human tfr Search Results


91
Elabscience Biotechnology human stfr elisa kit
Human Stfr Elisa Kit, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/Human+TFR1+(Transferrin+Receptor+1)+ELISA+Kit/pm37347744-85-13-17
Average 91 stars, based on 1 article reviews
human stfr elisa kit - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier

90
R&D Systems transferrin receptor
Figure 5. Translation of dual orthogonal coupling to different antibodies. (A) <t>Anti-TfR</t> and EpCAM antibodies had low TCO reactivity (12−15%) after direct amine-conjugation, but the PEG24− TCO increased reactive TCO density 3- to 4-fold. *MALDI-TOF analysis of the TCO−PEG24-modified anti-EpCAM antibody was limited by difficulties with desorption. (B) Flow cytometry results for TCO- and TCO−PEG24-modified anti-EpCAM and TfR antibodies on A431 cells after reaction with 10 nM tetrazine−QDs for 30 min, showing 5-fold signal enhancements for the PEG24−TCO. (C) Confocal images of A431 cells labeled with (i, iv) anti-EpCAM, (ii, v) anti-TfR, or (iii, vi) nonbinding control antibodies. The antibodies were modified with (i−iii) TCO or (iv−vi) PEG24−TCO at the highest densities and reacted with tetrazine−QD at 10 nM for 30 min. Scale bar: 20 μm. Error bars represent the standard error of at least three independent experiments.
Transferrin Receptor, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/Human+TfR+(Transferrin+R)+Antibody/10__1021_slash_bc500605g-100-11-20
Average 90 stars, based on 1 article reviews
transferrin receptor - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

94
R&D Systems tfr 2474 tr proteins
Figure 5. Translation of dual orthogonal coupling to different antibodies. (A) <t>Anti-TfR</t> and EpCAM antibodies had low TCO reactivity (12−15%) after direct amine-conjugation, but the PEG24− TCO increased reactive TCO density 3- to 4-fold. *MALDI-TOF analysis of the TCO−PEG24-modified anti-EpCAM antibody was limited by difficulties with desorption. (B) Flow cytometry results for TCO- and TCO−PEG24-modified anti-EpCAM and TfR antibodies on A431 cells after reaction with 10 nM tetrazine−QDs for 30 min, showing 5-fold signal enhancements for the PEG24−TCO. (C) Confocal images of A431 cells labeled with (i, iv) anti-EpCAM, (ii, v) anti-TfR, or (iii, vi) nonbinding control antibodies. The antibodies were modified with (i−iii) TCO or (iv−vi) PEG24−TCO at the highest densities and reacted with tetrazine−QD at 10 nM for 30 min. Scale bar: 20 μm. Error bars represent the standard error of at least three independent experiments.
Tfr 2474 Tr Proteins, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/Recombinant+Human+TfR+Protein%2C+CF/bio_rxiv__64898__2026__01__21__700773-163-5-10
Average 94 stars, based on 1 article reviews
tfr 2474 tr proteins - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

94
Miltenyi Biotec fc 1 20
Figure 5. Translation of dual orthogonal coupling to different antibodies. (A) <t>Anti-TfR</t> and EpCAM antibodies had low TCO reactivity (12−15%) after direct amine-conjugation, but the PEG24− TCO increased reactive TCO density 3- to 4-fold. *MALDI-TOF analysis of the TCO−PEG24-modified anti-EpCAM antibody was limited by difficulties with desorption. (B) Flow cytometry results for TCO- and TCO−PEG24-modified anti-EpCAM and TfR antibodies on A431 cells after reaction with 10 nM tetrazine−QDs for 30 min, showing 5-fold signal enhancements for the PEG24−TCO. (C) Confocal images of A431 cells labeled with (i, iv) anti-EpCAM, (ii, v) anti-TfR, or (iii, vi) nonbinding control antibodies. The antibodies were modified with (i−iii) TCO or (iv−vi) PEG24−TCO at the highest densities and reacted with tetrazine−QD at 10 nM for 30 min. Scale bar: 20 μm. Error bars represent the standard error of at least three independent experiments.
Fc 1 20, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/CD71+Antibody%2C+anti-human/pmc08184214-16-12-6
Average 94 stars, based on 1 article reviews
fc 1 20 - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

