human rig Search Results


rabbit antip p53  (R&D Systems)
93
R&D Systems rabbit antip p53
FIGURE 5 PAI-1 induced <t>p53</t> upregulation is critical for the subsequent maladaptive response. A, Western blot assessments for total and p-p53 protein levels between CMV-Con and CMV-PAI-1 populations. B-C, Histograms depicting the relative expression of p53 levels (mean ± SD) for three independent studies, n = 3. D-G, Lysates of CMV-PAI-1+Con-shRNA and CMV-PAI-1+p53-shRNA double transductants are immunoblotted for p53 (D, E; P < .001), p21 (D, F; P < .01), p-H3 (D, G; P < .01), fibronectin (H, I; P < .01), collagen-1 (H, J; P < .01). Histograms in (E-G) and (I-J) depict the relative expression (mean ± SD) for indicated proteins from the immunoblots in (D) and (H), shown as biological triplicates for three independent studies (n = 3). K, Confluent monolayers of CMV-PAI-1+Con-shRNA and CMV-PAI-1+p53- shRNA HK2 cultures are serum-starved for 6 days. Phase contrast and crystal violet images are taken on day 0 and day 6 to assess cell monolayer detachment. Scale bar = 400 µm. L, Western blot analysis for FAK and p-ERK1/2 protein levels between CMV-Con and CMV-PAI-1 cultures, with ERK2 serving as a loading control, (n = 3). *P < .05, **P < .01, ***P < .001
Rabbit Antip P53, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/10__1096_slash_fj__202002652rr-32-183-188?v=R%26D+Systems
Average 93 stars, based on 1 article reviews
rabbit antip p53 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier
ly6e  (OriGene)
91
OriGene ly6e
FIGURE 5 PAI-1 induced <t>p53</t> upregulation is critical for the subsequent maladaptive response. A, Western blot assessments for total and p-p53 protein levels between CMV-Con and CMV-PAI-1 populations. B-C, Histograms depicting the relative expression of p53 levels (mean ± SD) for three independent studies, n = 3. D-G, Lysates of CMV-PAI-1+Con-shRNA and CMV-PAI-1+p53-shRNA double transductants are immunoblotted for p53 (D, E; P < .001), p21 (D, F; P < .01), p-H3 (D, G; P < .01), fibronectin (H, I; P < .01), collagen-1 (H, J; P < .01). Histograms in (E-G) and (I-J) depict the relative expression (mean ± SD) for indicated proteins from the immunoblots in (D) and (H), shown as biological triplicates for three independent studies (n = 3). K, Confluent monolayers of CMV-PAI-1+Con-shRNA and CMV-PAI-1+p53- shRNA HK2 cultures are serum-starved for 6 days. Phase contrast and crystal violet images are taken on day 0 and day 6 to assess cell monolayer detachment. Scale bar = 400 µm. L, Western blot analysis for FAK and p-ERK1/2 protein levels between CMV-Con and CMV-PAI-1 cultures, with ERK2 serving as a loading control, (n = 3). *P < .05, **P < .01, ***P < .001
Ly6e, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/pm37676001-203-4-8?v=OriGene
Average 91 stars, based on 1 article reviews
ly6e - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier
duoset ic human phospho p53 s15 elisa  (R&D Systems)
90
R&D Systems duoset ic human phospho p53 s15 elisa
Figure 5. Effect of RSV and/or cisplatin on <t>p53</t> phosphorylation in FaDu cell line. Phosphorylated (phos-) and total p53 protein expression in FaDu cell line treated with RSV 50μM and/or CisPt 10μM for 24h in presence or absence of SB203580 inhibitor (A). The results were analyzed and used to calculate the phospho-p53 /total p53 ratios (B). Results are presented in graphics as mean ± standard errors from three independent experiments.
Duoset Ic Human Phospho P53 S15 Elisa, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/10__25083_slash_rbl_slash_24__1_slash_118__128-67-12-42?v=R%26D+Systems
Average 90 stars, based on 1 article reviews
duoset ic human phospho p53 s15 elisa - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
pp53 ser15  (R&D Systems)
94
R&D Systems pp53 ser15
Figure 5. Effect of RSV and/or cisplatin on <t>p53</t> phosphorylation in FaDu cell line. Phosphorylated (phos-) and total p53 protein expression in FaDu cell line treated with RSV 50μM and/or CisPt 10μM for 24h in presence or absence of SB203580 inhibitor (A). The results were analyzed and used to calculate the phospho-p53 /total p53 ratios (B). Results are presented in graphics as mean ± standard errors from three independent experiments.
