent was collected at one hour and run on a spectrophotometer, with albumin reabsorption calculated as noted in the main text. A two-tailed paired T test was done comparing albumin reabsorption in cellularized versus decellularized vessels (n = 3, bars indicate SEM and ** indicates P < 0.01).
Cellprofiler Software, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/cellprofiler/10__3390_slash_biom14091047-52-7-12
Average 90 stars, based on 1 article reviews
cellprofiler software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Revvity vivo imaging software ivis system
Pep42-BBZ CAR-T cells showed antitumor activity in vivo. A Schematic in the top panel illustrates the experiment design for the U-251MG xenograft tumors. NCG mice was inoculated subcutaneously with 5 × 10 6 luciferase-expressing U-251MG cells. Five days later mock-BBZ and Pep42-BBZ CAR-T cells (1 × 10 7 per mouse) were injected intravenously into tail veins. The tumors growth was monitored once a week. B A representative image of csGRP78 staining of xenograft tumor sections by IF. Five days after tumor cells inoculation, tumor tissues were extracted and cell surface IF was performed for GRP78. Control was stained without GRP78 antibody. C The tumor bioluminescence images by <t>IVIS</t> imaging. D Tumor bioluminescence intensity curves for the two groups. E Representative CD3 staining of tumor sections by IF. Five-days post injection, 3 tumors from each group were extracted, embedded in paraffin, sectioned, and stained with CD3ζ antibody coupled with Cy3-conjunctated secondary antibodies. Two representative images are included from each group. F The statistics and representatives of CD4 and CD8 staining on Pep42-BBZ CAR-T treated tumor sample sections. The numbers of FITC labeled-CD4 and Cy3 labeled-CD8 were calculated and performed for percentage counting. G Representative NESTIN staining of tumor sections by IF. Five-days post injection, 3 tumors from each group were extracted, embedded in paraffin, sectioned, and stained with NESTIN antibodies coupled with Cy3-conjunctated secondary antibodies. Two representative images from each group are shown. Scale bar = 100 μm
Vivo Imaging Software Ivis System, supplied by Revvity, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/IVIS+Lumina+LT+In+Vivo+Imaging+System/pmc10362566-85-10-17
Average 93 stars, based on 1 article reviews
vivo imaging software ivis system - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
corel corporation coreldraw software
Pep42-BBZ CAR-T cells showed antitumor activity in vivo. A Schematic in the top panel illustrates the experiment design for the U-251MG xenograft tumors. NCG mice was inoculated subcutaneously with 5 × 10 6 luciferase-expressing U-251MG cells. Five days later mock-BBZ and Pep42-BBZ CAR-T cells (1 × 10 7 per mouse) were injected intravenously into tail veins. The tumors growth was monitored once a week. B A representative image of csGRP78 staining of xenograft tumor sections by IF. Five days after tumor cells inoculation, tumor tissues were extracted and cell surface IF was performed for GRP78. Control was stained without GRP78 antibody. C The tumor bioluminescence images by <t>IVIS</t> imaging. D Tumor bioluminescence intensity curves for the two groups. E Representative CD3 staining of tumor sections by IF. Five-days post injection, 3 tumors from each group were extracted, embedded in paraffin, sectioned, and stained with CD3ζ antibody coupled with Cy3-conjunctated secondary antibodies. Two representative images are included from each group. F The statistics and representatives of CD4 and CD8 staining on Pep42-BBZ CAR-T treated tumor sample sections. The numbers of FITC labeled-CD4 and Cy3 labeled-CD8 were calculated and performed for percentage counting. G Representative NESTIN staining of tumor sections by IF. Five-days post injection, 3 tumors from each group were extracted, embedded in paraffin, sectioned, and stained with NESTIN antibodies coupled with Cy3-conjunctated secondary antibodies. Two representative images from each group are shown. Scale bar = 100 μm
Coreldraw Software, supplied by corel corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/image+labeling+tool/coreldraw+x7/pm31692367-79-8-10
Average 90 stars, based on 1 article reviews
coreldraw software - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Smpd3 modulates pancreatic tumor growth. A) Immortalized human pancreatic duct cells (hTERT-HPNE and HPDE6c7), human and murine PDA cell lines, and human patient derived-organoids (PDOs) demonstrate nSMase activity. Values shown are technical replicates of one lysate per cell line. B) SMPD3 expression was analyzed in an existing human pancreas organoid RNA-Seq dataset and is depicted in normal (n=11), primary (n=35), and metastatic (n=9) human organoids. Log of normalized counts of SMPD3 expression are plotted. C) Immunocytochemistry demonstrates nSMase2 expression in two pancreatic metastatic PDOs. Scale bar is 100uM. D) Nanoparticle tracking analysis of CD63 + sEVs upon GW4869 and vehicle treatment is depicted. E) IVIS imaging results at Day 7, 14, and 19 are graphed. Eight animals were injected with each cell line. F) Images depict bioluminescence signal during IVIS imaging at day 19. G) Pancreas weight/body weight at day 19 is graphed. Average values for the KPC scrambled shRNA are 0.04540 ± 0.001635 (n=8) and KPC Smpd3 shRNA 1 are 0.02817 ± 0.0008858 (n=7). H) Rag 1 KO mice injected orthotopically with KPC Smpd3 shRNA1 and KPC Smpd3 shRNA2 cell lines lived significantly longer than Rag1 KO mice injected orthotopically with KPC scrambled shRNA cells ( P =0.0013 using log-rank test and P =0.0001 using log-rank test, respectively). The median survival of Rag 1 KO mice injected orthotopically with KPC scrambled shRNA cells (n=12) is 19 days, KPC Smpd3 shRNA 1 cells (n=6) is 31.50 days, and KPC Smpd3 shRNA 2 cells (n=6) is 36.50 days.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: Smpd3 modulates pancreatic tumor growth. A) Immortalized human pancreatic duct cells (hTERT-HPNE and HPDE6c7), human and murine PDA cell lines, and human patient derived-organoids (PDOs) demonstrate nSMase activity. Values shown are technical replicates of one lysate per cell line. B) SMPD3 expression was analyzed in an existing human pancreas organoid RNA-Seq dataset and is depicted in normal (n=11), primary (n=35), and metastatic (n=9) human organoids. Log of normalized counts of SMPD3 expression are plotted. C) Immunocytochemistry demonstrates nSMase2 expression in two pancreatic metastatic PDOs. Scale bar is 100uM. D) Nanoparticle tracking analysis of CD63 + sEVs upon GW4869 and vehicle treatment is depicted. E) IVIS imaging results at Day 7, 14, and 19 are graphed. Eight animals were injected with each cell line. F) Images depict bioluminescence signal during IVIS imaging at day 19. G) Pancreas weight/body weight at day 19 is graphed. Average values for the KPC scrambled shRNA are 0.04540 ± 0.001635 (n=8) and KPC Smpd3 shRNA 1 are 0.02817 ± 0.0008858 (n=7). H) Rag 1 KO mice injected orthotopically with KPC Smpd3 shRNA1 and KPC Smpd3 shRNA2 cell lines lived significantly longer than Rag1 KO mice injected orthotopically with KPC scrambled shRNA cells ( P =0.0013 using log-rank test and P =0.0001 using log-rank test, respectively). The median survival of Rag 1 KO mice injected orthotopically with KPC scrambled shRNA cells (n=12) is 19 days, KPC Smpd3 shRNA 1 cells (n=6) is 31.50 days, and KPC Smpd3 shRNA 2 cells (n=6) is 36.50 days.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Derivative Assay, Activity Assay, Expressing, RNA Sequencing, Immunocytochemistry, Imaging, Injection, shRNA