93
Miltenyi Biotec cd71 apc
Figure 5. Translation of dual orthogonal coupling to different antibodies. (A) <t>Anti-TfR</t> and EpCAM antibodies had low TCO reactivity (12−15%) after direct amine-conjugation, but the PEG24− TCO increased reactive TCO density 3- to 4-fold. *MALDI-TOF analysis of the TCO−PEG24-modified anti-EpCAM antibody was limited by difficulties with desorption. (B) Flow cytometry results for TCO- and TCO−PEG24-modified anti-EpCAM and TfR antibodies on A431 cells after reaction with 10 nM tetrazine−QDs for 30 min, showing 5-fold signal enhancements for the PEG24−TCO. (C) Confocal images of A431 cells labeled with (i, iv) anti-EpCAM, (ii, v) anti-TfR, or (iii, vi) nonbinding control antibodies. The antibodies were modified with (i−iii) TCO or (iv−vi) PEG24−TCO at the highest densities and reacted with tetrazine−QD at 10 nM for 30 min. Scale bar: 20 μm. Error bars represent the standard error of at least three independent experiments.
Cd71 Apc, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/CD71+Antibody%2C+anti-human%2C+REAfinity/pmc12320723-60-19-21
Average 93 stars, based on 1 article reviews
cd71 apc - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

94
R&D Systems mouse anti tfr
Figure 5. Translation of dual orthogonal coupling to different antibodies. (A) <t>Anti-TfR</t> and EpCAM antibodies had low TCO reactivity (12−15%) after direct amine-conjugation, but the PEG24− TCO increased reactive TCO density 3- to 4-fold. *MALDI-TOF analysis of the TCO−PEG24-modified anti-EpCAM antibody was limited by difficulties with desorption. (B) Flow cytometry results for TCO- and TCO−PEG24-modified anti-EpCAM and TfR antibodies on A431 cells after reaction with 10 nM tetrazine−QDs for 30 min, showing 5-fold signal enhancements for the PEG24−TCO. (C) Confocal images of A431 cells labeled with (i, iv) anti-EpCAM, (ii, v) anti-TfR, or (iii, vi) nonbinding control antibodies. The antibodies were modified with (i−iii) TCO or (iv−vi) PEG24−TCO at the highest densities and reacted with tetrazine−QD at 10 nM for 30 min. Scale bar: 20 μm. Error bars represent the standard error of at least three independent experiments.
Mouse Anti Tfr, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/Human+TfR+(Transferrin+R)+Antibody/pmc07017056-179-2-4
Average 94 stars, based on 1 article reviews
mouse anti tfr - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

90
R&D Systems tfr1 pe
Figure 5. Translation of dual orthogonal coupling to different antibodies. (A) <t>Anti-TfR</t> and EpCAM antibodies had low TCO reactivity (12−15%) after direct amine-conjugation, but the PEG24− TCO increased reactive TCO density 3- to 4-fold. *MALDI-TOF analysis of the TCO−PEG24-modified anti-EpCAM antibody was limited by difficulties with desorption. (B) Flow cytometry results for TCO- and TCO−PEG24-modified anti-EpCAM and TfR antibodies on A431 cells after reaction with 10 nM tetrazine−QDs for 30 min, showing 5-fold signal enhancements for the PEG24−TCO. (C) Confocal images of A431 cells labeled with (i, iv) anti-EpCAM, (ii, v) anti-TfR, or (iii, vi) nonbinding control antibodies. The antibodies were modified with (i−iii) TCO or (iv−vi) PEG24−TCO at the highest densities and reacted with tetrazine−QD at 10 nM for 30 min. Scale bar: 20 μm. Error bars represent the standard error of at least three independent experiments.
Tfr1 Pe, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/Human+TfR+(Transferrin+R)+PE-conjugated+Antibody/bio_rxiv__693424-162-140-141
Average 90 stars, based on 1 article reviews
tfr1 pe - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
OriGene expression constructs for tfr1
Protein sequencing results.
Expression Constructs For Tfr1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/CD71+(TFRC)+(NM_003234)+Human+Tagged+ORF+Clone/pmc05089552-43-0-23
Average 90 stars, based on 1 article reviews
expression constructs for tfr1 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

