ia2 Search Results


93
Miltenyi Biotec anti mhc class ii antibodies
Anti Mhc Class Ii Antibodies, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti mhc class ii antibodies/product/Miltenyi Biotec
Average 93 stars, based on 1 article reviews
anti mhc class ii antibodies - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

95
Miltenyi Biotec anti mhc ii
Anti Mhc Ii, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti mhc ii/product/Miltenyi Biotec
Average 95 stars, based on 1 article reviews
anti mhc ii - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

92
Proteintech ia2
Ia2, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ia2/product/Proteintech
Average 92 stars, based on 1 article reviews
ia2 - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

92
Eagle Biosciences enzyme linked immunosorbent assay elisa cat no sku
Enzyme Linked Immunosorbent Assay Elisa Cat No Sku, supplied by Eagle Biosciences, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/enzyme linked immunosorbent assay elisa cat no sku/product/Eagle Biosciences
Average 92 stars, based on 1 article reviews
enzyme linked immunosorbent assay elisa cat no sku - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology target effect sihp0814 sihp0816
Target Effect Sihp0814 Sihp0816, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/target effect sihp0814 sihp0816/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
target effect sihp0814 sihp0816 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

86
Santa Cruz Biotechnology anti ptprn monoclonal antibody
Figure 1—Assessment of <t>PTPRN</t> dysregulation in CRC. A: Evaluation of mRNA levels in CRC tissue compared with normal adjacent tis- sue using Oncomine. Higher PTPRN mRNA levels were found in CRC tissue in comparison with control tissue (39,40). B: The cBioPortal database retrieved data about the presence of PTPRN mutations at a genetic level in 3% of patients with CRC (TCGA, COAD). C: Sur- vival analysis retrieved from the GEPIA2 web-based tool revealed that a higher PTPRN expression in patients with CRC (READ and COAD) and patients with COAD (TCGA data sets) was related with a large decrease in their overall and disease-free survival (P values < 0.05). CNA, copy number alteration; HR, hazard ratio.
Anti Ptprn Monoclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti ptprn monoclonal antibody/product/Santa Cruz Biotechnology
Average 86 stars, based on 1 article reviews
anti ptprn monoclonal antibody - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
LGC Biosearch ia2-7: gtcatcggtacctccgccaccacggcacgcgaagctccaa
Figure 1—Assessment of <t>PTPRN</t> dysregulation in CRC. A: Evaluation of mRNA levels in CRC tissue compared with normal adjacent tis- sue using Oncomine. Higher PTPRN mRNA levels were found in CRC tissue in comparison with control tissue (39,40). B: The cBioPortal database retrieved data about the presence of PTPRN mutations at a genetic level in 3% of patients with CRC (TCGA, COAD). C: Sur- vival analysis retrieved from the GEPIA2 web-based tool revealed that a higher PTPRN expression in patients with CRC (READ and COAD) and patients with COAD (TCGA data sets) was related with a large decrease in their overall and disease-free survival (P values < 0.05). CNA, copy number alteration; HR, hazard ratio.
Ia2 7: Gtcatcggtacctccgccaccacggcacgcgaagctccaa, supplied by LGC Biosearch, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ia2-7: gtcatcggtacctccgccaccacggcacgcgaagctccaa/product/LGC Biosearch
Average 90 stars, based on 1 article reviews
ia2-7: gtcatcggtacctccgccaccacggcacgcgaagctccaa - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
MEDIPAN GmbH 125i]btsh
Figure 1—Assessment of <t>PTPRN</t> dysregulation in CRC. A: Evaluation of mRNA levels in CRC tissue compared with normal adjacent tis- sue using Oncomine. Higher PTPRN mRNA levels were found in CRC tissue in comparison with control tissue (39,40). B: The cBioPortal database retrieved data about the presence of PTPRN mutations at a genetic level in 3% of patients with CRC (TCGA, COAD). C: Sur- vival analysis retrieved from the GEPIA2 web-based tool revealed that a higher PTPRN expression in patients with CRC (READ and COAD) and patients with COAD (TCGA data sets) was related with a large decrease in their overall and disease-free survival (P values < 0.05). CNA, copy number alteration; HR, hazard ratio.
125i]Btsh, supplied by MEDIPAN GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/125i]btsh/product/MEDIPAN GmbH
Average 90 stars, based on 1 article reviews
125i]btsh - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
SlidePath Ltd leica tissue ia 2.0 software
