il6 Search Results


86
Jackson Laboratory jackson laboratory il6 r mutant
Jackson Laboratory Il6 R Mutant, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/il6+jackson+laboratory+mutant+r/pmc12315988__sciadv%2Eads3530_sm-92-35-35
Average 86 stars, based on 1 article reviews
jackson laboratory il6 r mutant - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Jackson Laboratory jackson laboratory il6 f common
Jackson Laboratory Il6 F Common, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/common+f+il6+jackson+laboratory/pmc12315988__sciadv%2Eads3530_sm-92-25-25
Average 86 stars, based on 1 article reviews
jackson laboratory il6 f common - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Procell Inc il 6
Il 6, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/6+il/pm38493291-90-30-32
Average 86 stars, based on 1 article reviews
il 6 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Jackson Laboratory jackson laboratory il6 r wt
Jackson Laboratory Il6 R Wt, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/il6+jackson+laboratory+r+wt/pmc12315988__sciadv%2Eads3530_sm-92-30-30
Average 86 stars, based on 1 article reviews
jackson laboratory il6 r wt - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Eurofins il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha
Il 6 Nm 031168 Probe Eurofins 50cagataagctggagtcacagaaggagtgg 30 Tnf Alpha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/031168+30+50cagataagctggagtcacagaaggagtgg+6+alpha+eurofins+il+nm+probe+tnf/pm30995475-232-95-98
Average 86 stars, based on 1 article reviews
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

96
R&D Systems il 6 d6050
Il 6 D6050, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/Human+IL-6+Quantikine+ELISA+Kit/pmc03628221-151-10-4
Average 96 stars, based on 1 article reviews
il 6 d6050 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

97
R&D Systems cold air 827 il 6
Cold Air 827 Il 6, supplied by R&D Systems, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/Recombinant+Human+IL-6+Protein/pm09817153-91-12-16
Average 97 stars, based on 1 article reviews
cold air 827 il 6 - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

99
R&D Systems il 6 duoset elisa kit
α-LA inhibits the expression of pro-inflammatory cytokines in LPS-treated BV-2 microglial cells. (A) Effects of α-LA on cell viability. BV-2 microglial cells were incubated with LPS (1 μg/ml) for 30 min followed by treatment with the indicated concentrations of α-LA for 24 h. Thereafter, cell viability was assessed through the MTT assay. (B and C) BV-2 microglial cells were treated with LPS (1 μg/ml) for 30 min followed by treatment with the indicated concentrations of α-LA at the suggested times. The cell-free conditioned culture medium was collected and analyzed with <t>ELISA</t> for TNF-α, IL-6. Data from three independent experiments are presented as means ± S.D. *≤ 0.05, **< 0.01, ***< 0.001 and are related to both LPS-induced cells and α-LA treated cells.
Il 6 Duoset Elisa Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/Mouse+IL-6+DuoSet+ELISA/pmc06827572-73-18-22
Average 99 stars, based on 1 article reviews
il 6 duoset elisa kit - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