92
R&D Systems polyclonal goat antibody against cd71
Tissue transferrin receptor-1 in LTX cohort. ( A ) Representative image of IHC staining for <t>CD71</t> in the lung tissue of healthy donor. Scale: 50 µm. ( B ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with no/mild PH. Scale: 50 µm. ( C ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with moderate PH. Scale: 50 µm. ( D ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with severe PH. Scale: 50 µm. ( E ) Quantification of CD71-positive cells representing transferrin receptor-1 in lung tissues. ( F ) Correlation between the density of CD71-positive cells in the lung and mPAP in COPD. mPAP mean pulmonary artery pressure, V vessel
Polyclonal Goat Antibody Against Cd71, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/Human+TfR+(Transferrin+R)+Antibody/pmc12259483-80-16-28
Average 92 stars, based on 1 article reviews
polyclonal goat antibody against cd71 - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier

95
R&D Systems human tfr
Tissue transferrin receptor-1 in LTX cohort. ( A ) Representative image of IHC staining for <t>CD71</t> in the lung tissue of healthy donor. Scale: 50 µm. ( B ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with no/mild PH. Scale: 50 µm. ( C ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with moderate PH. Scale: 50 µm. ( D ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with severe PH. Scale: 50 µm. ( E ) Quantification of CD71-positive cells representing transferrin receptor-1 in lung tissues. ( F ) Correlation between the density of CD71-positive cells in the lung and mPAP in COPD. mPAP mean pulmonary artery pressure, V vessel
Human Tfr, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/Recombinant+Human+TfR+Protein%2C+CF/pm37376196-65-0-3
Average 95 stars, based on 1 article reviews
human tfr - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

93
OriGene 7157 rev 5 tggatggtggtacagtcagagc 3 tfrc
Tissue transferrin receptor-1 in LTX cohort. ( A ) Representative image of IHC staining for <t>CD71</t> in the lung tissue of healthy donor. Scale: 50 µm. ( B ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with no/mild PH. Scale: 50 µm. ( C ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with moderate PH. Scale: 50 µm. ( D ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with severe PH. Scale: 50 µm. ( E ) Quantification of CD71-positive cells representing transferrin receptor-1 in lung tissues. ( F ) Correlation between the density of CD71-positive cells in the lung and mPAP in COPD. mPAP mean pulmonary artery pressure, V vessel
7157 Rev 5 Tggatggtggtacagtcagagc 3 Tfrc, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+tfr/CD71+(TFRC)+(NM_001128148)+Human+Untagged+Clone/pmc12196323__oncotarget-16-28750-s001-52-75-74
Average 93 stars, based on 1 article reviews
7157 rev 5 tggatggtggtacagtcagagc 3 tfrc - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

Image Search Results


Figure 5. Translation of dual orthogonal coupling to different antibodies. (A) Anti-TfR and EpCAM antibodies had low TCO reactivity (12−15%) after direct amine-conjugation, but the PEG24− TCO increased reactive TCO density 3- to 4-fold. *MALDI-TOF analysis of the TCO−PEG24-modified anti-EpCAM antibody was limited by difficulties with desorption. (B) Flow cytometry results for TCO- and TCO−PEG24-modified anti-EpCAM and TfR antibodies on A431 cells after reaction with 10 nM tetrazine−QDs for 30 min, showing 5-fold signal enhancements for the PEG24−TCO. (C) Confocal images of A431 cells labeled with (i, iv) anti-EpCAM, (ii, v) anti-TfR, or (iii, vi) nonbinding control antibodies. The antibodies were modified with (i−iii) TCO or (iv−vi) PEG24−TCO at the highest densities and reacted with tetrazine−QD at 10 nM for 30 min. Scale bar: 20 μm. Error bars represent the standard error of at least three independent experiments.

Journal: Bioconjugate Chemistry

Article Title: Enhancing Reactivity for Bioorthogonal Pretargeting by Unmasking Antibody-Conjugated trans-Cyclooctenes

doi: 10.1021/bc500605g

Figure Lengend Snippet: Figure 5. Translation of dual orthogonal coupling to different antibodies. (A) Anti-TfR and EpCAM antibodies had low TCO reactivity (12−15%) after direct amine-conjugation, but the PEG24− TCO increased reactive TCO density 3- to 4-fold. *MALDI-TOF analysis of the TCO−PEG24-modified anti-EpCAM antibody was limited by difficulties with desorption. (B) Flow cytometry results for TCO- and TCO−PEG24-modified anti-EpCAM and TfR antibodies on A431 cells after reaction with 10 nM tetrazine−QDs for 30 min, showing 5-fold signal enhancements for the PEG24−TCO. (C) Confocal images of A431 cells labeled with (i, iv) anti-EpCAM, (ii, v) anti-TfR, or (iii, vi) nonbinding control antibodies. The antibodies were modified with (i−iii) TCO or (iv−vi) PEG24−TCO at the highest densities and reacted with tetrazine−QD at 10 nM for 30 min. Scale bar: 20 μm. Error bars represent the standard error of at least three independent experiments.