Figure 1—Assessment of <t>PTPRN</t> dysregulation in CRC. A: Evaluation of mRNA levels in CRC tissue compared with normal adjacent tis- sue using Oncomine. Higher PTPRN mRNA levels were found in CRC tissue in comparison with control tissue (39,40). B: The cBioPortal database retrieved data about the presence of PTPRN mutations at a genetic level in 3% of patients with CRC (TCGA, COAD). C: Sur- vival analysis retrieved from the GEPIA2 web-based tool revealed that a higher PTPRN expression in patients with CRC (READ and COAD) and patients with COAD (TCGA data sets) was related with a large decrease in their overall and disease-free survival (P values < 0.05). CNA, copy number alteration; HR, hazard ratio.
Leica Tissue Ia 2.0 Software, supplied by SlidePath Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/leica tissue ia 2.0 software/product/SlidePath Ltd
Average 90 stars, based on 1 article reviews
leica tissue ia 2.0 software - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
KRONUS Inc gad/ia-2 antibody screen elisa test kit
Figure 1—Assessment of <t>PTPRN</t> dysregulation in CRC. A: Evaluation of mRNA levels in CRC tissue compared with normal adjacent tis- sue using Oncomine. Higher PTPRN mRNA levels were found in CRC tissue in comparison with control tissue (39,40). B: The cBioPortal database retrieved data about the presence of PTPRN mutations at a genetic level in 3% of patients with CRC (TCGA, COAD). C: Sur- vival analysis retrieved from the GEPIA2 web-based tool revealed that a higher PTPRN expression in patients with CRC (READ and COAD) and patients with COAD (TCGA data sets) was related with a large decrease in their overall and disease-free survival (P values < 0.05). CNA, copy number alteration; HR, hazard ratio.
Gad/Ia 2 Antibody Screen Elisa Test Kit, supplied by KRONUS Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gad/ia-2 antibody screen elisa test kit/product/KRONUS Inc
Average 90 stars, based on 1 article reviews
gad/ia-2 antibody screen elisa test kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
AESKU Inc aesku ia2-gad
Figure 1—Assessment of <t>PTPRN</t> dysregulation in CRC. A: Evaluation of mRNA levels in CRC tissue compared with normal adjacent tis- sue using Oncomine. Higher PTPRN mRNA levels were found in CRC tissue in comparison with control tissue (39,40). B: The cBioPortal database retrieved data about the presence of PTPRN mutations at a genetic level in 3% of patients with CRC (TCGA, COAD). C: Sur- vival analysis retrieved from the GEPIA2 web-based tool revealed that a higher PTPRN expression in patients with CRC (READ and COAD) and patients with COAD (TCGA data sets) was related with a large decrease in their overall and disease-free survival (P values < 0.05). CNA, copy number alteration; HR, hazard ratio.
Aesku Ia2 Gad, supplied by AESKU Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aesku ia2-gad/product/AESKU Inc
Average 90 stars, based on 1 article reviews
aesku ia2-gad - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
EUROIMMUN ica512 (ia2) antibodies
Figure 1—Assessment of <t>PTPRN</t> dysregulation in CRC. A: Evaluation of mRNA levels in CRC tissue compared with normal adjacent tis- sue using Oncomine. Higher PTPRN mRNA levels were found in CRC tissue in comparison with control tissue (39,40). B: The cBioPortal database retrieved data about the presence of PTPRN mutations at a genetic level in 3% of patients with CRC (TCGA, COAD). C: Sur- vival analysis retrieved from the GEPIA2 web-based tool revealed that a higher PTPRN expression in patients with CRC (READ and COAD) and patients with COAD (TCGA data sets) was related with a large decrease in their overall and disease-free survival (P values < 0.05). CNA, copy number alteration; HR, hazard ratio.
Ica512 (Ia2) Antibodies, supplied by EUROIMMUN, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ica512 (ia2) antibodies/product/EUROIMMUN
Average 90 stars, based on 1 article reviews
ica512 (ia2) antibodies - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Figure 1—Assessment of PTPRN dysregulation in CRC. A: Evaluation of mRNA levels in CRC tissue compared with normal adjacent tis- sue using Oncomine. Higher PTPRN mRNA levels were found in CRC tissue in comparison with control tissue (39,40). B: The cBioPortal database retrieved data about the presence of PTPRN mutations at a genetic level in 3% of patients with CRC (TCGA, COAD). C: Sur- vival analysis retrieved from the GEPIA2 web-based tool revealed that a higher PTPRN expression in patients with CRC (READ and COAD) and patients with COAD (TCGA data sets) was related with a large decrease in their overall and disease-free survival (P values < 0.05). CNA, copy number alteration; HR, hazard ratio.

