|
New England Biolabs
nebnext ultra ii dna library prep kit Nebnext Ultra Ii Dna Library Prep Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/NEBNext+Ultra+II+DNA+Lib+Prep+for+Il+24/pmc13178659-276-7-14 Average 99 stars, based on 1 article reviews
nebnext ultra ii dna library prep kit - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Mabtech Inc
human il 6 alp mabtech Human Il 6 Alp Mabtech, supplied by Mabtech Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/8+elisa+for+il+interleukin/10__1016_slash_j__isci__2025__113046-729-122-125 Average 86 stars, based on 1 article reviews
human il 6 alp mabtech - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Procell Inc
il 1β Il 1β, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/1%CE%B2+il/pm38493291-90-33-35 Average 86 stars, based on 1 article reviews
il 1β - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Procell Inc
il 6 Il 6, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/6+il/pm38493291-90-30-32 Average 86 stars, based on 1 article reviews
il 6 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Eurofins
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha Il 6 Nm 031168 Probe Eurofins 50cagataagctggagtcacagaaggagtgg 30 Tnf Alpha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/031168+30+50cagataagctggagtcacagaaggagtgg+6+alpha+eurofins+il+nm+probe+tnf/pm30995475-232-95-98 Average 86 stars, based on 1 article reviews
il 6 nm 031168 probe eurofins 50cagataagctggagtcacagaaggagtgg 30 tnf alpha - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Wuhan Sanying Biotechnology
il 8 Il 8, supplied by Wuhan Sanying Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/8+anti+il/pmc12399170-47-67-68 Average 86 stars, based on 1 article reviews
il 8 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Huabio Inc
il 6r Il 6r, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/6r+antibody+il+polyclonal/pm42030937-264-18-23 Average 86 stars, based on 1 article reviews
il 6r - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Servicebio Inc
immunohistochemical interleukin il ![]() Immunohistochemical Interleukin Il, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/1+anti+il+%CE%B2/pmc13031196-64-85-90 Average 86 stars, based on 1 article reviews
immunohistochemical interleukin il - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Abmart Inc
rabbit ![]() Rabbit, supplied by Abmart Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/1%CE%B2+anti+il/pm41543628-76-83-87 Average 86 stars, based on 1 article reviews
rabbit - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
Dakewe Biotech Co
il 1β ![]() Il 1β, supplied by Dakewe Biotech Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/1%CE%B2+il/bio_rxiv__64898__2026__02__11__705426-244-22-23 Average 86 stars, based on 1 article reviews
il 1β - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
|
New England Biolabs
nebnext small rna library prep set ![]() Nebnext Small Rna Library Prep Set, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/NEBNext+Small+RNA+Lib+Prep+IL/pmc13106721-267-6-12 Average 96 stars, based on 1 article reviews
nebnext small rna library prep set - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
R&D Systems
anti mouse il 33 antibody ![]() Anti Mouse Il 33 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/il/Mouse+IL-33+Antibody/10__1016_slash_j__apsb__2026__02__011-81-8-15 Average 94 stars, based on 1 article reviews
anti mouse il 33 antibody - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Techniques in Coloproctology
Article Title: Comparison of the modeling effects between two hemorrhoid models
doi: 10.1007/s10151-026-03303-x
Figure Lengend Snippet: Histology and IL-2 expression in rat hemorrhoidal tissue. A Microscopic appearance of the hemorrhoid areas of the rats in each group (HE, ×50; a model group, b control group). B Expression of IL-2 in anorectal tissue in each group detected by immunohistochemical staining. (IHC, ×50; a model group, b control group)
Article Snippet: The study’s experimental pharmaceuticals and reagents included croton oil (GlpBio 1), olive oil (Sinopharm Chemical Reagent Co., Ltd., 20230807); pyridine (Xilong Scientific Co., Ltd., 240507D1); ether (Tianjin Kemiou Chemical Reagent Co., Ltd., 20230919); 2% isoflurane (RWD Life Science Co., Ltd., 20240902); 4% paraformaldehyde (biosharp BL539A); hematoxylin eosin high definition constant staining kit (Servicebio G1076); bovine serum albumin BSA (Servicebio GC305010 ); normal rabbit serum (concentrated type) (Servicebio G1209); histochemical kit DAB chromogenic reagent (Servicebio G1212); immunohistochemical tumor necrosis factor alpha (TNFα) primary antibody (Servicebio AF7014);
Techniques: Expressing, Control, Immunohistochemical staining, Staining
Journal: Techniques in Coloproctology
Article Title: Comparison of the modeling effects between two hemorrhoid models