S m pd3 regulates proliferation of PDA cells in vivo . A) SMPD3 is expressed in a panel of human pancreatic duct cells (n=2 cell lines), human PDA cells (n=12 cell lines), and mouse PDA cells (n=3 cell lines). B) qPCR demonstrates a reduction in Smpd3 expression in KPC Smpd3 shRNA 1 LucFlag (n=3) and KPC Smpd3 shRNA 2 LucFlag (n=3) cell lines when compared to the KPC scrambled shRNA LucFlag (n=3) control cell line. C) Mean ± standard deviation for tumor volume of cell lines injected subcutaneously are graphed. Results of an unpaired t test comparing KPC scrambled shRNA and KPC Smpd3 shRNA 2 cell lines at day 17 are depicted on the graph. For all cell lines, N=6 animals. D) Mean ± standard error of the mean for tumor weight at Day 17 of cell lines injected subcutaneously are graphed. For all cell lines, N=6 animals. E) Immunofluorescence images and quantification of epithelial (CK19 + , Vimentin - , Dapi + ), proliferative (Ki67 + ) pancreatic cancer cells are depicted. Average values for tumors generated using the KPC scrambled shRNA LucFlag line (n=4) are 39.33% ± 2.046%, KPC Smpd3 shRNA 1 LucFlag line (n=5) are 28.88% ± 4.096%, and KPC Smpd3 shRNA 2 LucFlag line (n=5) are 15.83% ± 1.960. Scale bar is 50uM. F) Immunofluorescence images and quantification of epithelial (E-cadherin + , Vimentin - , Dapi + ), apoptotic (Cleaved caspase 3 + ) pancreatic cancer cells are depicted. Average values for tumors generated using the KPC scrambled shRNA LucFlag cell line (n=4) are 1.299% ± 0.2075%, KPC Smpd3 shRNA 1 LucFlag cell line (n=5) are 1.082% ± 0.2126%, and KPC Smpd3 shRNA 2 LucFlag cell line (n=5) are 0.9832% ± 0.1307. Scale bar is 50uM. G) CTG assay or colony formation assay results for the indicated cell lines are depicted. H) Reduction of Smpd3 in epithelial pancreatic cancer cells modestly reduces fibrosis. IHC demonstrates loss of nSMase2 in epithelial pancreatic cancer cells in tumors generated using the KPC Smpd3 shRNA 1 LucFlag and KPC Smpd3 shRNA 2 LucFlag cell lines. One scale bar (1000uM) on the picrosirius red image is representative for all picrosirius red and corresponding brightfield images. One scale bar (200uM) on the nSMase2 IHC image is representative for all nSMase2 IHC images. I) Quantification of polarized light using the picrosirius red stained images is depicted. Average values for tumors generated using the KPC scrambled shRNA LucFlag cell line (n=4) are 1.734% ± 0.3760%, KPC Smpd3 shRNA 1 LucFlag cell line (n=5) are 1.319% ± 0.1328%, and KPC Smpd3 shRNA 2 LucFlag cell line (n=4) are 0.9188% ± 0.1124.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: S m pd3 regulates proliferation of PDA cells in vivo . A) SMPD3 is expressed in a panel of human pancreatic duct cells (n=2 cell lines), human PDA cells (n=12 cell lines), and mouse PDA cells (n=3 cell lines). B) qPCR demonstrates a reduction in Smpd3 expression in KPC Smpd3 shRNA 1 LucFlag (n=3) and KPC Smpd3 shRNA 2 LucFlag (n=3) cell lines when compared to the KPC scrambled shRNA LucFlag (n=3) control cell line. C) Mean ± standard deviation for tumor volume of cell lines injected subcutaneously are graphed. Results of an unpaired t test comparing KPC scrambled shRNA and KPC Smpd3 shRNA 2 cell lines at day 17 are depicted on the graph. For all cell lines, N=6 animals. D) Mean ± standard error of the mean for tumor weight at Day 17 of cell lines injected subcutaneously are graphed. For all cell lines, N=6 animals. E) Immunofluorescence images and quantification of epithelial (CK19 + , Vimentin - , Dapi + ), proliferative (Ki67 + ) pancreatic cancer cells are depicted. Average values for tumors generated using the KPC scrambled shRNA LucFlag line (n=4) are 39.33% ± 2.046%, KPC Smpd3 shRNA 1 LucFlag line (n=5) are 28.88% ± 4.096%, and KPC Smpd3 shRNA 2 LucFlag line (n=5) are 15.83% ± 1.960. Scale bar is 50uM. F) Immunofluorescence images and quantification of epithelial (E-cadherin + , Vimentin - , Dapi + ), apoptotic (Cleaved caspase 3 + ) pancreatic cancer cells are depicted. Average values for tumors generated using the KPC scrambled shRNA LucFlag cell line (n=4) are 1.299% ± 0.2075%, KPC Smpd3 shRNA 1 LucFlag cell line (n=5) are 1.082% ± 0.2126%, and KPC Smpd3 shRNA 2 LucFlag cell line (n=5) are 0.9832% ± 0.1307. Scale bar is 50uM. G) CTG assay or colony formation assay results for the indicated cell lines are depicted. H) Reduction of Smpd3 in epithelial pancreatic cancer cells modestly reduces fibrosis. IHC demonstrates loss of nSMase2 in epithelial pancreatic cancer cells in tumors generated using the KPC Smpd3 shRNA 1 LucFlag and KPC Smpd3 shRNA 2 LucFlag cell lines. One scale bar (1000uM) on the picrosirius red image is representative for all picrosirius red and corresponding brightfield images. One scale bar (200uM) on the nSMase2 IHC image is representative for all nSMase2 IHC images. I) Quantification of polarized light using the picrosirius red stained images is depicted. Average values for tumors generated using the KPC scrambled shRNA LucFlag cell line (n=4) are 1.734% ± 0.3760%, KPC Smpd3 shRNA 1 LucFlag cell line (n=5) are 1.319% ± 0.1328%, and KPC Smpd3 shRNA 2 LucFlag cell line (n=4) are 0.9188% ± 0.1124.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: In Vivo, Expressing, shRNA, Control, Standard Deviation, Injection, Immunofluorescence, Generated, CTG Assay, Colony Assay, Staining

nSMase2 expression is upregulated in PanIN. A) Schematic details the construct design for the Smpd3 floxed mouse. B-C) For examination of nSMase2 expression in the indicated normal murine pancreatic cell types, nSMase2 IHC sections from 3 C57BL/6J mice were scored. Preneoplasia and neoplasia lesions were scored from KPC mice (n=10 animals scored for acinar-to-ductal metaplasia (ADM), n=12 animals scored for PanIN, n=10 animals scored for primary tumor, and n=4 animals scored for metastasis). Scale bars for IHC images are 40 uM. nSMase2 expression was scored on a scale of 0-3 and is depicted in (C). The scoring system used is 0=absent, 1=low, 2=medium, 3=high. Values depicted are representative for individual animals. D) Subcellular localization of nSMase2 was scored using the same slides and animals used for expression scoring in . Results from Chi-squared tests using a 2 x 3 table are shown. E-F) H&E and IHC for nSMase2 images are displayed for the indicated genotypes.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: nSMase2 expression is upregulated in PanIN. A) Schematic details the construct design for the Smpd3 floxed mouse. B-C) For examination of nSMase2 expression in the indicated normal murine pancreatic cell types, nSMase2 IHC sections from 3 C57BL/6J mice were scored. Preneoplasia and neoplasia lesions were scored from KPC mice (n=10 animals scored for acinar-to-ductal metaplasia (ADM), n=12 animals scored for PanIN, n=10 animals scored for primary tumor, and n=4 animals scored for metastasis). Scale bars for IHC images are 40 uM. nSMase2 expression was scored on a scale of 0-3 and is depicted in (C). The scoring system used is 0=absent, 1=low, 2=medium, 3=high. Values depicted are representative for individual animals. D) Subcellular localization of nSMase2 was scored using the same slides and animals used for expression scoring in . Results from Chi-squared tests using a 2 x 3 table are shown. E-F) H&E and IHC for nSMase2 images are displayed for the indicated genotypes.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Expressing, Construct

Smpd3 ablation reduces formation of neoplasia and prolongs survival of KPC mice. A) KPC; Smpd3 f/f mice lived significantly longer than KPC; Smpd3 wt/wt mice ( P =0.0039 using log-rank (Mantel-Cox) test). The median survival of KPC; Smpd3 f/f mice (n=41) is 23.71 weeks, KPC; Smpd3 f/wt mice is 21.57 weeks (n=45), and KPC; Smpd3 wt/wt mice (n=47) is 20.00 weeks. B) The percentage of animals having PDA at end-stage in addition to the differentiation status of primary pancreatic tumors at end-stage is graphed for KPC; Smpd3 wt/wt mice (n=30), KPC; Smpd3 f/wt mice (n=27), and KPC; Smpd3 f/f mice (n=24). (C) The percentage of animals having macrometastasis at end-stage in addition to the site of macrometastasis at end-stage is depicted for KPC; Smpd3 wt/wt (n=29), KPC; Smpd3 f/wt (n=25), and KPC; Smpd3 f/f (n=22) mice. Using Fisher’s exact tests, no significant differences were observed in the number or site of macrometastatic lesions present at end-stage in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , or KPC; Smpd3 f/f mice. If macrometastasis was present, only one site was observed per animal in these cohorts. D-E) Quantification of alcian blue staining demonstrates significantly reduced PanIN lesions in KPC; Smpd3 f/f mice (n=5) when compared to KPC; Smpd3 wt/wt mice (n=9) ( P =0.0154). H&Es used to score edema are depicted. nSMase2 immunohistochemistry depicts loss of nSMase2 in pancreatic epithelium of PanIN-bearing KPC; Smpd3 f/f mice. F) Edema scoring for KPC; Smpd3 wt/wt (n=9), KPC; Smpd3 f/wt (n=7), and KPC; Smpd3 f/f (n=7) mice is depicted. The scoring system used is 1=low, 2=medium, and 3=high. G-H) The percentage of pancreatic area occupied by PDA is significantly higher in KPC; Smpd3 wt/wt mice (74.16 ± 8.705) when compared to KPC; Smpd3 f/f mice (30.51 ± 17.72) ( P =0.0497) at 19-21 weeks of age. Average percent area is graphed in H (n=4 KPC; Smpd3 f/f mice, n=4 KPC; Smpd3 f/wt mice, n=5 KPC; Smpd3 wt/wt mice). Dotted lines show the PDA area in representative images. nSMase2 immunohistochemistry depicts loss of nSMase2 in pancreatic epithelium of PDA-bearing KPC; Smpd3 f/f mice at 19-21 weeks of age.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: Smpd3 ablation reduces formation of neoplasia and prolongs survival of KPC mice. A) KPC; Smpd3 f/f mice lived significantly longer than KPC; Smpd3 wt/wt mice ( P =0.0039 using log-rank (Mantel-Cox) test). The median survival of KPC; Smpd3 f/f mice (n=41) is 23.71 weeks, KPC; Smpd3 f/wt mice is 21.57 weeks (n=45), and KPC; Smpd3 wt/wt mice (n=47) is 20.00 weeks. B) The percentage of animals having PDA at end-stage in addition to the differentiation status of primary pancreatic tumors at end-stage is graphed for KPC; Smpd3 wt/wt mice (n=30), KPC; Smpd3 f/wt mice (n=27), and KPC; Smpd3 f/f mice (n=24). (C) The percentage of animals having macrometastasis at end-stage in addition to the site of macrometastasis at end-stage is depicted for KPC; Smpd3 wt/wt (n=29), KPC; Smpd3 f/wt (n=25), and KPC; Smpd3 f/f (n=22) mice. Using Fisher’s exact tests, no significant differences were observed in the number or site of macrometastatic lesions present at end-stage in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , or KPC; Smpd3 f/f mice. If macrometastasis was present, only one site was observed per animal in these cohorts. D-E) Quantification of alcian blue staining demonstrates significantly reduced PanIN lesions in KPC; Smpd3 f/f mice (n=5) when compared to KPC; Smpd3 wt/wt mice (n=9) ( P =0.0154). H&Es used to score edema are depicted. nSMase2 immunohistochemistry depicts loss of nSMase2 in pancreatic epithelium of PanIN-bearing KPC; Smpd3 f/f mice. F) Edema scoring for KPC; Smpd3 wt/wt (n=9), KPC; Smpd3 f/wt (n=7), and KPC; Smpd3 f/f (n=7) mice is depicted. The scoring system used is 1=low, 2=medium, and 3=high. G-H) The percentage of pancreatic area occupied by PDA is significantly higher in KPC; Smpd3 wt/wt mice (74.16 ± 8.705) when compared to KPC; Smpd3 f/f mice (30.51 ± 17.72) ( P =0.0497) at 19-21 weeks of age. Average percent area is graphed in H (n=4 KPC; Smpd3 f/f mice, n=4 KPC; Smpd3 f/wt mice, n=5 KPC; Smpd3 wt/wt mice). Dotted lines show the PDA area in representative images. nSMase2 immunohistochemistry depicts loss of nSMase2 in pancreatic epithelium of PDA-bearing KPC; Smpd3 f/f mice at 19-21 weeks of age.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Staining, Immunohistochemistry