94
R&D Systems goat polyclonal anti il 6
α-LA inhibits the expression of pro-inflammatory cytokines in LPS-treated BV-2 microglial cells. (A) Effects of α-LA on cell viability. BV-2 microglial cells were incubated with LPS (1 μg/ml) for 30 min followed by treatment with the indicated concentrations of α-LA for 24 h. Thereafter, cell viability was assessed through the MTT assay. (B and C) BV-2 microglial cells were treated with LPS (1 μg/ml) for 30 min followed by treatment with the indicated concentrations of α-LA at the suggested times. The cell-free conditioned culture medium was collected and analyzed with <t>ELISA</t> for TNF-α, IL-6. Data from three independent experiments are presented as means ± S.D. *≤ 0.05, **< 0.01, ***< 0.001 and are related to both LPS-induced cells and α-LA treated cells.
Goat Polyclonal Anti Il 6, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/Human+IL-6+Antibody/pm38012402-400-41-44
Average 94 stars, based on 1 article reviews
goat polyclonal anti il 6 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
R&D Systems il6 blocking antibody ab206na
LIF hierarchically regulates STAT3 phosphorylation, <t>IL6</t> expression, and cell proliferation in EAC cells. SiRNA-mediated silencing of LIF expression results in reduced LIF mRNA ( A ) expression, ( B ) secretion, and ( C ) a recombinant-recoverable reduction in cell proliferation in CP-D, SKGT4, and OE-33 EAC cell lines. Treatment of LIF silenced cells with recombinant LIF protein (rLIF) results in ( D ) recovery of LIF mRNA in CP-D, SKGT4, and OE33 EAC cells and ( E ) protein expression levels in SKGT4 EAC cells. ( F ) STAT3-Y705 phosphorylation levels in LIF-silenced SKGT4 EAC cells are rescued by treatment with recombinant LIF protein as determined by Western blot. ( G ) Silencing LIF expression in SKGT4 EAC cells results in decreased IL6 mRNA expression that is recovered upon exposure to rLIF protein. ( H ) Neither silencing IL6 expression by siRNA-mediated silencing nor treatment with anti-IL6 antibody affects LIF mRNA levels or SKGT4 EAC cell growth. ( I ) Silencing LIF expression results in decreased expression of C1QA mRNA but not TREM2 in SKGT4 EAC cells. ∗ P < .05, ** P < .01, *** P < .001, and **** P < .0001 in either Student t test (proliferation) or Mann–Whitney testing (mRNA expression). siNT, nontargeting siRNA pool; siLIF, LIF-targeted siRNA pool; rLIF, recombinant LIF protein; rIL6, recombinant IL6 protein.
Il6 Blocking Antibody Ab206na, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/Human+IL-6+Antibody/pmc06009761-15-26-14
Average 94 stars, based on 1 article reviews
il6 blocking antibody ab206na - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
R&D Systems goat anti rat il 6
LIF hierarchically regulates STAT3 phosphorylation, <t>IL6</t> expression, and cell proliferation in EAC cells. SiRNA-mediated silencing of LIF expression results in reduced LIF mRNA ( A ) expression, ( B ) secretion, and ( C ) a recombinant-recoverable reduction in cell proliferation in CP-D, SKGT4, and OE-33 EAC cell lines. Treatment of LIF silenced cells with recombinant LIF protein (rLIF) results in ( D ) recovery of LIF mRNA in CP-D, SKGT4, and OE33 EAC cells and ( E ) protein expression levels in SKGT4 EAC cells. ( F ) STAT3-Y705 phosphorylation levels in LIF-silenced SKGT4 EAC cells are rescued by treatment with recombinant LIF protein as determined by Western blot. ( G ) Silencing LIF expression in SKGT4 EAC cells results in decreased IL6 mRNA expression that is recovered upon exposure to rLIF protein. ( H ) Neither silencing IL6 expression by siRNA-mediated silencing nor treatment with anti-IL6 antibody affects LIF mRNA levels or SKGT4 EAC cell growth. ( I ) Silencing LIF expression results in decreased expression of C1QA mRNA but not TREM2 in SKGT4 EAC cells. ∗ P < .05, ** P < .01, *** P < .001, and **** P < .0001 in either Student t test (proliferation) or Mann–Whitney testing (mRNA expression). siNT, nontargeting siRNA pool; siLIF, LIF-targeted siRNA pool; rLIF, recombinant LIF protein; rIL6, recombinant IL6 protein.
Goat Anti Rat Il 6, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/Rat+IL-6+Antibody/pmc02972360-171-14-18
Average 94 stars, based on 1 article reviews
goat anti rat il 6 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
R&D Systems biotinylated rat anti mouse il 6
LIF hierarchically regulates STAT3 phosphorylation, <t>IL6</t> expression, and cell proliferation in EAC cells. SiRNA-mediated silencing of LIF expression results in reduced LIF mRNA ( A ) expression, ( B ) secretion, and ( C ) a recombinant-recoverable reduction in cell proliferation in CP-D, SKGT4, and OE-33 EAC cell lines. Treatment of LIF silenced cells with recombinant LIF protein (rLIF) results in ( D ) recovery of LIF mRNA in CP-D, SKGT4, and OE33 EAC cells and ( E ) protein expression levels in SKGT4 EAC cells. ( F ) STAT3-Y705 phosphorylation levels in LIF-silenced SKGT4 EAC cells are rescued by treatment with recombinant LIF protein as determined by Western blot. ( G ) Silencing LIF expression in SKGT4 EAC cells results in decreased IL6 mRNA expression that is recovered upon exposure to rLIF protein. ( H ) Neither silencing IL6 expression by siRNA-mediated silencing nor treatment with anti-IL6 antibody affects LIF mRNA levels or SKGT4 EAC cell growth. ( I ) Silencing LIF expression results in decreased expression of C1QA mRNA but not TREM2 in SKGT4 EAC cells. ∗ P < .05, ** P < .01, *** P < .001, and **** P < .0001 in either Student t test (proliferation) or Mann–Whitney testing (mRNA expression). siNT, nontargeting siRNA pool; siLIF, LIF-targeted siRNA pool; rLIF, recombinant LIF protein; rIL6, recombinant IL6 protein.
Biotinylated Rat Anti Mouse Il 6, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/il6/Mouse+IL-6+Biotinylated+Antibody/pmc02966783-146-10-16
Average 93 stars, based on 1 article reviews
biotinylated rat anti mouse il 6 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