Article Snippet: Monoclonal mouse antibodies specific for human EpCAM (IgG2b, clone 158206) and transferrin receptor (TfR, IgG1, clone 29806) were purchased from R&D Systems (Minneapolis, MN).

Techniques: Conjugation Assay, Flow Cytometry, Labeling, Control

Protein sequencing results.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: Protein sequencing results.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Sequencing

A . Huh7 cells were transiently transfected with DDK tagged TFR1 cDNA. Lysate of transfected or non-transfected cells was immunoprecipitated with DDK or AF20 mAb, followed by sequential detection of the blot with DDK and TFR1 antibodies. B . Lysate of nontransfected Huh7 cells was incubated with AF20 mAb immobilized on protein G beads, or protein G beads alone to serve as a negative control, followed by Western blot detection of beads-associated proteins by antibodies against AF20, TFR1, HSP and N + /K + ATPase, respectively. Note that a minigel was used for electrophoresis, which could not resolve proteins of similar sizes.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: A . Huh7 cells were transiently transfected with DDK tagged TFR1 cDNA. Lysate of transfected or non-transfected cells was immunoprecipitated with DDK or AF20 mAb, followed by sequential detection of the blot with DDK and TFR1 antibodies. B . Lysate of nontransfected Huh7 cells was incubated with AF20 mAb immobilized on protein G beads, or protein G beads alone to serve as a negative control, followed by Western blot detection of beads-associated proteins by antibodies against AF20, TFR1, HSP and N + /K + ATPase, respectively. Note that a minigel was used for electrophoresis, which could not resolve proteins of similar sizes.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Transfection, Immunoprecipitation, Incubation, Negative Control, Western Blot, Electrophoresis

NIH 3T3 cells grown in 24-well plate with cover slips were transfected with expression constructs of DDK tagged TFR1, DDK tagged Na + /K + ATPase, or untagged HSP90. Cells were fixed with acid alcohol followed by staining with AF20, TFR1, DDK, and HSP90 antibodies, respectively. Note that AF20 mAb only revealed signals in TFR1 transfected cells, although all three proteins were successfully expressed in NIH 3T3 cells. In addition, cell death or unusual morphology (elongated) was observed in cells expressing the exogenous proteins (dead cells are indicated by arrows). All images were taken at 20x magnification.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: NIH 3T3 cells grown in 24-well plate with cover slips were transfected with expression constructs of DDK tagged TFR1, DDK tagged Na + /K + ATPase, or untagged HSP90. Cells were fixed with acid alcohol followed by staining with AF20, TFR1, DDK, and HSP90 antibodies, respectively. Note that AF20 mAb only revealed signals in TFR1 transfected cells, although all three proteins were successfully expressed in NIH 3T3 cells. In addition, cell death or unusual morphology (elongated) was observed in cells expressing the exogenous proteins (dead cells are indicated by arrows). All images were taken at 20x magnification.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Transfection, Expressing, Construct, Staining

TFR1 transfected NIH 3T3 cells were fixed and stained with either AF20 mAb (panel A) or TFR1 mAb (panel B), followed by confocal microscopy to reveal subcellular localization and 3D pattern of the protein. (C) Stacks of X axis for panels A and B, respectively.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: TFR1 transfected NIH 3T3 cells were fixed and stained with either AF20 mAb (panel A) or TFR1 mAb (panel B), followed by confocal microscopy to reveal subcellular localization and 3D pattern of the protein. (C) Stacks of X axis for panels A and B, respectively.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Transfection, Staining, Confocal Microscopy

Huh7 cell lysate was subject to immunoprecipitation with AF20 mAb and retained proteins on protein G beads were treated with PNGase F at 37°C for 1hr. Samples were directly loaded onto 10% SDS-PAGE (minigel) in duplicate followed by Western blot detection using AF20 (left) and TFR1 antibodies (right), respectively. Note that an additional protein band above the 75-kd size marker was detected by TFR1 antibody from PNGase F treated sample, most likely corresponding to deglycosylated form of TFR1 (79kDd).