doi: 10.1007/s10151-026-03303-x
Figure Lengend Snippet: Immunohistochemical overview of anorectal cytokine expression. Expression of A IL-2, B IL-6, C , and D TNFα in anorectal tissue in each group detected by immunohistochemical staining (IHC, ×50; a model group, b control group)
Article Snippet: The study’s experimental pharmaceuticals and reagents included croton oil (GlpBio 1), olive oil (Sinopharm Chemical Reagent Co., Ltd., 20230807); pyridine (Xilong Scientific Co., Ltd., 240507D1); ether (Tianjin Kemiou Chemical Reagent Co., Ltd., 20230919); 2% isoflurane (RWD Life Science Co., Ltd., 20240902); 4% paraformaldehyde (biosharp BL539A); hematoxylin eosin high definition constant staining kit (Servicebio G1076); bovine serum albumin BSA (Servicebio GC305010 ); normal rabbit serum (concentrated type) (Servicebio G1209); histochemical kit DAB chromogenic reagent (Servicebio G1212); immunohistochemical tumor necrosis factor alpha (TNFα) primary antibody (Servicebio AF7014);
Techniques: Immunohistochemical staining, Expressing, Staining, Control
Journal: Techniques in Coloproctology
Article Title: Comparison of the modeling effects between two hemorrhoid models
doi: 10.1007/s10151-026-03303-x
Figure Lengend Snippet: Relative mRNA expression of pro-inflammatory cytokines A IL-2, B IL-6, and C TNFα in anorectal tissue in each group. * P < 0.05 vs control group
Article Snippet: The study’s experimental pharmaceuticals and reagents included croton oil (GlpBio 1), olive oil (Sinopharm Chemical Reagent Co., Ltd., 20230807); pyridine (Xilong Scientific Co., Ltd., 240507D1); ether (Tianjin Kemiou Chemical Reagent Co., Ltd., 20230919); 2% isoflurane (RWD Life Science Co., Ltd., 20240902); 4% paraformaldehyde (biosharp BL539A); hematoxylin eosin high definition constant staining kit (Servicebio G1076); bovine serum albumin BSA (Servicebio GC305010 ); normal rabbit serum (concentrated type) (Servicebio G1209); histochemical kit DAB chromogenic reagent (Servicebio G1212); immunohistochemical tumor necrosis factor alpha (TNFα) primary antibody (Servicebio AF7014);
Techniques: Expressing, Control
Journal: Techniques in Coloproctology
Article Title: Comparison of the modeling effects between two hemorrhoid models
doi: 10.1007/s10151-026-03303-x
Figure Lengend Snippet: Western blotting for detecting protein expression of IL-2, IL-6, and TNFα
Article Snippet: The study’s experimental pharmaceuticals and reagents included croton oil (GlpBio 1), olive oil (Sinopharm Chemical Reagent Co., Ltd., 20230807); pyridine (Xilong Scientific Co., Ltd., 240507D1); ether (Tianjin Kemiou Chemical Reagent Co., Ltd., 20230919); 2% isoflurane (RWD Life Science Co., Ltd., 20240902); 4% paraformaldehyde (biosharp BL539A); hematoxylin eosin high definition constant staining kit (Servicebio G1076); bovine serum albumin BSA (Servicebio GC305010 ); normal rabbit serum (concentrated type) (Servicebio G1209); histochemical kit DAB chromogenic reagent (Servicebio G1212); immunohistochemical tumor necrosis factor alpha (TNFα) primary antibody (Servicebio AF7014);
Techniques: Western Blot, Expressing
Journal: Techniques in Coloproctology
Article Title: Comparison of the modeling effects between two hemorrhoid models
doi: 10.1007/s10151-026-03303-x
Figure Lengend Snippet: IL-2, IL-6, and TNFα protein levels in anorectal tissue are significantly elevated in the model group compared to the control group (* P < 0.05). A IL-2, B IL-6, and C TNFα protein expression in anorectal tissue. * P < 0.05 vs control group
Article Snippet: The study’s experimental pharmaceuticals and reagents included croton oil (GlpBio 1), olive oil (Sinopharm Chemical Reagent Co., Ltd., 20230807); pyridine (Xilong Scientific Co., Ltd., 240507D1); ether (Tianjin Kemiou Chemical Reagent Co., Ltd., 20230919); 2% isoflurane (RWD Life Science Co., Ltd., 20240902); 4% paraformaldehyde (biosharp BL539A); hematoxylin eosin high definition constant staining kit (Servicebio G1076); bovine serum albumin BSA (Servicebio GC305010 ); normal rabbit serum (concentrated type) (Servicebio G1209); histochemical kit DAB chromogenic reagent (Servicebio G1212); immunohistochemical tumor necrosis factor alpha (TNFα) primary antibody (Servicebio AF7014);
Techniques: Control, Expressing
Journal: Nature Communications
Article Title: Small RNA genomics of Aedes aegypti mosquitoes discovers infectious viruses that trigger an RNA interference response
doi: 10.1038/s41467-026-71964-1
Figure Lengend Snippet: a Overview of the Mosquito Small RNA Genomics (MSRG) pipeline applied to a survey of whole mosquitoes from Americas, Asia, Africa and laboratory strains. b Implementation of the VirusDetect program with updated GBVRL and custom databases for comprehensive mosquito virus detection. c Summary tabulation of the samples and RNA libraries analyzed in this study.