α-LA inhibits the expression of pro-inflammatory cytokines in LPS-treated BV-2 microglial cells. (A) Effects of α-LA on cell viability. BV-2 microglial cells were incubated with LPS (1 μg/ml) for 30 min followed by treatment with the indicated concentrations of α-LA for 24 h. Thereafter, cell viability was assessed through the MTT assay. (B and C) BV-2 microglial cells were treated with LPS (1 μg/ml) for 30 min followed by treatment with the indicated concentrations of α-LA at the suggested times. The cell-free conditioned culture medium was collected and analyzed with ELISA for TNF-α, IL-6. Data from three independent experiments are presented as means ± S.D. *≤ 0.05, **< 0.01, ***< 0.001 and are related to both LPS-induced cells and α-LA treated cells.

Journal: BMB Reports

Article Title: Effects of α-lipoic acid on LPS-induced neuroinflammation and NLRP3 inflammasome activation through the regulation of BV-2 microglial cells activation

doi: 10.5483/BMBRep.2019.52.10.026

Figure Lengend Snippet: α-LA inhibits the expression of pro-inflammatory cytokines in LPS-treated BV-2 microglial cells. (A) Effects of α-LA on cell viability. BV-2 microglial cells were incubated with LPS (1 μg/ml) for 30 min followed by treatment with the indicated concentrations of α-LA for 24 h. Thereafter, cell viability was assessed through the MTT assay. (B and C) BV-2 microglial cells were treated with LPS (1 μg/ml) for 30 min followed by treatment with the indicated concentrations of α-LA at the suggested times. The cell-free conditioned culture medium was collected and analyzed with ELISA for TNF-α, IL-6. Data from three independent experiments are presented as means ± S.D. *≤ 0.05, **< 0.01, ***< 0.001 and are related to both LPS-induced cells and α-LA treated cells.

Article Snippet: Both TNF-α and IL-6 were quantitatively measured through an enzyme-linked immunosorbent assay (ELISA) using the mouse TNF-α and IL-6 DuoSet ELISA kit (R&D systems, Minneapolis, MN, USA), according to the manufacturer’s instructions.

