Journal: bioRxiv

Article Title: Neural cell state modulation by PARK2 and dopaminergic neuroprotection by small molecule Parkin agonism

doi: 10.64898/2026.04.01.715918

Figure Lengend Snippet: ( a ) Single cell sequencing results and unsupervised clustering of WT cells (Parental1, Parental2, Parental Bulk)(n=3) and KO cells (KO1, KO2)(n=2). Four primary clusters are identified that correspond to population types shown in the legend at the bottom. Colors indicate cell types. ( b ) Parkin loss alters the relative ratio of cell types following differentiation induction. Frequency of resulting cellular types from differentiation in each genotype is shown as a stacked bar plot for each sample. ( c ) Parkin KO results in alterations in transcription factors related to neuronal cell state. DecoupleR analysis was performed on differentially expressed genes between WT and KO neuronal-like cells. DecoupleR TF scores are plotted for each genotype. ( d ) Examples of Parkin KO-induced alterations in the expression of genes important for each cell type. Differential expression was performed to identify the top and bottom 5 genes by log2FC. Data shown as dot plots with the size of each dot representing the cell percentage expressing the gene, and the color scale indicating the average normalized expression level. ( e ) GSEA analysis of differentially expressed genes between KO neuronal cells and WT neuronal cells (x-axis represents the normalized enrichment score; dot size shows the gene set size; color shows p-value). ( f ) Genes from the gene ontology set Ribosome Assembly were selected, and the Log2FC is shown for KO vs WT cells as shown. Each row represents the KO vs WT comparison for the indicated cell type. ( g ) Chemical Structure of compound FB231. ( h ) Concentration of FB231 in the plasma of rats with IV and IP administration. Rats were treated with intravenous injection (1 mg/kg) and i.p. injection (3 mg/kg). ( i ) Immunoprecipitation (IP) of Parkin constructs. T98G cells were transfected with either pcDNA3.1 empty vector (EV) or with vector encoding WT Parkin. Cell lysates were prepared and immunoprecipitated with anti-Parkin antibody. ( j ) FB231 promotes Parkin activity to ubiquitinate cyclin D in vitro. Using Parkin IP, in vitro ubiquitination assay was performed. Different concentrations of compound FB231 were added in the indicated reactions. ( k ) Compound FB231 promotes Parkin activity to ubiquitinate αSyn in vitro. Using the above Parkin-pulled-down solution , an in vitro ubiquitination assay was performed, followed by a Western blot. Different concentrations of compound FB231 were added as indicated.

Article Snippet: Finally, αSyn primers (Origene, HP200326) had the following sequence for forward and reverse primers, respectively: ACCAAACAGGGTGTGGCAGAAG and CTTGCTCTTTGGTCTTCTCAGCC.

Techniques: Single Cell, Sequencing, Expressing, Quantitative Proteomics, Comparison, Concentration Assay, Clinical Proteomics, Injection, Immunoprecipitation, Construct, Transfection, Plasmid Preparation, Activity Assay, In Vitro, Ubiquitin Proteomics, Western Blot

Journal: F1000Research

Article Title: Does inactivation of USP14 enhance degradation of proteasomal substrates that are associated with neurodegenerative diseases?

doi: 10.12688/f1000research.7800.2

Figure Lengend Snippet: U2OS cells stably expressing Flag-α-synuclein were treated with 100nM USP14 siRNA from Ambion (A58, A59, A60 or A90) for 60 or 96 hours ( A ). Scrambled siRNA (AS) served as control for the specificity of the siRNA knockdown. Despite 50–75% knockdown of basal USP14 protein levels ( B ), no changes in Flag-α-synuclein expression were detected ( C ).

Article Snippet: Human α-synuclein-Flag CMV6 expression vector was purchased from Origene (#RC221446) and confirmed by sequencing.