Journal: Diabetes

Article Title: Seroreactivity Against Tyrosine Phosphatase PTPRN Links Type 2 Diabetes and Colorectal Cancer and Identifies a Potential Diagnostic and Therapeutic Target.

doi: 10.2337/db20-1206

Figure Lengend Snippet: Figure 1—Assessment of PTPRN dysregulation in CRC. A: Evaluation of mRNA levels in CRC tissue compared with normal adjacent tis- sue using Oncomine. Higher PTPRN mRNA levels were found in CRC tissue in comparison with control tissue (39,40). B: The cBioPortal database retrieved data about the presence of PTPRN mutations at a genetic level in 3% of patients with CRC (TCGA, COAD). C: Sur- vival analysis retrieved from the GEPIA2 web-based tool revealed that a higher PTPRN expression in patients with CRC (READ and COAD) and patients with COAD (TCGA data sets) was related with a large decrease in their overall and disease-free survival (P values < 0.05). CNA, copy number alteration; HR, hazard ratio.

Article Snippet: After blocking, membranes were incubated overnight at 4 C with an anti-HaloTag monoclonal antibody (#6921A; Promega) diluted 1:1,000, an anti-PTPRN monoclonal antibody (sc-130570; Santa Cruz Biotechnology) diluted 1:200, an anti–phosphorylated (p-)insulin Rb polyclonal antibody (sc-25103-R; Santa Cruz Biotechnology) diluted 1:1,000, an anti-IRS1 polyclonal antibody (sc-559; Santa Cruz Biotechnology) diluted 1:1,000, an anti–pFOXO1/3 polyclonal antibody (#9464; Cell Signaling Technology), an anti-AKT polyclonal antibody (#4691; Cell Signaling Technology,), an anti–p-AKT polyclonal antibody (#9275; Cell Signaling Technology), an anti-ERK polyclonal antibody (#4695; Cell Signaling Technology), an anti–p-ERK polyclonal antibody (#9101; Cell Signaling Technology), an anti-GSK3b monoclonal antibody (#61021; BD Transduction Laboratories), an anti-GAPDH (800–656–7625; Rockland Immunochemicals) diluted 1:2,000, or an anti-RhoGDi (sc-360; Santa Cruz Biotechnology) diluted 1:1,000.

Techniques: Comparison, Control, Expressing

Figure 2—In vitro PTPRN expression and seroreactivity analysis of PTPRN. A: PTPRN (979 aa in length) is composed of a signal peptide (SP), an ECD, a transmembrane domain (TM), and an ICD. The amino acids composing each domain are highlighted. B: Immunostaining using a monoclonal antibody against the HaloTag of the indicated fusion proteins in vitro expressed. C: Covalent immobilization of the proteins into MBs by HaloTag was verified through luminescence using a monoclonal antibody against the tag. D: Seroreactivity analysis of autoantibodies against ECD, ICD, and PTPRN in plasma samples from healthy individuals and those with diabetes, CRC, and CRC with T2D. E: PTPRN and ECD seroreactivity was significantly higher in the CRC group than in the control group (P value <0.05). F: When com- paring the control group with the patients with CRC and the CRC with patients with T2D separately, PTPRN could significantly discrimi- nate between control subjects and patients with T2D with CRC (P value <0.05), whereas ECD could significantly discriminate between the control group and the patients with CRC (P value <0.05). G: Not statistically significant differences were found when comparing EBNA1 seroreactivity among groups. EBNA1 seroreactivity was used as control because >90% of the human population has antibodies against EBNA1. H: Both PTPRN and ECD autoantibodies could discriminate between individuals with diabetes and patients with CRC and patients with CRC with T2D separately (P values <0.05). Measurements were performed in triplicate. Bar graphs represent the mean ± SD (E, F, and H). *P < 0.05.