Characterization of the KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , KPC; Smpd3 f/f , KPC; Smpd3 wt/wt Mock OE, and KPC; Smpd3 wt/wt Smpd3 OE cell lines. A-F) Western blot depicts nSMase2 expression levels in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , KPC; Smpd3 f/f , KPC; Smpd3 wt/wt Mock OE, and KPC; Smpd3 wt/wt Smpd3 OE cell lines. G) Pictures of cell lines taken immediately before RNA isolation for RNA sequencing are shown. Scale bars are 100uM.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: Characterization of the KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , KPC; Smpd3 f/f , KPC; Smpd3 wt/wt Mock OE, and KPC; Smpd3 wt/wt Smpd3 OE cell lines. A-F) Western blot depicts nSMase2 expression levels in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , KPC; Smpd3 f/f , KPC; Smpd3 wt/wt Mock OE, and KPC; Smpd3 wt/wt Smpd3 OE cell lines. G) Pictures of cell lines taken immediately before RNA isolation for RNA sequencing are shown. Scale bars are 100uM.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Western Blot, Expressing, Isolation, RNA Sequencing

RNA sequencing demonstrates a role for Smpd3 in modulation of cellular pathways and regulation of PDA subtype. A) Average luminescence values from 3-5 independent experiments per cell line are graphed. Average values for primary PDA cell lines generated from KPC; Smpd3 wt/wt mice (n=17 cell lines) are 98,614 ± 5,684, KPC; Smpd3 f/wt mice (n=14 cell lines) are 106,061 ± 6,699, and KPC; Smpd3 f/f mice (n=15 cell lines) are 88,460 ± 6,672. B) Average number of colonies from at least 3 independent colony formation assays per cell line are depicted. Average values from KPC; Smpd3 wt/wt mice (n=14 cell lines) are 26.02 ± 3.652, KPC; Smpd3 f/wt mice (n=14 cell lines) are 24.16 ± 2.519, and KPC; Smpd3 f/f mice (n=13 cell lines) are 21.34 ± 4.872. C) Heat maps depict expression of significantly deregulated molecules in Tumor Microenvironment Pathway and Hepatic Fibrosis Signaling Pathway in all three PPT cell lines. Molecules shown in heat maps include those molecules within the Ingenuity pathway analysis (IPA) pathway that were significantly deregulated in any comparison between PPT groups. D) IPA results show a bubble category chart of significantly deregulated pathways when comparing KPC; Smpd3 f/f PPT and KPC; Smpd3 wt/wt PPT cell lines. A positive z-score represents upregulation, and a negative z-score indicates downregulation of a pathway in KPC; Smpd3 f/f PPT when compared to KPC; Smpd3 wt/wt PPT cell lines. A gray circle depicts significant overrepresentation of a pathway, the direction of which cannot yet be determined. Select pathways are annotated. E) Picrosirius red stained images are shown for KPC; Smpd3 wt/wt (n=6), KPC; Smpd3 f/wt (n=5), and KPC; Smpd3 f/f (n=6) mice at 10-11 weeks of age. The small piece of intestine in the lower left corner of the KPC; Smpd3 f/wt image was excluded from the quantification. Scale bar is 1000uM. Inset shows brightfield image. F) Transcriptional subtyping of end-stage pancreatic tumor cell lines generated from KPC; Smpd3 wt/wt (PPT and MPT), KPC; Smpd3 f/wt (PPT), KPC; Smpd3 f/f (PPT and MPT) as well as KPC Mock OE and KPC Smpd3 OE lines is depicted. Genes used to identify subtypes according to the Moffitt classification are shown. G) Pie charts depict the number of cell lines with the classical and basal-like Moffitt subtypes. When comparing KPC; Smpd3 wt/wt PPT vs KPC; Smpd3 f/f PPT using Moffitt classification and Chi square test, p-value=0.0339.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: RNA sequencing demonstrates a role for Smpd3 in modulation of cellular pathways and regulation of PDA subtype. A) Average luminescence values from 3-5 independent experiments per cell line are graphed. Average values for primary PDA cell lines generated from KPC; Smpd3 wt/wt mice (n=17 cell lines) are 98,614 ± 5,684, KPC; Smpd3 f/wt mice (n=14 cell lines) are 106,061 ± 6,699, and KPC; Smpd3 f/f mice (n=15 cell lines) are 88,460 ± 6,672. B) Average number of colonies from at least 3 independent colony formation assays per cell line are depicted. Average values from KPC; Smpd3 wt/wt mice (n=14 cell lines) are 26.02 ± 3.652, KPC; Smpd3 f/wt mice (n=14 cell lines) are 24.16 ± 2.519, and KPC; Smpd3 f/f mice (n=13 cell lines) are 21.34 ± 4.872. C) Heat maps depict expression of significantly deregulated molecules in Tumor Microenvironment Pathway and Hepatic Fibrosis Signaling Pathway in all three PPT cell lines. Molecules shown in heat maps include those molecules within the Ingenuity pathway analysis (IPA) pathway that were significantly deregulated in any comparison between PPT groups. D) IPA results show a bubble category chart of significantly deregulated pathways when comparing KPC; Smpd3 f/f PPT and KPC; Smpd3 wt/wt PPT cell lines. A positive z-score represents upregulation, and a negative z-score indicates downregulation of a pathway in KPC; Smpd3 f/f PPT when compared to KPC; Smpd3 wt/wt PPT cell lines. A gray circle depicts significant overrepresentation of a pathway, the direction of which cannot yet be determined. Select pathways are annotated. E) Picrosirius red stained images are shown for KPC; Smpd3 wt/wt (n=6), KPC; Smpd3 f/wt (n=5), and KPC; Smpd3 f/f (n=6) mice at 10-11 weeks of age. The small piece of intestine in the lower left corner of the KPC; Smpd3 f/wt image was excluded from the quantification. Scale bar is 1000uM. Inset shows brightfield image. F) Transcriptional subtyping of end-stage pancreatic tumor cell lines generated from KPC; Smpd3 wt/wt (PPT and MPT), KPC; Smpd3 f/wt (PPT), KPC; Smpd3 f/f (PPT and MPT) as well as KPC Mock OE and KPC Smpd3 OE lines is depicted. Genes used to identify subtypes according to the Moffitt classification are shown. G) Pie charts depict the number of cell lines with the classical and basal-like Moffitt subtypes. When comparing KPC; Smpd3 wt/wt PPT vs KPC; Smpd3 f/f PPT using Moffitt classification and Chi square test, p-value=0.0339.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: RNA Sequencing, Generated, Expressing, Comparison, Staining

Analysis of RNA sequencing data from murine polyclonal pancreatic cancer cell lines. A) Heat map showing Integrin Signaling in all three PPT cell lines. B) Estimated counts for select genes identified from Sleuth comparison of polyclonal cell lines from end-stage PPTs of KPC; Smpd3 wt/wt (n=8), KPC; Smpd3 f/wt (n=7), and KPC; Smpd3 f/f (n=10) mice are graphed. Each box plot represents the distribution of estimated counts quantified by kallisto with 100 bootstrap samples. For each gene, the most significant protein-coding isoforms are shown. C) The top twenty pathways from IPA comparing KPC; Smpd3 f/f MPT vs KPC; Smpd3 wt/wt MPT are shown. D) A heat map including significantly differentially regulated molecules in the Pentose Phosphate Pathway are shown for KPC; Smpd3 wt/wt MPT and KPC; Smpd3 f/f MPT groups. E) The six differentially regulated pathways when comparing KPC Smpd3 OE vs KPC Mock OE are shown. F) Log of transcript per million (TPM) values for Smpd3 gene are graphed for KPC Mock OE and KPC Smpd3 OE sequenced cell lines.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: Analysis of RNA sequencing data from murine polyclonal pancreatic cancer cell lines. A) Heat map showing Integrin Signaling in all three PPT cell lines. B) Estimated counts for select genes identified from Sleuth comparison of polyclonal cell lines from end-stage PPTs of KPC; Smpd3 wt/wt (n=8), KPC; Smpd3 f/wt (n=7), and KPC; Smpd3 f/f (n=10) mice are graphed. Each box plot represents the distribution of estimated counts quantified by kallisto with 100 bootstrap samples. For each gene, the most significant protein-coding isoforms are shown. C) The top twenty pathways from IPA comparing KPC; Smpd3 f/f MPT vs KPC; Smpd3 wt/wt MPT are shown. D) A heat map including significantly differentially regulated molecules in the Pentose Phosphate Pathway are shown for KPC; Smpd3 wt/wt MPT and KPC; Smpd3 f/f MPT groups. E) The six differentially regulated pathways when comparing KPC Smpd3 OE vs KPC Mock OE are shown. F) Log of transcript per million (TPM) values for Smpd3 gene are graphed for KPC Mock OE and KPC Smpd3 OE sequenced cell lines.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: RNA Sequencing, Comparison

K P C ; Smpd3 f/f pancreata display significantly fewer activated stellate cells and fibroblasts when compared to both KPC; Smpd3 f/wt and KPC; Smpd3 wt/wt pancreata. A) Immunofluorescence images depict co-labeling with alpha SMA, Gfap, Desmin, and Dapi in the pancreas of 10–11-week-old mice. For KPC; Smpd3 wt/wt , n=6 animals, KPC; Smpd3 f/wt , n=5 animals, and KPC; Smpd3 f/f , n=5 animals. Yellow arrows in insets point to examples of quadruple positive cells that were quantified in Panel C. Scale bar is 20uM. B) Immunofluorescence images depict co-labeling with alpha SMA, Fap, Vimentin, and Dapi in the pancreas of 10–11-week-old mice. Yellow arrows in insets point to examples of quadruple positive cells that were quantified in Panel D. For KPC; Smpd3 wt/wt , n=5 animals, KPC; Smpd3 f/wt , n=5 animals, KPC; Smpd3 f/f , n=6 animals. Scale bar is 50uM. C) Quantification of alpha SMA, Gfap, Desmin, and Dapi quadruple positive cells is depicted. D) Quantification of alpha SMA, Fap, Vimentin, and Dapi quadruple positive cells is depicted. E) Pie charts depict Moffitt classification PDA subtypes for KPC Mock OE and KPC Smpd3 OE cell lines.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: K P C ; Smpd3 f/f pancreata display significantly fewer activated stellate cells and fibroblasts when compared to both KPC; Smpd3 f/wt and KPC; Smpd3 wt/wt pancreata. A) Immunofluorescence images depict co-labeling with alpha SMA, Gfap, Desmin, and Dapi in the pancreas of 10–11-week-old mice. For KPC; Smpd3 wt/wt , n=6 animals, KPC; Smpd3 f/wt , n=5 animals, and KPC; Smpd3 f/f , n=5 animals. Yellow arrows in insets point to examples of quadruple positive cells that were quantified in Panel C. Scale bar is 20uM. B) Immunofluorescence images depict co-labeling with alpha SMA, Fap, Vimentin, and Dapi in the pancreas of 10–11-week-old mice. Yellow arrows in insets point to examples of quadruple positive cells that were quantified in Panel D. For KPC; Smpd3 wt/wt , n=5 animals, KPC; Smpd3 f/wt , n=5 animals, KPC; Smpd3 f/f , n=6 animals. Scale bar is 50uM. C) Quantification of alpha SMA, Gfap, Desmin, and Dapi quadruple positive cells is depicted. D) Quantification of alpha SMA, Fap, Vimentin, and Dapi quadruple positive cells is depicted. E) Pie charts depict Moffitt classification PDA subtypes for KPC Mock OE and KPC Smpd3 OE cell lines.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Immunofluorescence, Labeling