Article Snippet: Small RNA libraries were made using
Techniques: Virus
Journal: Nature Communications
Article Title: Small RNA genomics of Aedes aegypti mosquitoes discovers infectious viruses that trigger an RNA interference response
doi: 10.1038/s41467-026-71964-1
Figure Lengend Snippet: a Bubble plot of vsmRNAs from Africa Ae. aegypti colony strains. Number of reads per million is reflected by bubble diameter, and color represents strand bias of reads, red is plus strand biased, blue is minus strand biased. Dashed pink line boxes mark the PCLV and FORMV noted in panels ( c ) and ( d ), respectively. b Map of Africa locations where the Ae. aegypti colonies or samples originated. Map data ©2025 Google. c Coverage plots of PCLV small RNAs from a selection of African Ae. aegypti showing high M-fragment piRNAs rivaling the S-fragment piRNAs. d The FORMV vsmRNA coverage from African Ae. aegypti colonies from the McBride lab and an independent Kedougou, Senegal sample from Olmo et al. . The black arrow points to male-specific viral piRNA species. e Three examples of FORMV long RNAs sequenced from matched samples in ( d ).
Article Snippet: Small RNA libraries were made using
Techniques: Selection
Journal: Nature Communications
Article Title: Small RNA genomics of Aedes aegypti mosquitoes discovers infectious viruses that trigger an RNA interference response
doi: 10.1038/s41467-026-71964-1
Figure Lengend Snippet: a Bubble plot of vsmRNAs from lab strains. Reads per million represented by bubble diameter, strand bias represented by color, red is plus strand biased, blue is minus strand biased. See Supplementary Data for sample details. Lab initials: BZL=Benzon Research, MY = M. Younger, DB = D. Brackney, JM = J. Marques, ZT = Z. Tu, GH = G. Hughes, TC = T. Colpitts, BH = B. Hay, GP = G. Pijlman labs. b Coverage plots of long RNAs compared to small RNAs for viruses from the BZL strain of Ae. aegypti females and dormant eggs. c Coverage plots of TMBTLV small RNAs from GP lab strains also infected with Zika virus (ZIKV). d Scatterplot comparing matched small and long RNA libraries from Ae. aegypti . Sequencing RPM are plotted on a logarithmic scale. Sample dots are colored by sex, and clustered samples are in labeled ovals. e Coverage plots of two Florida exhibiting abundant long RNA signal for the Toti-like virus but negligible vsmRNAs in the upper plots that contrast both long and small RNAs against an R1-Ele4 TE. f Coverage plots of long RNAs versus small RNAs for the Formosus virus and R1-Ele4 TE from both males and females of the ENT African colony.
Article Snippet: Small RNA libraries were made using
Techniques: Infection, Virus, Sequencing, Labeling
Journal: Nature Communications
Article Title: Small RNA genomics of Aedes aegypti mosquitoes discovers infectious viruses that trigger an RNA interference response
doi: 10.1038/s41467-026-71964-1
Figure Lengend Snippet: a Our methodology to molecularly validate the small RNA detection of ISVs are true viruses that can be isolated and verified for triggering the RNAi response in mosquito cells. b RT-PCR detection of TMBTLV RNAs S1 and S2 during multiple rounds of blind passaging, starting with BZL mosquito homogenate as the initial virus infection source placed onto C6/36-NL and Aag2 mosquito cells. The ladder is the 1KbPlus DNA ladder, and uncropped gels are in the source data files. c Virus infection kinetics measured in C6/36-NL and Aag2 cells over 12 days using droplet digital PCR (ddPCR). Flasks with 1 million cells were infected on Day 0 with 20 K viral copies per infection. Virus stocks are from filtered media from subsequent passage from the experiment in (a). Error bars correspond to the 95% confidence interval from Poisson Distribution in the ddPCR analysis algorithm centered around the mean from each reading that contained >15 K droplets replicates. Additional virus infection kinetics measurements are shown in Supplementary Fig. . T-flask illustration from NIAID NIH BioArt Source (bioart.niaid.nih.gov/bioart/303).
Article Snippet: Small RNA libraries were made using
Techniques: RNA Detection, Isolation, Reverse Transcription Polymerase Chain Reaction, Passaging, Virus, Infection, Digital PCR