Journal: Diabetes

Article Title: Seroreactivity Against Tyrosine Phosphatase PTPRN Links Type 2 Diabetes and Colorectal Cancer and Identifies a Potential Diagnostic and Therapeutic Target.

doi: 10.2337/db20-1206

Figure Lengend Snippet: Figure 2—In vitro PTPRN expression and seroreactivity analysis of PTPRN. A: PTPRN (979 aa in length) is composed of a signal peptide (SP), an ECD, a transmembrane domain (TM), and an ICD. The amino acids composing each domain are highlighted. B: Immunostaining using a monoclonal antibody against the HaloTag of the indicated fusion proteins in vitro expressed. C: Covalent immobilization of the proteins into MBs by HaloTag was verified through luminescence using a monoclonal antibody against the tag. D: Seroreactivity analysis of autoantibodies against ECD, ICD, and PTPRN in plasma samples from healthy individuals and those with diabetes, CRC, and CRC with T2D. E: PTPRN and ECD seroreactivity was significantly higher in the CRC group than in the control group (P value <0.05). F: When com- paring the control group with the patients with CRC and the CRC with patients with T2D separately, PTPRN could significantly discrimi- nate between control subjects and patients with T2D with CRC (P value <0.05), whereas ECD could significantly discriminate between the control group and the patients with CRC (P value <0.05). G: Not statistically significant differences were found when comparing EBNA1 seroreactivity among groups. EBNA1 seroreactivity was used as control because >90% of the human population has antibodies against EBNA1. H: Both PTPRN and ECD autoantibodies could discriminate between individuals with diabetes and patients with CRC and patients with CRC with T2D separately (P values <0.05). Measurements were performed in triplicate. Bar graphs represent the mean ± SD (E, F, and H). *P < 0.05.

Article Snippet: After blocking, membranes were incubated overnight at 4 C with an anti-HaloTag monoclonal antibody (#6921A; Promega) diluted 1:1,000, an anti-PTPRN monoclonal antibody (sc-130570; Santa Cruz Biotechnology) diluted 1:200, an anti–phosphorylated (p-)insulin Rb polyclonal antibody (sc-25103-R; Santa Cruz Biotechnology) diluted 1:1,000, an anti-IRS1 polyclonal antibody (sc-559; Santa Cruz Biotechnology) diluted 1:1,000, an anti–pFOXO1/3 polyclonal antibody (#9464; Cell Signaling Technology), an anti-AKT polyclonal antibody (#4691; Cell Signaling Technology,), an anti–p-AKT polyclonal antibody (#9275; Cell Signaling Technology), an anti-ERK polyclonal antibody (#4695; Cell Signaling Technology), an anti–p-ERK polyclonal antibody (#9101; Cell Signaling Technology), an anti-GSK3b monoclonal antibody (#61021; BD Transduction Laboratories), an anti-GAPDH (800–656–7625; Rockland Immunochemicals) diluted 1:2,000, or an anti-RhoGDi (sc-360; Santa Cruz Biotechnology) diluted 1:1,000.

Techniques: In Vitro, Expressing, Immunostaining, Clinical Proteomics, Control

Figure 3—Diagnostic potential of the detection of PTPRN autoantibodies. The diagnostic potential for the detection of autoantibodies against PTPRN and ECD was evaluated using ROC curves. A: Autoantibody detection could discriminate between control and CRC group with an AUC of 75.5%. B: Autoantibody detection could discriminate between patients with T2D and CRC with patients with T2D with an AUC of 90.0%. Sens, sensitivy; Spec, specificity.

Journal: Diabetes

Article Title: Seroreactivity Against Tyrosine Phosphatase PTPRN Links Type 2 Diabetes and Colorectal Cancer and Identifies a Potential Diagnostic and Therapeutic Target.

doi: 10.2337/db20-1206

Figure Lengend Snippet: Figure 3—Diagnostic potential of the detection of PTPRN autoantibodies. The diagnostic potential for the detection of autoantibodies against PTPRN and ECD was evaluated using ROC curves. A: Autoantibody detection could discriminate between control and CRC group with an AUC of 75.5%. B: Autoantibody detection could discriminate between patients with T2D and CRC with patients with T2D with an AUC of 90.0%. Sens, sensitivy; Spec, specificity.