Techniques: Expressing, Incubation, MTT Assay, Enzyme-linked Immunosorbent Assay

LIF hierarchically regulates STAT3 phosphorylation, IL6 expression, and cell proliferation in EAC cells. SiRNA-mediated silencing of LIF expression results in reduced LIF mRNA ( A ) expression, ( B ) secretion, and ( C ) a recombinant-recoverable reduction in cell proliferation in CP-D, SKGT4, and OE-33 EAC cell lines. Treatment of LIF silenced cells with recombinant LIF protein (rLIF) results in ( D ) recovery of LIF mRNA in CP-D, SKGT4, and OE33 EAC cells and ( E ) protein expression levels in SKGT4 EAC cells. ( F ) STAT3-Y705 phosphorylation levels in LIF-silenced SKGT4 EAC cells are rescued by treatment with recombinant LIF protein as determined by Western blot. ( G ) Silencing LIF expression in SKGT4 EAC cells results in decreased IL6 mRNA expression that is recovered upon exposure to rLIF protein. ( H ) Neither silencing IL6 expression by siRNA-mediated silencing nor treatment with anti-IL6 antibody affects LIF mRNA levels or SKGT4 EAC cell growth. ( I ) Silencing LIF expression results in decreased expression of C1QA mRNA but not TREM2 in SKGT4 EAC cells. ∗ P < .05, ** P < .01, *** P < .001, and **** P < .0001 in either Student t test (proliferation) or Mann–Whitney testing (mRNA expression). siNT, nontargeting siRNA pool; siLIF, LIF-targeted siRNA pool; rLIF, recombinant LIF protein; rIL6, recombinant IL6 protein.

Journal: Cellular and Molecular Gastroenterology and Hepatology

Article Title: siRNA Library Screening Identifies a Druggable Immune-Signature Driving Esophageal Adenocarcinoma Cell Growth

doi: 10.1016/j.jcmgh.2018.01.012

Figure Lengend Snippet: LIF hierarchically regulates STAT3 phosphorylation, IL6 expression, and cell proliferation in EAC cells. SiRNA-mediated silencing of LIF expression results in reduced LIF mRNA ( A ) expression, ( B ) secretion, and ( C ) a recombinant-recoverable reduction in cell proliferation in CP-D, SKGT4, and OE-33 EAC cell lines. Treatment of LIF silenced cells with recombinant LIF protein (rLIF) results in ( D ) recovery of LIF mRNA in CP-D, SKGT4, and OE33 EAC cells and ( E ) protein expression levels in SKGT4 EAC cells. ( F ) STAT3-Y705 phosphorylation levels in LIF-silenced SKGT4 EAC cells are rescued by treatment with recombinant LIF protein as determined by Western blot. ( G ) Silencing LIF expression in SKGT4 EAC cells results in decreased IL6 mRNA expression that is recovered upon exposure to rLIF protein. ( H ) Neither silencing IL6 expression by siRNA-mediated silencing nor treatment with anti-IL6 antibody affects LIF mRNA levels or SKGT4 EAC cell growth. ( I ) Silencing LIF expression results in decreased expression of C1QA mRNA but not TREM2 in SKGT4 EAC cells. ∗ P < .05, ** P < .01, *** P < .001, and **** P < .0001 in either Student t test (proliferation) or Mann–Whitney testing (mRNA expression). siNT, nontargeting siRNA pool; siLIF, LIF-targeted siRNA pool; rLIF, recombinant LIF protein; rIL6, recombinant IL6 protein.

Article Snippet: Treatments with recombinant leukemia inhibitory factor (LIF) (30 ng/mL, ab57665; Abcam), IL6 (30 ng/mL; R&D Systems, Minneapolis, MN), native C1q (75 μg/mL; Sigma, Oakville, Ontario), and IL6 blocking antibody (AB206NA) experiments were performed in either 6- or 96-well cell culture plates for protein and viability experiments, respectively.

Techniques: Phospho-proteomics, Expressing, Recombinant, Western Blot, MANN-WHITNEY