Techniques: Stable Transfection, Expressing

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: A53T mutant α-synuclein fibrils formed in macrophage are spread to neurons

doi: 10.1007/s00018-022-04263-9

Figure Lengend Snippet: Localizations of transgenes in double transgenic zebrafish larvae at 5 days post fertilization. a, b mpeg-expressing cells are shown in green (mpeg:EGFP). Localization of αS expressed in mpeg-expressing cells is shown in red (mpeg:SNCA-KO2). c, d mpeg-expressing cells are shown in green (mpeg:EGFP). Localization of αS_A53T expressed in mpeg-expressing cells is shown in red (mpeg:SNCA_A53T-KO2). The white arrowheads indicate co-localization of EGFP and SNCA_A53T-KO2. e, f HuC-expressing cells are shown in green (HuC:EGFP). Localization of αS_A53T expressed in mpeg-expressing cells is shown in red (mpeg:SNCA_A53T-KO2). The white arrowheads indicate co-localization of EGFP and SNCA_A53T-KO2. g HuC-expressing cells are shown in green (HuC:EGFP). Localization of αS expressed in HuC-expressing cells is shown in red (HuC:SNCA -KO2). h HuC-expressing cells are shown in green (HuC:EGFP). Localization of αS_A53T expressed in HuC-expressing cells is shown in red (HuC:SNCA_A53T -KO2). (a, c, e, g, h), lateral view; (b, d, f), ventral view. Scale bar: 500 μm (a, c, e, g, h), 100 μm (b, d, f). Insets are for enlargement (c, e)

Article Snippet: Human SNCA coding region without stop codon amplified with human SNCA full-length cDNA clone (OriGene Technologies, MD, USA) was ligated with Kusabira Orange2 ( KO2 ) coding region amplified with phmKO2-MN1 vector (MBL, Aichi, Japan).

Techniques: Transgenic Assay, Expressing

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: A53T mutant α-synuclein fibrils formed in macrophage are spread to neurons

doi: 10.1007/s00018-022-04263-9

Figure Lengend Snippet: αS protein in wild type, Tg(mpeg:SNCA-KO2), Tg(mpeg:SNCA_A53T-KO2), Tg(HuC:SNCA-KO2), and Tg(HuC:SNCA_A53T-KO2) zebrafish

Article Snippet: Human SNCA coding region without stop codon amplified with human SNCA full-length cDNA clone (OriGene Technologies, MD, USA) was ligated with Kusabira Orange2 ( KO2 ) coding region amplified with phmKO2-MN1 vector (MBL, Aichi, Japan).

Techniques:

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: A53T mutant α-synuclein fibrils formed in macrophage are spread to neurons

doi: 10.1007/s00018-022-04263-9

Figure Lengend Snippet: Transcriptome analysis among wild type, Tg(mpeg:SNCA-KO2) and Tg(mpeg:SNCA_A53T-KO2) zebrafish. a Venn diagram of isolated genes by three comparisons. b Heatmap of genes expressed significantly different between Tg(mpeg:SNCA-KO2) and Tg(mpeg:SNCA_A53T-KO2) zebrafish. c Gene ontology enrichment analysis with MonaGO of the isolated genes between Tg(mpeg:SNCA-KO2) and Tg(mpeg:SNCA_A53T-KO2) zebrafish

Article Snippet: Human SNCA coding region without stop codon amplified with human SNCA full-length cDNA clone (OriGene Technologies, MD, USA) was ligated with Kusabira Orange2 ( KO2 ) coding region amplified with phmKO2-MN1 vector (MBL, Aichi, Japan).

Techniques: Isolation

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: A53T mutant α-synuclein fibrils formed in macrophage are spread to neurons

doi: 10.1007/s00018-022-04263-9

Figure Lengend Snippet: Transcriptome analysis among wild type, Tg(mpeg:SNCA-KO2) and Tg(mpeg:SNCA_A53T-KO2) zebrafish. a Heatmap of post-translational modification-related genes expressed significantly higher in both Tg(mpeg:SNCA-KO2) and Tg(mpeg:SNCA_A53T-KO2). Gene names in black are kinase genes; gene names in red are E3 ubiquitin protein ligase genes. b Gene ontology enrichment analysis with MonaGO of the isolated genes in both Tg(mpeg:SNCA-KO2) and Tg(mpeg:SNCA_A53T-KO2)

Article Snippet: Human SNCA coding region without stop codon amplified with human SNCA full-length cDNA clone (OriGene Technologies, MD, USA) was ligated with Kusabira Orange2 ( KO2 ) coding region amplified with phmKO2-MN1 vector (MBL, Aichi, Japan).

Techniques: Modification, Ubiquitin Proteomics, Isolation