Article Snippet: After blocking, membranes were incubated overnight at 4 C with an anti-HaloTag monoclonal antibody (#6921A; Promega) diluted 1:1,000, an anti-PTPRN monoclonal antibody (sc-130570; Santa Cruz Biotechnology) diluted 1:200, an anti–phosphorylated (p-)insulin Rb polyclonal antibody (sc-25103-R; Santa Cruz Biotechnology) diluted 1:1,000, an anti-IRS1 polyclonal antibody (sc-559; Santa Cruz Biotechnology) diluted 1:1,000, an anti–pFOXO1/3 polyclonal antibody (#9464; Cell Signaling Technology), an anti-AKT polyclonal antibody (#4691; Cell Signaling Technology,), an anti–p-AKT polyclonal antibody (#9275; Cell Signaling Technology), an anti-ERK polyclonal antibody (#4695; Cell Signaling Technology), an anti–p-ERK polyclonal antibody (#9101; Cell Signaling Technology), an anti-GSK3b monoclonal antibody (#61021; BD Transduction Laboratories), an anti-GAPDH (800–656–7625; Rockland Immunochemicals) diluted 1:2,000, or an anti-RhoGDi (sc-360; Santa Cruz Biotechnology) diluted 1:1,000.

Techniques: Diagnostic Assay, Control

Figure 4—Silencing of PTPRN in KM12C and KM12SM CRC cells and effect on their tumorigenic properties. A: Protein expression levels in CRC cell lines KM12C and KM12SM. RhoGDi was used as loading control. B: Evaluation by PCR and WB of the transient silencing of

Journal: Diabetes

Article Title: Seroreactivity Against Tyrosine Phosphatase PTPRN Links Type 2 Diabetes and Colorectal Cancer and Identifies a Potential Diagnostic and Therapeutic Target.

doi: 10.2337/db20-1206

Figure Lengend Snippet: Figure 4—Silencing of PTPRN in KM12C and KM12SM CRC cells and effect on their tumorigenic properties. A: Protein expression levels in CRC cell lines KM12C and KM12SM. RhoGDi was used as loading control. B: Evaluation by PCR and WB of the transient silencing of

Article Snippet: After blocking, membranes were incubated overnight at 4 C with an anti-HaloTag monoclonal antibody (#6921A; Promega) diluted 1:1,000, an anti-PTPRN monoclonal antibody (sc-130570; Santa Cruz Biotechnology) diluted 1:200, an anti–phosphorylated (p-)insulin Rb polyclonal antibody (sc-25103-R; Santa Cruz Biotechnology) diluted 1:1,000, an anti-IRS1 polyclonal antibody (sc-559; Santa Cruz Biotechnology) diluted 1:1,000, an anti–pFOXO1/3 polyclonal antibody (#9464; Cell Signaling Technology), an anti-AKT polyclonal antibody (#4691; Cell Signaling Technology,), an anti–p-AKT polyclonal antibody (#9275; Cell Signaling Technology), an anti-ERK polyclonal antibody (#4695; Cell Signaling Technology), an anti–p-ERK polyclonal antibody (#9101; Cell Signaling Technology), an anti-GSK3b monoclonal antibody (#61021; BD Transduction Laboratories), an anti-GAPDH (800–656–7625; Rockland Immunochemicals) diluted 1:2,000, or an anti-RhoGDi (sc-360; Santa Cruz Biotechnology) diluted 1:1,000.