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: Huh7 cell lysate was subject to immunoprecipitation with AF20 mAb and retained proteins on protein G beads were treated with PNGase F at 37°C for 1hr. Samples were directly loaded onto 10% SDS-PAGE (minigel) in duplicate followed by Western blot detection using AF20 (left) and TFR1 antibodies (right), respectively. Note that an additional protein band above the 75-kd size marker was detected by TFR1 antibody from PNGase F treated sample, most likely corresponding to deglycosylated form of TFR1 (79kDd).

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Immunoprecipitation, SDS Page, Western Blot, Marker

Three pairs of adjacent tissue sections of normal colon ( A ) and colon cancer ( B ) were stained with TFR1 (upper panels, 1:50 dilution) and AF20 mAb (lower panels, 1:500 dilution), respectively. Images were taken at 1000x magnification. Note that overexpression of both TFR1 and AF20 antigen was only observed in colon cancer but not in normal colon. In addition, the expression pattern and localization as revealed by TFR1 and AF20 Ab are indistinguishable.

Journal: PLoS ONE

Article Title: Identification of Tumor Antigen AF20 as Glycosylated Transferrin Receptor 1 in Complex with Heat Shock Protein 90 and/or Transporting ATPase

doi: 10.1371/journal.pone.0165227

Figure Lengend Snippet: Three pairs of adjacent tissue sections of normal colon ( A ) and colon cancer ( B ) were stained with TFR1 (upper panels, 1:50 dilution) and AF20 mAb (lower panels, 1:500 dilution), respectively. Images were taken at 1000x magnification. Note that overexpression of both TFR1 and AF20 antigen was only observed in colon cancer but not in normal colon. In addition, the expression pattern and localization as revealed by TFR1 and AF20 Ab are indistinguishable.

Article Snippet: Expression constructs for TFR1 (Myc-DDK-tagged, RC200980, NM_003234.1), HSP90 (untagged, SC108085, NM_007355.2), and Na + /K + ATPase (Myc-DDK-tagged, RC201009, NM_000701) were purchased from Origene.

Techniques: Staining, Over Expression, Expressing

Tissue transferrin receptor-1 in LTX cohort. ( A ) Representative image of IHC staining for CD71 in the lung tissue of healthy donor. Scale: 50 µm. ( B ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with no/mild PH. Scale: 50 µm. ( C ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with moderate PH. Scale: 50 µm. ( D ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with severe PH. Scale: 50 µm. ( E ) Quantification of CD71-positive cells representing transferrin receptor-1 in lung tissues. ( F ) Correlation between the density of CD71-positive cells in the lung and mPAP in COPD. mPAP mean pulmonary artery pressure, V vessel

Journal: Lung

Article Title: Soluble Transferrin Receptor-1 in Pulmonary Hypertension Associated with COPD

doi: 10.1007/s00408-025-00833-3

Figure Lengend Snippet: Tissue transferrin receptor-1 in LTX cohort. ( A ) Representative image of IHC staining for CD71 in the lung tissue of healthy donor. Scale: 50 µm. ( B ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with no/mild PH. Scale: 50 µm. ( C ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with moderate PH. Scale: 50 µm. ( D ) Representative image of IHC staining for CD71 in the lung tissue of end-stage COPD patient with severe PH. Scale: 50 µm. ( E ) Quantification of CD71-positive cells representing transferrin receptor-1 in lung tissues. ( F ) Correlation between the density of CD71-positive cells in the lung and mPAP in COPD. mPAP mean pulmonary artery pressure, V vessel

Article Snippet: Immunohistochemical (IHC) staining for transferrin receptor-1 (CD71) was conducted on formalin-fixed paraffin-embedded tissue sections using a polyclonal goat antibody against CD71 at 1:200 dilution (cat. #AF2474, RRID: AB_416601, R&D Systems, USA), followed by a biotinylated donkey anti-goat secondary IgG antibody (cat. #BA–9500–1.5, Vector Laboratories, USA) and an avidin–biotin complex HRP detection system from the ImmPACT NovaRED® Substrate Kit (cat. #SK-4805, Vector Laboratories, USA), as previously described [ ].

Techniques: Immunohistochemistry