Analysis of lipidomics data from murine polyclonal pancreatic cancer cell lines. A) Heat map shows IPA Ceramide Signaling Pathway in all three PPT cell lines. B) Heat map shows differentially expressed lipids in comparisons amongst our murine polyclonal pancreatic cancer cell lines. Groups compared are listed as A-B where depicted upregulation or downregulation of a lipid would be in A when compared to B. C) Principal component analysis of our polyclonal murine pancreatic cancer cell lines based on lipid composition is depicted. D) Box plots showing expression of selected ceramide species in our KPC; Smpd3 wt/wt PPT, KPC; Smpd3 f/wt PPT, KPC; Smpd3 f/f PPT, KPC; Smpd3 wt/wt MPT, and KPC; Smpd3 f/f MPT cell lines. E) Box plots showing expression of selected phosphatidylcholine species in our KPC Mock OE and KPC Smpd3 OE cell lines.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: Analysis of lipidomics data from murine polyclonal pancreatic cancer cell lines. A) Heat map shows IPA Ceramide Signaling Pathway in all three PPT cell lines. B) Heat map shows differentially expressed lipids in comparisons amongst our murine polyclonal pancreatic cancer cell lines. Groups compared are listed as A-B where depicted upregulation or downregulation of a lipid would be in A when compared to B. C) Principal component analysis of our polyclonal murine pancreatic cancer cell lines based on lipid composition is depicted. D) Box plots showing expression of selected ceramide species in our KPC; Smpd3 wt/wt PPT, KPC; Smpd3 f/wt PPT, KPC; Smpd3 f/f PPT, KPC; Smpd3 wt/wt MPT, and KPC; Smpd3 f/f MPT cell lines. E) Box plots showing expression of selected phosphatidylcholine species in our KPC Mock OE and KPC Smpd3 OE cell lines.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Expressing

Characterization of exosomes isolated from KPC; Smpd3 wt/wt PPT and KPC; Smpd3 f/f PPT cell lines. A) CD63eGFP particles per cell are graphed for KPC; Smpd3 wt/wt CD63eGFP cell lines (n=6) and KPC; Smpd3 f/f CD63eGFP cell lines (n=6). B) Fractions were subjected to WB for sEV markers to determine the fractions that exosomes are contained within using the C-DGUC exosome isolation protocol. Expected band sizes are listed for each marker. C) The percentage of animals having PDA at end-stage in addition to the differentiation status of primary pancreatic tumors at end-stage is graphed for KPC; Smpd3 wt/wt uninjected mice (n=30), KPC; Smpd3 wt/wt mice injected with sEVs isolated from KPC; Smpd3 wt/wt PPT cell lines (n=15), KPC; Smpd3 wt/wt mice injected with sEVs isolated from KPC; Smpd3 f/f PPT cell lines (n=15), KPC; Smpd3 f/f uninjected mice (n=24), KPC; Smpd3 f/f mice injected with sEVs isolated from KPC; Smpd3 wt/wt PPT cell lines (n=9), and KPC; Smpd3 f/f mice injected with sEVs isolated from KPC; Smpd3 f/f PPT cell lines (n=9). Values plotted for uninjected mice are the same as those in . D) The percentage of animals having macrometastasis at end-stage in addition to the site of macrometastasis at end-stage is depicted for KPC; Smpd3 wt/wt uninjected mice (n=29), KPC; Smpd3 wt/wt mice injected with sEVs isolated from KPC; Smpd3 wt/wt PPT cell lines (n=14), KPC; Smpd3 wt/wt mice injected with sEVs isolated from KPC; Smpd3 f/f PPT cell lines (n=12), KPC; Smpd3 f/f uninjected mice (n=22), KPC; Smpd3 f/f mice injected with sEVs isolated from KPC; Smpd3 wt/wt PPT cell lines (n=8), and KPC; Smpd3 f/f mice injected with sEVs isolated from KPC; Smpd3 f/f PPT cell lines (n=9). Values plotted for uninjected mice are the same as those in . E) Pancreas weight/body weight is graphed for the indicated groups. Average values for uninjected KPC; Smpd3 wt/wt are 0.04396 ± 0.006112 (n=28), KPC; Smpd3 wt/wt injected with exosomes isolated from KPC; Smpd3 wt/wt are 0.05477 ± 0.007678 (n=15), and KPC; Smpd3 wt/wt injected with exosomes isolated from KPC; Smpd3 f/f are 0.06809 ± 0.009409 (n=16). F) Pancreas weight/body weight is graphed for the indicated groups. Average values for uninjected KPC; Smpd3 f/f are 0.05085 ± 0.005912, KPC; Smpd3 f/f injected with exosomes isolated from KPC; Smpd3 wt/wt are 0.06149 ± 0.01434, and KPC; Smpd3 f/f injected with exosomes isolated from KPC; Smpd3 f/f are 0.04654 ± 0.008279. G) Pancreas images at dissection for the indicated groups are depicted.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: Characterization of exosomes isolated from KPC; Smpd3 wt/wt PPT and KPC; Smpd3 f/f PPT cell lines. A) CD63eGFP particles per cell are graphed for KPC; Smpd3 wt/wt CD63eGFP cell lines (n=6) and KPC; Smpd3 f/f CD63eGFP cell lines (n=6). B) Fractions were subjected to WB for sEV markers to determine the fractions that exosomes are contained within using the C-DGUC exosome isolation protocol. Expected band sizes are listed for each marker. C) The percentage of animals having PDA at end-stage in addition to the differentiation status of primary pancreatic tumors at end-stage is graphed for KPC; Smpd3 wt/wt uninjected mice (n=30), KPC; Smpd3 wt/wt mice injected with sEVs isolated from KPC; Smpd3 wt/wt PPT cell lines (n=15), KPC; Smpd3 wt/wt mice injected with sEVs isolated from KPC; Smpd3 f/f PPT cell lines (n=15), KPC; Smpd3 f/f uninjected mice (n=24), KPC; Smpd3 f/f mice injected with sEVs isolated from KPC; Smpd3 wt/wt PPT cell lines (n=9), and KPC; Smpd3 f/f mice injected with sEVs isolated from KPC; Smpd3 f/f PPT cell lines (n=9). Values plotted for uninjected mice are the same as those in . D) The percentage of animals having macrometastasis at end-stage in addition to the site of macrometastasis at end-stage is depicted for KPC; Smpd3 wt/wt uninjected mice (n=29), KPC; Smpd3 wt/wt mice injected with sEVs isolated from KPC; Smpd3 wt/wt PPT cell lines (n=14), KPC; Smpd3 wt/wt mice injected with sEVs isolated from KPC; Smpd3 f/f PPT cell lines (n=12), KPC; Smpd3 f/f uninjected mice (n=22), KPC; Smpd3 f/f mice injected with sEVs isolated from KPC; Smpd3 wt/wt PPT cell lines (n=8), and KPC; Smpd3 f/f mice injected with sEVs isolated from KPC; Smpd3 f/f PPT cell lines (n=9). Values plotted for uninjected mice are the same as those in . E) Pancreas weight/body weight is graphed for the indicated groups. Average values for uninjected KPC; Smpd3 wt/wt are 0.04396 ± 0.006112 (n=28), KPC; Smpd3 wt/wt injected with exosomes isolated from KPC; Smpd3 wt/wt are 0.05477 ± 0.007678 (n=15), and KPC; Smpd3 wt/wt injected with exosomes isolated from KPC; Smpd3 f/f are 0.06809 ± 0.009409 (n=16). F) Pancreas weight/body weight is graphed for the indicated groups. Average values for uninjected KPC; Smpd3 f/f are 0.05085 ± 0.005912, KPC; Smpd3 f/f injected with exosomes isolated from KPC; Smpd3 wt/wt are 0.06149 ± 0.01434, and KPC; Smpd3 f/f injected with exosomes isolated from KPC; Smpd3 f/f are 0.04654 ± 0.008279. G) Pancreas images at dissection for the indicated groups are depicted.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Isolation, Marker, Injection, Dissection

PDA cell exosomes generated through nSMase2 accelerate PDA progression. A) Schematic of exosome injection study. B) Probability of survival for the indicated groups is graphed. Log-rank test was performed between the indicated groups. C-D) Volcano plot (C) and heat map (D) depict differentially expressed exosomal miRNAs isolated from KPC; Smpd3 f/f and KPC; Smpd3 wt/wt polyclonal PDA PPT cell lines. E) Exosomal protein abundance results for KPC; Smpd3 f/f versus KPC; Smpd3 wt/wt PPT cell lines are depicted. The x-axis shows the log2 fold change for KPC; Smpd3 f/f over KPC; Smpd3 wt/wt and the y-axis shows −log10(q-value). Significantly upregulated proteins (q-value < 0.05) are shown in green and significantly downregulated proteins are shown in red. F) Heatmap of top 40 differentially abundant exosomal proteins comparing KPC; Smpd3 f/f versus KPC; Smpd3 wt/wt , displaying log2 normalized expression. Red indicates lower abundance of a given protein in each sample and green indicates higher abundance. Rows and columns are arranged based on hierarchical clustering dendrograms (not displayed). The color bar at the top indicates the genotype. G) IPA results depict significantly differentially regulated pathways when comparing exosomal proteins from KPC; Smpd3 f/f versus KPC; Smpd3 wt/wt PPT cell lines.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: PDA cell exosomes generated through nSMase2 accelerate PDA progression. A) Schematic of exosome injection study. B) Probability of survival for the indicated groups is graphed. Log-rank test was performed between the indicated groups. C-D) Volcano plot (C) and heat map (D) depict differentially expressed exosomal miRNAs isolated from KPC; Smpd3 f/f and KPC; Smpd3 wt/wt polyclonal PDA PPT cell lines. E) Exosomal protein abundance results for KPC; Smpd3 f/f versus KPC; Smpd3 wt/wt PPT cell lines are depicted. The x-axis shows the log2 fold change for KPC; Smpd3 f/f over KPC; Smpd3 wt/wt and the y-axis shows −log10(q-value). Significantly upregulated proteins (q-value < 0.05) are shown in green and significantly downregulated proteins are shown in red. F) Heatmap of top 40 differentially abundant exosomal proteins comparing KPC; Smpd3 f/f versus KPC; Smpd3 wt/wt , displaying log2 normalized expression. Red indicates lower abundance of a given protein in each sample and green indicates higher abundance. Rows and columns are arranged based on hierarchical clustering dendrograms (not displayed). The color bar at the top indicates the genotype. G) IPA results depict significantly differentially regulated pathways when comparing exosomal proteins from KPC; Smpd3 f/f versus KPC; Smpd3 wt/wt PPT cell lines.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Generated, Injection, Isolation, Quantitative Proteomics, Expressing