Techniques: Expressing, Control

Figure 5—PTPRN depletion on KM12C and KM12SM CRC cells alters EMT transition and reduces insulin receptor signaling pathway. A and B: Alterations in EMT inducers after PTPRN depletion in KM12C and KM12SM cell lines. cDNA synthesized from total RNA from tran- siently depleted PTPRN and scrambled control cells was subjected to semiquantitative RT-PCR analysis using specific primers for the EMT inducers TGF-b1, SNAI1, Claudin-2, E-cadherin, N-cadherin, and ZO1 using 18S as control and for normalization (A) or qPCR analy- sis using specific primers for TGF-b1, SNAI1, Claudin-2, and E-cadherin using 18S for normalization (B). C–E: Analysis of alterations in the insulin receptor signaling pathway by PCR and WB, respectively, after PTPRN depletion in KM12C and KM12SM cell lines. cDNA synthe- sized from total RNA from transiently depleted PTPRN and scrambled control cells after 48 h posttransfection was subjected to semiquan- titative RT-PCR analysis using specific primers for IRS1, ERK1, ERK2, AKT1, AKT2, mTOR, FOXO1, AS160, and GSK3a using 18S as control and for normalization (C) or qPCR analysis using specific primers for ERK1, ERK2, AKT1, AKT2, mTOR, FOXO1, and GSK3a using 18S for normalization (D). E: Protein expression levels of p-FOXO1/3, GSK3b, p-IRb, AKT, p-AKT, ERK, p-ERK, and IRS1 in CRC cell lines KM12C and KM12SM transiently transfected with indicated siRNAs for 48 h confirmed RT-PCR and/or qPCR results. GAPDH and RhoGDi were used as controls. Red Ponceau staining of each line was used for normalization. A, C, and E: Two replicate experiments (#1 and #2) were analyzed. Representative images are shown. B and D: Data represent the mean ± SD of two experiments. The abundance of each mRNA and protein was quantified by densitometry using ImageJ. a.u., arbitrary units.

Journal: Diabetes

Article Title: Seroreactivity Against Tyrosine Phosphatase PTPRN Links Type 2 Diabetes and Colorectal Cancer and Identifies a Potential Diagnostic and Therapeutic Target.

doi: 10.2337/db20-1206

Figure Lengend Snippet: Figure 5—PTPRN depletion on KM12C and KM12SM CRC cells alters EMT transition and reduces insulin receptor signaling pathway. A and B: Alterations in EMT inducers after PTPRN depletion in KM12C and KM12SM cell lines. cDNA synthesized from total RNA from tran- siently depleted PTPRN and scrambled control cells was subjected to semiquantitative RT-PCR analysis using specific primers for the EMT inducers TGF-b1, SNAI1, Claudin-2, E-cadherin, N-cadherin, and ZO1 using 18S as control and for normalization (A) or qPCR analy- sis using specific primers for TGF-b1, SNAI1, Claudin-2, and E-cadherin using 18S for normalization (B). C–E: Analysis of alterations in the insulin receptor signaling pathway by PCR and WB, respectively, after PTPRN depletion in KM12C and KM12SM cell lines. cDNA synthe- sized from total RNA from transiently depleted PTPRN and scrambled control cells after 48 h posttransfection was subjected to semiquan- titative RT-PCR analysis using specific primers for IRS1, ERK1, ERK2, AKT1, AKT2, mTOR, FOXO1, AS160, and GSK3a using 18S as control and for normalization (C) or qPCR analysis using specific primers for ERK1, ERK2, AKT1, AKT2, mTOR, FOXO1, and GSK3a using 18S for normalization (D). E: Protein expression levels of p-FOXO1/3, GSK3b, p-IRb, AKT, p-AKT, ERK, p-ERK, and IRS1 in CRC cell lines KM12C and KM12SM transiently transfected with indicated siRNAs for 48 h confirmed RT-PCR and/or qPCR results. GAPDH and RhoGDi were used as controls. Red Ponceau staining of each line was used for normalization. A, C, and E: Two replicate experiments (#1 and #2) were analyzed. Representative images are shown. B and D: Data represent the mean ± SD of two experiments. The abundance of each mRNA and protein was quantified by densitometry using ImageJ. a.u., arbitrary units.

Article Snippet: After blocking, membranes were incubated overnight at 4 C with an anti-HaloTag monoclonal antibody (#6921A; Promega) diluted 1:1,000, an anti-PTPRN monoclonal antibody (sc-130570; Santa Cruz Biotechnology) diluted 1:200, an anti–phosphorylated (p-)insulin Rb polyclonal antibody (sc-25103-R; Santa Cruz Biotechnology) diluted 1:1,000, an anti-IRS1 polyclonal antibody (sc-559; Santa Cruz Biotechnology) diluted 1:1,000, an anti–pFOXO1/3 polyclonal antibody (#9464; Cell Signaling Technology), an anti-AKT polyclonal antibody (#4691; Cell Signaling Technology,), an anti–p-AKT polyclonal antibody (#9275; Cell Signaling Technology), an anti-ERK polyclonal antibody (#4695; Cell Signaling Technology), an anti–p-ERK polyclonal antibody (#9101; Cell Signaling Technology), an anti-GSK3b monoclonal antibody (#61021; BD Transduction Laboratories), an anti-GAPDH (800–656–7625; Rockland Immunochemicals) diluted 1:2,000, or an anti-RhoGDi (sc-360; Santa Cruz Biotechnology) diluted 1:1,000.