sEVs generated independently of nSMase2 promote a proinflammatory macrophage phenotype. A) Heat map depicts scaled marker expression in KPC; Smpd3 wt/wt and KPC Smpd3 f/f pancreata using our 17-marker myeloid spectral flow cytometry panel. B) t-SNE of 200,683 cells stained with our spectral flow panel depict 12 clusters identified for KPC; Smpd3 wt/wt and KPC; Smpd3 f/f pancreata through FlowSOM clustering. C) Heat map of scaled marker expression and number of cells for clusters shown in B is displayed. D) Bar graphs depict percent cellular subpopulations from KPC; Smpd3 wt/wt and KPC; Smpd3 f/f pancreata for the indicated markers after gating in FlowJo. E) Immunofluorescence images depict co-labeling with F4/80, iNOS, and Dapi at 10-11 weeks of age. Scale bar is 20uM. F) Quantification of intralobular F4/80 + and iNOS + copositive cells in KPC; Smpd3 wt/wt (n=5 animals), KPC; Smpd3 f/wt (n=6 animals), and KPC; Smpd3 f/f (n=5 animals) pancreata at 10-11 weeks of age is depicted. G) Schematic of experiment to assess how nSMase2-mediated exosome biogenesis affects polarization of macrophages. H-J) RNA expression fold change in RAW 264.7 cells, with PBS treated normalized to 1, for each gene at the indicated time point and treatment condition is depicted. Results of unpaired t tests between groups shown at the time point written are depicted.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: sEVs generated independently of nSMase2 promote a proinflammatory macrophage phenotype. A) Heat map depicts scaled marker expression in KPC; Smpd3 wt/wt and KPC Smpd3 f/f pancreata using our 17-marker myeloid spectral flow cytometry panel. B) t-SNE of 200,683 cells stained with our spectral flow panel depict 12 clusters identified for KPC; Smpd3 wt/wt and KPC; Smpd3 f/f pancreata through FlowSOM clustering. C) Heat map of scaled marker expression and number of cells for clusters shown in B is displayed. D) Bar graphs depict percent cellular subpopulations from KPC; Smpd3 wt/wt and KPC; Smpd3 f/f pancreata for the indicated markers after gating in FlowJo. E) Immunofluorescence images depict co-labeling with F4/80, iNOS, and Dapi at 10-11 weeks of age. Scale bar is 20uM. F) Quantification of intralobular F4/80 + and iNOS + copositive cells in KPC; Smpd3 wt/wt (n=5 animals), KPC; Smpd3 f/wt (n=6 animals), and KPC; Smpd3 f/f (n=5 animals) pancreata at 10-11 weeks of age is depicted. G) Schematic of experiment to assess how nSMase2-mediated exosome biogenesis affects polarization of macrophages. H-J) RNA expression fold change in RAW 264.7 cells, with PBS treated normalized to 1, for each gene at the indicated time point and treatment condition is depicted. Results of unpaired t tests between groups shown at the time point written are depicted.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Generated, Marker, Expressing, Flow Cytometry, Staining, Immunofluorescence, Labeling, RNA Expression

Functional effects of PDA cell sEVs on macrophages. A) Immunofluorescence images depict co-labeling with F4/80, Ly6G, and Dapi at 10-11 weeks of age. For KPC; Smpd3 wt/wt , n=5 animals, KPC; Smpd3 f/wt , n=5 animals, and KPC; Smpd3 f/f , n=6 animals. Scale bar is 20uM. B) Quantification of interlobular F4/80 and Ly6G in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , and KPC; Smpd3 f/f pancreata at 10-11 weeks of age is depicted. C) Quantification of intralobular F4/80 and Ly6G in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , and KPC; Smpd3 f/f pancreata at 10-11 weeks of age is depicted. D-F) RNA expression fold change in RAW 264.7 cells, with PBS treated normalized to 1, for each gene at the indicated time point and treatment condition is depicted. Results of unpaired t tests between groups shown at the time point written are depicted.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: Functional effects of PDA cell sEVs on macrophages. A) Immunofluorescence images depict co-labeling with F4/80, Ly6G, and Dapi at 10-11 weeks of age. For KPC; Smpd3 wt/wt , n=5 animals, KPC; Smpd3 f/wt , n=5 animals, and KPC; Smpd3 f/f , n=6 animals. Scale bar is 20uM. B) Quantification of interlobular F4/80 and Ly6G in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , and KPC; Smpd3 f/f pancreata at 10-11 weeks of age is depicted. C) Quantification of intralobular F4/80 and Ly6G in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , and KPC; Smpd3 f/f pancreata at 10-11 weeks of age is depicted. D-F) RNA expression fold change in RAW 264.7 cells, with PBS treated normalized to 1, for each gene at the indicated time point and treatment condition is depicted. Results of unpaired t tests between groups shown at the time point written are depicted.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Functional Assay, Immunofluorescence, Labeling, RNA Expression

SMPD3 is an independent prognostic factor for pancreatic cancer patient survival. A) Log2 of the normalized counts are plotted for normal human pancreatic SMPD3 expression (n=39 samples) and primary PDA SMPD3 expression (n=39 samples). B) Log2 of the normalized counts are plotted for PPT SMPD3 expression (n=231 samples) and MPT SMPD3 expression (n=158 samples) in PDA patients. C) Kaplan-Meier survival curve of the whole cohort (N = 94) with the patients dichotomized into SMPD3 high and low expression based on the median mRNA expression value. SMPD3 high group had significantly better survival (median survival of 26.5 vs 15.0 months; P = 0.0364). A (0) value indicates a censored event and a (1) value indicates a death event. D) Kaplan-Meier survival curve of the subset of the whole cohort of patients who underwent adjuvant chemotherapy (> 95% single agent gemcitabine) after surgical resection (N = 58). SMPD3 expression was significantly associated with better survival (median survival of 34.3 vs 15.9 months; P = 0.0289) indicating SMPD3 is a biomarker of adjuvant gemcitabine response. E) Kaplan-Meier survival curve of the subset of the whole cohort of patients who did not undergo adjuvant chemotherapy after surgical resection (N = 36). SMPD3 expression was not associated with survival (P = 0.8001). F-G) Kaplan-Meier curves depict patient survival based on SMPD3 expression in locally advanced primaries or metastatic PDA from the COMPASS trial for patients who received chemotherapy with modified Folfirinox or Gemcitabine plus Abraxane. SMPD3 expression was stratified into high and low with low expression defined as the maximal chi-squared statistic. H) Log2 of SMPD3 expression by hypoxia status defined by . I) Log2 of SMPD3 expression in defined Waddell structural variation subtypes in COMPASS cases is depicted. J) Kaplan-Meier curves depict patient survival based on cytoplasmic and membranous nSMase2 expression in treatment naïve primary resected PDA. Tumor, and not stromal, cell nSMase2 expression was scored in 143 patients. When comparing survival of PDA patients with low cytoplasmic nSMase2 expression (n=89, mean survival=30.1 months) and high cytoplasmic nSMase2 expression (n=54, mean survival=29.1 months), p=0.627 using the log-rank test. When comparing survival of PDA patients with low membrane nSMase2 expression (n=65, mean survival=25.6 months) and high membrane nSMase2 expression (n=78, mean survival=32.9 months), p=0.052 using the log-rank test.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: SMPD3 is an independent prognostic factor for pancreatic cancer patient survival. A) Log2 of the normalized counts are plotted for normal human pancreatic SMPD3 expression (n=39 samples) and primary PDA SMPD3 expression (n=39 samples). B) Log2 of the normalized counts are plotted for PPT SMPD3 expression (n=231 samples) and MPT SMPD3 expression (n=158 samples) in PDA patients. C) Kaplan-Meier survival curve of the whole cohort (N = 94) with the patients dichotomized into SMPD3 high and low expression based on the median mRNA expression value. SMPD3 high group had significantly better survival (median survival of 26.5 vs 15.0 months; P = 0.0364). A (0) value indicates a censored event and a (1) value indicates a death event. D) Kaplan-Meier survival curve of the subset of the whole cohort of patients who underwent adjuvant chemotherapy (> 95% single agent gemcitabine) after surgical resection (N = 58). SMPD3 expression was significantly associated with better survival (median survival of 34.3 vs 15.9 months; P = 0.0289) indicating SMPD3 is a biomarker of adjuvant gemcitabine response. E) Kaplan-Meier survival curve of the subset of the whole cohort of patients who did not undergo adjuvant chemotherapy after surgical resection (N = 36). SMPD3 expression was not associated with survival (P = 0.8001). F-G) Kaplan-Meier curves depict patient survival based on SMPD3 expression in locally advanced primaries or metastatic PDA from the COMPASS trial for patients who received chemotherapy with modified Folfirinox or Gemcitabine plus Abraxane. SMPD3 expression was stratified into high and low with low expression defined as the maximal chi-squared statistic. H) Log2 of SMPD3 expression by hypoxia status defined by . I) Log2 of SMPD3 expression in defined Waddell structural variation subtypes in COMPASS cases is depicted. J) Kaplan-Meier curves depict patient survival based on cytoplasmic and membranous nSMase2 expression in treatment naïve primary resected PDA. Tumor, and not stromal, cell nSMase2 expression was scored in 143 patients. When comparing survival of PDA patients with low cytoplasmic nSMase2 expression (n=89, mean survival=30.1 months) and high cytoplasmic nSMase2 expression (n=54, mean survival=29.1 months), p=0.627 using the log-rank test. When comparing survival of PDA patients with low membrane nSMase2 expression (n=65, mean survival=25.6 months) and high membrane nSMase2 expression (n=78, mean survival=32.9 months), p=0.052 using the log-rank test.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Expressing, Adjuvant, Biomarker Discovery, Modification, Membrane