Techniques: Synthesized, Control, Reverse Transcription Polymerase Chain Reaction, Expressing, Transfection, Staining

Figure 6—PTPRN depletion decreases liver homing and liver metastasis in KM12SM CRC cells. A: Nude mice intrasplenically inoculated with KM12SM cells transiently transfected with siScramble (n 5 2) and indicated PTPRN siRNAs (n 5 1/PTPRN siRNA) were sacrificed 24 h after inoculation for analysis of in vivo liver homing. RNA was isolated from the liver and spleen (as control) and directly subjected to RT-PCR to amplify human GAPDH (hGAPDH). Representative experiments out of two are shown. Murine b-actin (mActin) was amplified as control. B: Representative images of luminescence intensity of in vivo luciferase activity from mice injected with KM12SM cells tran- siently transfected with control and PTPRN siRNAs at days 45 and 60 postintrasplenical inoculation. Mice injected with control cells did show detectable bioluminescence by IVIS analyses, in contrast to mice injected with PTPRN-depleted cells (one out of six mice showed

Journal: Diabetes

Article Title: Seroreactivity Against Tyrosine Phosphatase PTPRN Links Type 2 Diabetes and Colorectal Cancer and Identifies a Potential Diagnostic and Therapeutic Target.

doi: 10.2337/db20-1206

Figure Lengend Snippet: Figure 6—PTPRN depletion decreases liver homing and liver metastasis in KM12SM CRC cells. A: Nude mice intrasplenically inoculated with KM12SM cells transiently transfected with siScramble (n 5 2) and indicated PTPRN siRNAs (n 5 1/PTPRN siRNA) were sacrificed 24 h after inoculation for analysis of in vivo liver homing. RNA was isolated from the liver and spleen (as control) and directly subjected to RT-PCR to amplify human GAPDH (hGAPDH). Representative experiments out of two are shown. Murine b-actin (mActin) was amplified as control. B: Representative images of luminescence intensity of in vivo luciferase activity from mice injected with KM12SM cells tran- siently transfected with control and PTPRN siRNAs at days 45 and 60 postintrasplenical inoculation. Mice injected with control cells did show detectable bioluminescence by IVIS analyses, in contrast to mice injected with PTPRN-depleted cells (one out of six mice showed

Article Snippet: After blocking, membranes were incubated overnight at 4 C with an anti-HaloTag monoclonal antibody (#6921A; Promega) diluted 1:1,000, an anti-PTPRN monoclonal antibody (sc-130570; Santa Cruz Biotechnology) diluted 1:200, an anti–phosphorylated (p-)insulin Rb polyclonal antibody (sc-25103-R; Santa Cruz Biotechnology) diluted 1:1,000, an anti-IRS1 polyclonal antibody (sc-559; Santa Cruz Biotechnology) diluted 1:1,000, an anti–pFOXO1/3 polyclonal antibody (#9464; Cell Signaling Technology), an anti-AKT polyclonal antibody (#4691; Cell Signaling Technology,), an anti–p-AKT polyclonal antibody (#9275; Cell Signaling Technology), an anti-ERK polyclonal antibody (#4695; Cell Signaling Technology), an anti–p-ERK polyclonal antibody (#9101; Cell Signaling Technology), an anti-GSK3b monoclonal antibody (#61021; BD Transduction Laboratories), an anti-GAPDH (800–656–7625; Rockland Immunochemicals) diluted 1:2,000, or an anti-RhoGDi (sc-360; Santa Cruz Biotechnology) diluted 1:1,000.

Techniques: Transfection, In Vivo, Isolation, Control, Reverse Transcription Polymerase Chain Reaction, Luciferase, Activity Assay, Injection