Pathways analysis of pancreatic nSMase2 expression in PDA patients based on treatment with chemotherapy in addition to the effect of nSMase2 expression on chemosensitivity and vasculature integrity. A) IPA bar chart results show the top 15 deregulated pathways when comparing PDA patients with high SMPD3 expression in treatment naïve PPTs vs low SMPD3 expression in treatment naïve PPTs receiving adjuvant chemotherapy. The threshold line represents statistical significance. B) IPA bar chart results show the top 15 deregulated pathways when comparing PDA patients with high SMPD3 expression in treatment naïve PPTs vs low SMPD3 expression in treatment naïve PPTs not receiving adjuvant chemotherapy. C) Representative images used to score the TMA for nSMase2 low and nSMase2 high membrane and cytoplasmic labeling. D) Images depict dextran and tomato lectin, a marker of blood vessels in mice, immunofluorescence at 10-11 weeks of age in KPC; Smpd3 wt/wt and KPC; Smpd3 f/f pancreases. E) Percent pancreatic neoplastic area per field occupied by dextran is graphed for KPC; Smpd3 wt/wt (n=8) and KPC; Smpd3 f/f (n=6) mice. F) Negative log of gemcitabine IC50 for KPC; Smpd3 wt/wt , KPC; Smpd3 f/f , KPC Mock OE, and KPC Smpd3 OE cell lines is graphed. G) Quantification of total HIF1α in nSMase2 high and nSMase2 low primary pancreatic tumors of PDA patients is depicted.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: Pathways analysis of pancreatic nSMase2 expression in PDA patients based on treatment with chemotherapy in addition to the effect of nSMase2 expression on chemosensitivity and vasculature integrity. A) IPA bar chart results show the top 15 deregulated pathways when comparing PDA patients with high SMPD3 expression in treatment naïve PPTs vs low SMPD3 expression in treatment naïve PPTs receiving adjuvant chemotherapy. The threshold line represents statistical significance. B) IPA bar chart results show the top 15 deregulated pathways when comparing PDA patients with high SMPD3 expression in treatment naïve PPTs vs low SMPD3 expression in treatment naïve PPTs not receiving adjuvant chemotherapy. C) Representative images used to score the TMA for nSMase2 low and nSMase2 high membrane and cytoplasmic labeling. D) Images depict dextran and tomato lectin, a marker of blood vessels in mice, immunofluorescence at 10-11 weeks of age in KPC; Smpd3 wt/wt and KPC; Smpd3 f/f pancreases. E) Percent pancreatic neoplastic area per field occupied by dextran is graphed for KPC; Smpd3 wt/wt (n=8) and KPC; Smpd3 f/f (n=6) mice. F) Negative log of gemcitabine IC50 for KPC; Smpd3 wt/wt , KPC; Smpd3 f/f , KPC Mock OE, and KPC Smpd3 OE cell lines is graphed. G) Quantification of total HIF1α in nSMase2 high and nSMase2 low primary pancreatic tumors of PDA patients is depicted.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Expressing, Adjuvant, Membrane, Labeling, Marker, Immunofluorescence

nSMase2 regulates PDA vasculature development. A-B) Heat maps showing VEGF Signaling and HIF1α Signaling pathways in all three PPT cell lines. C) Log of transcript per million (TPM) values for Vegfa gene are graphed for sequenced PPT cell lines. Wilcoxon test was performed. D) Pancreatic CD31 and CK19 immunolabeling at 19-21 weeks of age in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , and KPC; Smpd3 f/f mice is depicted. Scale bar is 20uM. E) Quantification of pancreatic CD31 immunofluorescence in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , and KPC; Smpd3 f/f mice is shown. F) Pancreatic CD31 and CK19 immunolabeling at 21 days post orthotopic injection of KPC LucFlag scrambled shRNA, KPC LucFlag Smpd3 shRNA 1, and KPC LucFlag Smpd3 shRNA 2 cell lines into Rag1 KO mice 21 days post injection is depicted. Scale bar is 20uM. G) Quantification of pancreatic CD31 immunofluorescence in Rag1 KO mice injected with KPC LucFlag scrambled shRNA, KPC LucFlag Smpd3 shRNA 1, and KPC LucFlag Smpd3 shRNA 2 cell lines 21 days post injection is depicted. H) Immunohistochemistry of CD31 in primary tumors from PDA patients is depicted with low and high nSMase2 expression. I) Percent CD31 positive area in primary nSMase2 low (n=19) and nSMase2 high (n=34) pancreatic tumors from PDA patients is shown. J) Immunohistochemistry of HIF1α is depicted in primary tumors from PDA patients with low and high nSMase2 expression. K) Percent nuclear HIF1α epithelial tumor cells in primary nSMase2 low (n=5) and nSMase2 high (n=6) PDA patient pancreatic tumors is shown. L) Ratio of pancreas weight to body weight for gemcitabine and vehicle treated Rag1 KO mice 21 days after pancreatic orthotopic injection of the depicted cell lines is shown. For KPC scrambled shRNA vehicle treated mice, n=4, for KPC scrambled shRNA gemcitabine treated mice, n=9, for KPC Smpd3 shRNA 1 vehicle treated mice, n=10, for KPC Smpd3 shRNA 1 gemcitabine treated mice, n=10, for KPC Smpd3 shRNA 2 vehicle treated mice, n=10, and for KPC Smpd3 shRNA 2 gemcitabine treated mice, n=10. M) Kaplan-Meier survival curves show probability of survival for vehicle-injected KPC; Smpd3 wt/wt mice (n=12, median survival=20.29 weeks), gemcitabine-injected KPC; Smpd3 wt/wt mice (n=19, median survival=23.43 weeks), vehicle-injected KPC; Smpd3 f/f mice (n=15, median survival=23.29 weeks), gemcitabine-injected KPC; Smpd3 f/f mice (n=16, median survival=19.86 weeks). A black line indicates a censored animal.

Journal: bioRxiv

Article Title: nSMase2-mediated exosome secretion shapes the tumor microenvironment to immunologically support pancreatic cancer

doi: 10.1101/2024.09.23.614610

Figure Lengend Snippet: nSMase2 regulates PDA vasculature development. A-B) Heat maps showing VEGF Signaling and HIF1α Signaling pathways in all three PPT cell lines. C) Log of transcript per million (TPM) values for Vegfa gene are graphed for sequenced PPT cell lines. Wilcoxon test was performed. D) Pancreatic CD31 and CK19 immunolabeling at 19-21 weeks of age in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , and KPC; Smpd3 f/f mice is depicted. Scale bar is 20uM. E) Quantification of pancreatic CD31 immunofluorescence in KPC; Smpd3 wt/wt , KPC; Smpd3 f/wt , and KPC; Smpd3 f/f mice is shown. F) Pancreatic CD31 and CK19 immunolabeling at 21 days post orthotopic injection of KPC LucFlag scrambled shRNA, KPC LucFlag Smpd3 shRNA 1, and KPC LucFlag Smpd3 shRNA 2 cell lines into Rag1 KO mice 21 days post injection is depicted. Scale bar is 20uM. G) Quantification of pancreatic CD31 immunofluorescence in Rag1 KO mice injected with KPC LucFlag scrambled shRNA, KPC LucFlag Smpd3 shRNA 1, and KPC LucFlag Smpd3 shRNA 2 cell lines 21 days post injection is depicted. H) Immunohistochemistry of CD31 in primary tumors from PDA patients is depicted with low and high nSMase2 expression. I) Percent CD31 positive area in primary nSMase2 low (n=19) and nSMase2 high (n=34) pancreatic tumors from PDA patients is shown. J) Immunohistochemistry of HIF1α is depicted in primary tumors from PDA patients with low and high nSMase2 expression. K) Percent nuclear HIF1α epithelial tumor cells in primary nSMase2 low (n=5) and nSMase2 high (n=6) PDA patient pancreatic tumors is shown. L) Ratio of pancreas weight to body weight for gemcitabine and vehicle treated Rag1 KO mice 21 days after pancreatic orthotopic injection of the depicted cell lines is shown. For KPC scrambled shRNA vehicle treated mice, n=4, for KPC scrambled shRNA gemcitabine treated mice, n=9, for KPC Smpd3 shRNA 1 vehicle treated mice, n=10, for KPC Smpd3 shRNA 1 gemcitabine treated mice, n=10, for KPC Smpd3 shRNA 2 vehicle treated mice, n=10, and for KPC Smpd3 shRNA 2 gemcitabine treated mice, n=10. M) Kaplan-Meier survival curves show probability of survival for vehicle-injected KPC; Smpd3 wt/wt mice (n=12, median survival=20.29 weeks), gemcitabine-injected KPC; Smpd3 wt/wt mice (n=19, median survival=23.43 weeks), vehicle-injected KPC; Smpd3 f/f mice (n=15, median survival=23.29 weeks), gemcitabine-injected KPC; Smpd3 f/f mice (n=16, median survival=19.86 weeks). A black line indicates a censored animal.

Article Snippet: Removal of the Neomycin and lacZ cassettes in Smpd3 floxed mice was confirmed by genotyping with Transnetyx.

Techniques: Protein-Protein interactions, Immunolabeling, Immunofluorescence, Injection, shRNA, Immunohistochemistry, Expressing

KEY RESOURCES TABLE

Journal: Developmental cell

Article Title: Single-Cell and Population-Level Analyses Using Real-Time Kinetic Labeling Couples Proliferation and Cell Death Mechanisms

doi: 10.1016/j.devcel.2019.08.016

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins ABT-737 Selleck Chemicals Cat#: S1002 mTNFα Peprotech Cat#: 315-01A mTRAIL Peprotech Cat#: 315-19 STYO21 Thermo Fisher Scientific Cat#: S7556 YOYO-3 Iodide Thermo Fisher Scientific Cat#: Y3606 zVAD-fmk APExBIO Cat#: A1902 Experimental Models: Cell Lines Bax +/+ Bak +/+ SV40 transformed MEF ATCC Cat#: CRL-2907; RRID: CVCL_U630 Bax −/− Bak −/− SV40 transformed MEF ATCC Cat#: CRL-2913; RRID: CVCL_U626 Cyld −/− SV40 transformed MEF Adrian Ting (Icahn School of Medicine at Mount Sinai, NY, USA) O’Donnell et al., 2011 Mlkl −/− adult ear fibroblasts Warren Alexander (University of Melbourne, Melbourne, Australia) Murphy et al., 2013 Recombinant DNA pProEx.Htb.annexinV Seamus Martin (Trinity College, Dublin, Ireland) Accession#: {"type":"entrez-nucleotide","attrs":{"text":"NM_001154","term_id":"1519243621","term_text":"NM_001154"}} NM_001154 ; Logue et al., 2009 Software and Algorithms Excel v16.16.9 Microsoft N/A ImageJ/Fiji v2.0.0-rc-69/1.52n National Institutes of Health N/A IncuCyte ZOOM v2018A Essen Biosciences N/A Prism v8.1.1 Graphpad Software N/A Sequential labeling pipeline This paper https://doi.org/10.5281/zenodo.3458574 Open in a separate window KEY RESOURCES TABLE SPARKL workflows use live-cell imagers to capture the kinetics of cell death in real time Multi-parametric analyses of cell death kinetics reveal mechanisms for comparative study Multiplex workflows accounts for cell-inherent or drug-induced proliferation changes Single-cell analyses quantify differential response to drugs in isogenic cell populations

Techniques: Recombinant, Transformation Assay, Software, Labeling

Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 1. MLH1 Deficiency Activates Innate Immune Signaling Pathway (A) Detection of cytosolic DNA in WT, Mlh1/ 4T1, and Mlh1-rescued (Rescd) 4T1 cells treated with or without IR, as indicated. DNA was detected using the PicoGreen fluorescence dye selectively binding dsDNA. Arrows point to cytosolic DNA. The scale bars are 10 mm. (B) Percentage of cells displaying cytosolic DNA with and without IR treatment. (C) Western blot analysis showing prolonged gH2AX in Mlh1/, but not in WT and Mlh1-rescued 4T1 cells after IR treatment. (D) Quantification of relative gH2AX levels in various 4T1 cells. (E) Increased production of cGAMP in Mlh1/ 4T1 cells. (F) Western blots showing enhanced phosphorylation of STING (pSTING) and STAT1 (pSTAT1) induced by IR in Mlh1/ cells. (G and H) Quantification of relative levels of pSTING (G) and pSTAT1 (H). (I) qRT-PCR analysis showing increased production of Isg15 in Mlh1/ cells. (J and K) Western blots (J) and qRT-PCR (K) showing that immune signaling induced by MLH1 deficiency depends on cGAS. When present, ‘‘’’ indicates untreated cells. Data represent the mean ± SEM of three independent experiments (B, D, G, and H) or three replicates (E, I, and K). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Binding Assay, Western Blot, Phospho-proteomics, Quantitative RT-PCR

Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 2. Exo1 is Essential for Innate Sensing Signaling in Mlh1–/– 4T1 Cells (A) Depletion of Exo1 reduces cytosolic DNA accumulation in Mlh1/ cells regardless of IR treatment. (B) Western blots showing reduced DNA breaks and pSTAT1 when Exo1 was depleted from Mlh1/ cells. A non-specific band detected by an Exo1 antibody is indicated by an asterisk. (C) Quantification of the relative gH2AX levels in Mlh1 knockout and Mlh1-Exo1 double-knockout (Dbl KO) cells. (D) Western blots showing that Exo1 knockout abolishes IR-induced STING activation. (E) Quantification of relative pSTING levels in Mlh1- knockout and Mlh1-Exo1 Dbl KO cells. (F) qRT-PCR analysis showing that Exo1 depletion suppressed expression of Isg15. Data represent the mean ± SEM of three inde- pendent experiments (A, C, and E) or three repli- cates (F). p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Western Blot, Knock-Out, Double Knockout, Activation Assay, Quantitative RT-PCR, Expressing

Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 3. MutLa Regulates Exo1 Nuclease Activity (A) Diagram of major functional domains in Exo1. (B) Co-immunoprecipitation/western blot analysis of MutLa interactions with WT and mutant Exo1 (right) using purified proteins (left). (C) Southern blot analysis determining the impact of the MutLa–Exo1 interaction on mismatch-provoked excision in a purified MMR system. The excision products were digested with SspI and processed for Southern blot analysis, as described in STAR Methods. Schematic representation of the 50 G-T heteroduplex after SspI digestion is shown on the right side of the gel. Positions of the nick and mismatch (red asterisk) are 544 bp and 416 bp away, respectively, from the bottom SspI site. Red bar indicates the 32P-labeled oligonucleotide probe, which is complementary to the nicked strand near the bottom SspI site. Red bracket shows mismatch-provoked excision products terminated upon mismatch removal in reactions with WT Exo1 but not in those with Exo1-FF-AA. (D) In vitro end-resection assay to determine the impact of the MutLa-Exo1 interaction on Exo1-catalyzed resection using purified proteins and a linearized 2.7-kb pUC19 plasmid DNA. MutLa concentration was 1 pmol (lower) or 4 pmol (higher). (E) Percentage of end-resection product II shown in (D) in three independent assays. (F) In vitro end-resection assay to determine the role of RPA in Exo1-catalyzed resection. The MutLa concentrations used in titration were 1 pmol, 2 pmol and 4 pmol. (G) Principle of in vivo end-resection assay. (H) qPCR analysis determining the amount of ssDNA generated at a specific DBS site (AsiSI) in WT and MLH1/ U2OS cells. Data represent the mean ± SEM of three independent experiments (E) or three replicates (H). p values were calculated using one-way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activity Assay, Functional Assay, Immunoprecipitation, Western Blot, Mutagenesis, Southern Blot, Labeling, In Vitro, Resection Assay, Plasmid Preparation, Concentration Assay, Titration, In Vivo, Generated

Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 4. Exo1 Recruitment, Abundance, and Stability in MLH1–/– Cells (A) Live cell imaging showing real-time recruitment and retention dynamics of GFP-tagged Exo1 after laser microirradiation in WT and MLH1/ HeLa cells. The scale bars are 5 mm. (B) Quantification of GFP-tagged Exo1 levels from the indicated number of cells. (C) Western blots showing whole cell lysate (WCL) and chromatin-bound levels of Exo1 and phos- phorylated Exo1 (pExo1) in WT and MLH1/ HeLa cells. (D) Quantification of relative total Exo1 levels in WT and MLH1/ HeLa cells. (E) Western blots showing WCL levels of Exo1 in WT and MLH1/ U2OS cells. (F) RNA-sequencing data from the TCGA database showing significantly higher Exo1 expression in dMLH1 tumors than in MSS tumors. (G) Quantification of relative pExo1 levels in WCL (upper) and on chromatin (lower) in WT and MLH1/ HeLa cells. Data represent the mean ± SEM of three inde- pendent experiments. p values were calculated using one-way ANOVA. ****p < 0.0001. See also Figure S3.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Live Cell Imaging, Western Blot, RNA Sequencing, Expressing

Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 5. RPA Exhaustion and Aberrant Resection Intermediates in MLH1–/– Cells (A) Microscope imaging showing BrdU incorporation by DNA polymerase using hype-resection-generated unprotected RPA as a template for DNA synthesis in the RPA exhaustion assay. ssDNA binding by phosphorylated RPA (pRPA) is also shown. (B and C) Quantification of BrdU foci/cell (B) and percentage of cells exhibiting BrdU foci (C) in WT and MLH1/ U2OS cells. (D) Quantification of pRPA foci per cell. (E) Western blots detecting pRPA and its association with DNA break marker gH2AX in the indicated cells before and after IR. (F) Quantification of relative pRPA levels shown in (E), with three independent assays. (G) Immunofluorescence confocal analysis showing large RPA foci in HeLa MLH1/ cells. (H) Quantification and comparison of the percentage of WT and MLH1/ cells displaying RPA foci. (I) Immunofluorescence confocal analysis showing large Rad51 foci in MLH1/ HeLa cells. (J) Quantification of RAD51 foci/nucleus in various HeLa cells, as indicated. (K) Immunofluorescence confocal analysis showing large Rad51 foci in HCT116 and MLH1-rescued HCT116 cells. Data represent the mean ± SEM of three independent experiments (C, F, and H) or the indicated number of cells (B, D, and J). p values were calculated using one- way ANOVA. **p < 0.01; ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Microscopy, Imaging, BrdU Incorporation Assay, Generated, DNA Synthesis, Binding Assay, Western Blot, Marker, Comparison

Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 6. Chromosomal Abnormalities in MLH1–/– Cells (A–D) Chromosomal spreading analysis to deter- mine metaphase chromosomal breaks and other aberrations in 4T1 cells (A and C) and Mlh1/ 4T1 cells (B and D) with (C and D) and without (A and B) IR treatment. Chromosome breaks are indicated by green arrows while unresolved chromosomes are indicated by blue arrows. (E) Percentage of WT and Mlh1/ 4T1 cells con- taining the indicated number of chromosome ab- normalities. (F and G) Average number of chromosomal ab- normalities in WT and Mlh1/ 4T1 (F) and HeLa (G) cells. (H) Average number of chromosomal abnormal- ities in HCT116 and MLH1-rescued HCT116 cells. ***p < 0.001; ****p < 0.0001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques:

Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.

Journal: Cancer cell

Article Title: MLH1 Deficiency-Triggered DNA Hyperexcision by Exonuclease 1 Activates the cGAS-STING Pathway.

doi: 10.1016/j.ccell.2020.11.004

Figure Lengend Snippet: Figure 7. Model for MLH1–/–-Mediated cGAS Activation and Immunotherapy MutLa (MLH1-PMS2) properly terminates Exo1- catalyzed end resection, which facilitates DSB repair by HR (left). However, depleting MLH1 de- prives cells of MutLa, allowing Exo1 to conduct uncontrolled excision. This hyper-resection gen- erates a large quantity of ssDNA that exhausts the RPA pool, leaving the ssDNA chain unprotected. The unprotected ssDNA can be digested or nicked by various nucleases in the nucleus, which leads to abnormal recombination intermediates and chro- mosome breaks. The latter can trigger cells to degrade a part or all of the damaged chromosome to release nuclear DNA into the cytoplasm, acti- vating the cGAS-STING pathway and the down- stream immune responses. Together with the large number of neoantigens generated from mutations caused by MLH1 deficiency, the immune signaling activated by Exo1 hyper-resection facilitates immunotherapy.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HeLa ATCC Cat# 60,005; RRID:CVCL_0030 HCT116 ATCC Cat# KCB 200706YJ; RRID:CVCL_0291 ER-AsiSI-U2OS (Zhou et al., 2014) NA Oligonucleotides Mouse Isg15 forward: 50- GAGCTAGAGCCTGCAGCAAT-30 This paper NA Mouse Isg15 reverse: 50- TCACGGACACCAGGAAATCG-30 This paper NA Mouse Irf7 forward: 50- TTGGGCAAGACTTGTCAGCA-30 This paper NA Mouse Irf7 reverse: 50- ATACCCATGGCTCCAGCTTC-30 This paper NA Mouse Gapdh forward: 50- CAACTGCTTAGCCCCCCTGG-30 This paper NA Mouse Gapdh reverse: 50- GCAGGGTAAGATAAGAAATG-30 This paper NA DSB1-335 forward: 50- GAATCGGATGTATGCGACTGATC-30 This paper NA DSB1-335 reverse: 50- TTCCAAAGTTATTCCAACCCGAT-30 This paper NA DSB1-335 probe: 6FAMCACAGCTTGCCCATCCTTGCAAACC-TAMRA This paper NA DSB1-1618 forward: 50- TGAGGAGGTGACATTAGAACTCAGA-30 This paper NA DSB1-1618 reverse: 50- AGGACTCACTTACACGGCCTTT-30 This paper NA DSB1-1618 probe: 6FAMTTGCAAGGCTGCTTCCTTACCATTCAA-TAMRA This paper NA DSB1-3500 forward: 50- TCCTAGCCAGATAATAATAGCTATACAAACA30 This paper NA DSB1-3500 reverse: 50-TGAATAGACAGACAACAG-30 This paper NA DSB1-3500 probe: 6FAMACCCTGATCAGCCTTTCCATGGGTTAAG-TAMRA This paper NA Recombinant DNA pLentiCRISPR v2 (Sanjana et al., 2014) Addgene Plasmid Cat#52961 pSpCas9(BB)-2A-GFP (PX458) (Hmelo et al., 2015) Addgene Plasmid Cat #48138 pCMV6-Entry-mouse Mlh1 Origene Cat#: MR210511 pEGFP-N1-Exo1 This paper NA pLVX-CMV-human MLH1 This paper NA Software and Algorithms GraphPad Prism software 8.0 GraphPad Software NA Carl Zeiss Axiovision software v4.91 Carl Zeiss NA Carl Zeiss ZEN lite software Carl Zeiss NA ImageJ software NIH NA the LAS X software Leica NA Cancer Cell 39, 1–13.e1–e5, January 11, 2021 e2

Techniques: Activation Assay, Immunopeptidomics, Generated

Functional analysis of human fetal and adult single-donor human renal vascular-tubular units (hRVTU). A) hRVTU created from human fetal renal cortical epithelial cells and kidney microvascular endothelial cells from the same donor sets were used for permeability assessment. Texas Red-labeled 70 kDa dextran was perfused into the epithelial channel during real-time imaging with 10 µm FITC-labeled 70 kDa dextran perfused into the endothelial 2 minutes later. (i) Epithelial channel is shown ~1 minute into perfusion and (ii) endothelial channel ~3 minutes into perfusion. (ii and iv) Fluorescent intensity over distance was calculated for the ROI shown in each image (dashed yellow lines) at two time-points using imageJ software (U.S. National Institute of Health, Bethesda, Maryland), demonstrating relatively little increase in width during the measured period. B) Blood from healthy volunteers was perfused into the endothelial channel of a hRVTU constructed as in A, under real-time imaging. No blood components can be seen within epithelial channels throughout ten minutes of blood perfusion. Left panel at 4× magnification, right panel at 10× magnification. C) hRVTU were created from adult renal cortical epithelial cells and human kidney microvascular endothelial cells from the same donor sets. After four days in culture device epithelial inlets were perfused with rhodamine-labeled human serum albumin and FITC-labeled inulin under real-time imaging. Following perfusion, devices were decellularized with trypsin, and perfusion repeated as an internal control. (i) Devices shown 15 minutes into perfusion show albumin (red) accumulating within cells. Yellow arrows highlight intracellular albumin accumulation within cells both on the top and side walls of vessels. (ii) Magnified image of a channel 30 minutes into perfusion shows albumin accumulating within cells, while inulin (iii) is not seen to accumulate intracellularly. Effluent was collected at one hour and run on a spectrophotometer, with albumin reabsorption calculated as noted in the main text. A two-tailed paired T test was done comparing albumin reabsorption in cellularized versus decellularized vessels (n = 3, bars indicate SEM and ** indicates P < 0.01).

Journal: Advanced healthcare materials

Article Title: Reconstructing the Human Renal Vascular-Tubular Unit in Vitro

doi: 10.1002/adhm.201801120

Figure Lengend Snippet: Functional analysis of human fetal and adult single-donor human renal vascular-tubular units (hRVTU). A) hRVTU created from human fetal renal cortical epithelial cells and kidney microvascular endothelial cells from the same donor sets were used for permeability assessment. Texas Red-labeled 70 kDa dextran was perfused into the epithelial channel during real-time imaging with 10 µm FITC-labeled 70 kDa dextran perfused into the endothelial 2 minutes later. (i) Epithelial channel is shown ~1 minute into perfusion and (ii) endothelial channel ~3 minutes into perfusion. (ii and iv) Fluorescent intensity over distance was calculated for the ROI shown in each image (dashed yellow lines) at two time-points using imageJ software (U.S. National Institute of Health, Bethesda, Maryland), demonstrating relatively little increase in width during the measured period. B) Blood from healthy volunteers was perfused into the endothelial channel of a hRVTU constructed as in A, under real-time imaging. No blood components can be seen within epithelial channels throughout ten minutes of blood perfusion. Left panel at 4× magnification, right panel at 10× magnification. C) hRVTU were created from adult renal cortical epithelial cells and human kidney microvascular endothelial cells from the same donor sets. After four days in culture device epithelial inlets were perfused with rhodamine-labeled human serum albumin and FITC-labeled inulin under real-time imaging. Following perfusion, devices were decellularized with trypsin, and perfusion repeated as an internal control. (i) Devices shown 15 minutes into perfusion show albumin (red) accumulating within cells. Yellow arrows highlight intracellular albumin accumulation within cells both on the top and side walls of vessels. (ii) Magnified image of a channel 30 minutes into perfusion shows albumin accumulating within cells, while inulin (iii) is not seen to accumulate intracellularly. Effluent was collected at one hour and run on a spectrophotometer, with albumin reabsorption calculated as noted in the main text. A two-tailed paired T test was done comparing albumin reabsorption in cellularized versus decellularized vessels (n = 3, bars indicate SEM and ** indicates P < 0.01).

Article Snippet: Imaging was performed on a Nikon A1R confocal microscope with image analysis conducted in ImageJ software [ 49 ] (U.S. National Institute of Health, Bethesda, Maryland) and three-dimensional rendering performed using Imaris software (Bitplane).

Techniques: Functional Assay, Permeability, Labeling, Imaging, Software, Construct, Control, Spectrophotometry, Two Tailed Test

Pep42-BBZ CAR-T cells showed antitumor activity in vivo. A Schematic in the top panel illustrates the experiment design for the U-251MG xenograft tumors. NCG mice was inoculated subcutaneously with 5 × 10 6 luciferase-expressing U-251MG cells. Five days later mock-BBZ and Pep42-BBZ CAR-T cells (1 × 10 7 per mouse) were injected intravenously into tail veins. The tumors growth was monitored once a week. B A representative image of csGRP78 staining of xenograft tumor sections by IF. Five days after tumor cells inoculation, tumor tissues were extracted and cell surface IF was performed for GRP78. Control was stained without GRP78 antibody. C The tumor bioluminescence images by IVIS imaging. D Tumor bioluminescence intensity curves for the two groups. E Representative CD3 staining of tumor sections by IF. Five-days post injection, 3 tumors from each group were extracted, embedded in paraffin, sectioned, and stained with CD3ζ antibody coupled with Cy3-conjunctated secondary antibodies. Two representative images are included from each group. F The statistics and representatives of CD4 and CD8 staining on Pep42-BBZ CAR-T treated tumor sample sections. The numbers of FITC labeled-CD4 and Cy3 labeled-CD8 were calculated and performed for percentage counting. G Representative NESTIN staining of tumor sections by IF. Five-days post injection, 3 tumors from each group were extracted, embedded in paraffin, sectioned, and stained with NESTIN antibodies coupled with Cy3-conjunctated secondary antibodies. Two representative images from each group are shown. Scale bar = 100 μm

Journal: Journal of Translational Medicine

Article Title: Chimeric antigen receptor T cells targeting cell surface GRP78 efficiently kill glioblastoma and cancer stem cells

doi: 10.1186/s12967-023-04330-0

Figure Lengend Snippet: Pep42-BBZ CAR-T cells showed antitumor activity in vivo. A Schematic in the top panel illustrates the experiment design for the U-251MG xenograft tumors. NCG mice was inoculated subcutaneously with 5 × 10 6 luciferase-expressing U-251MG cells. Five days later mock-BBZ and Pep42-BBZ CAR-T cells (1 × 10 7 per mouse) were injected intravenously into tail veins. The tumors growth was monitored once a week. B A representative image of csGRP78 staining of xenograft tumor sections by IF. Five days after tumor cells inoculation, tumor tissues were extracted and cell surface IF was performed for GRP78. Control was stained without GRP78 antibody. C The tumor bioluminescence images by IVIS imaging. D Tumor bioluminescence intensity curves for the two groups. E Representative CD3 staining of tumor sections by IF. Five-days post injection, 3 tumors from each group were extracted, embedded in paraffin, sectioned, and stained with CD3ζ antibody coupled with Cy3-conjunctated secondary antibodies. Two representative images are included from each group. F The statistics and representatives of CD4 and CD8 staining on Pep42-BBZ CAR-T treated tumor sample sections. The numbers of FITC labeled-CD4 and Cy3 labeled-CD8 were calculated and performed for percentage counting. G Representative NESTIN staining of tumor sections by IF. Five-days post injection, 3 tumors from each group were extracted, embedded in paraffin, sectioned, and stained with NESTIN antibodies coupled with Cy3-conjunctated secondary antibodies. Two representative images from each group are shown. Scale bar = 100 μm

Article Snippet: Tumor growth was monitored once a week using an in vivo imaging software (IVIS) system (Lumina Xr, PerkinElmer, USA).

Techniques: Activity Assay, In Vivo, Luciferase, Expressing, Injection, Staining, Control, Imaging, Labeling