Pp53 Ser15, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/pmc07700231-182-70-73?v=R%26D+Systems
Average 94 stars, based on 1 article reviews
pp53 ser15 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier
gctcaggcttacgttgacaagg  (OriGene)
94
OriGene gctcaggcttacgttgacaagg
Primers
Gctcaggcttacgttgacaagg, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/pmc03488571-21-3-5?v=OriGene
Average 94 stars, based on 1 article reviews
gctcaggcttacgttgacaagg - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier
hct116 tp53 cells  (OriGene)
91
OriGene hct116 tp53 cells
(a) Comet assay detecting basal nuclear DNA damage in WRNIP1 KO cells versus WT. Quantification of comet tail DNA % is measured by ImageJ using microscopy images (n = 3 discrete replicates). Data points represent each individual cell analyzed. (b) Detection of γH2AX foci representing nuclear DNA damage in Dox and mtDox treated cells. Microscopy images comparing 24-hour treatment of <t>HCT116</t> <t>TP53</t> (-/-) cells with 8 µM mtDox and 25 nM Dox with and without 10 mM N -acetyl cysteine (NAC) antioxidant treatment. Moderate γH2AX detection in mtDox treated cells is attenuated by antioxidant treatment, while cells treated with Dox still display pronounced nuclear DNA damage in the presence of antioxidant. (c) Clonogenic survival comparing representative survival of cell lines treated with 8 μM mtDox. KO-1 and KO-2 represent two monoclonal WRNIP1 KO lines of HCT116 TP53 (-/-) (WT). The reintroduction of a WRNIP1 construct shows partial but incomplete recovery of the monoclonal KO lines to WT standard (n = 4, p -values are compared to WT, * p < 0.00001, ** p < 0.009) All p -values determined using unpaired t -test. Data represented as mean ± s.d.
Hct116 Tp53 Cells, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/bio_rxiv__2023__10__03__560559-286-0-14?v=OriGene
Average 91 stars, based on 1 article reviews
hct116 tp53 cells - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier
myc ddk tagged rps15  (OriGene)
90
OriGene myc ddk tagged rps15
(a) Comet assay detecting basal nuclear DNA damage in WRNIP1 KO cells versus WT. Quantification of comet tail DNA % is measured by ImageJ using microscopy images (n = 3 discrete replicates). Data points represent each individual cell analyzed. (b) Detection of γH2AX foci representing nuclear DNA damage in Dox and mtDox treated cells. Microscopy images comparing 24-hour treatment of <t>HCT116</t> <t>TP53</t> (-/-) cells with 8 µM mtDox and 25 nM Dox with and without 10 mM N -acetyl cysteine (NAC) antioxidant treatment. Moderate γH2AX detection in mtDox treated cells is attenuated by antioxidant treatment, while cells treated with Dox still display pronounced nuclear DNA damage in the presence of antioxidant. (c) Clonogenic survival comparing representative survival of cell lines treated with 8 μM mtDox. KO-1 and KO-2 represent two monoclonal WRNIP1 KO lines of HCT116 TP53 (-/-) (WT). The reintroduction of a WRNIP1 construct shows partial but incomplete recovery of the monoclonal KO lines to WT standard (n = 4, p -values are compared to WT, * p < 0.00001, ** p < 0.009) All p -values determined using unpaired t -test. Data represented as mean ± s.d.
Myc Ddk Tagged Rps15, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/pmc04768426-121-0-21?v=OriGene
Average 90 stars, based on 1 article reviews
myc ddk tagged rps15 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
ifit3 cdna  (OriGene)
90
OriGene ifit3 cdna
(a) Comet assay detecting basal nuclear DNA damage in WRNIP1 KO cells versus WT. Quantification of comet tail DNA % is measured by ImageJ using microscopy images (n = 3 discrete replicates). Data points represent each individual cell analyzed. (b) Detection of γH2AX foci representing nuclear DNA damage in Dox and mtDox treated cells. Microscopy images comparing 24-hour treatment of <t>HCT116</t> <t>TP53</t> (-/-) cells with 8 µM mtDox and 25 nM Dox with and without 10 mM N -acetyl cysteine (NAC) antioxidant treatment. Moderate γH2AX detection in mtDox treated cells is attenuated by antioxidant treatment, while cells treated with Dox still display pronounced nuclear DNA damage in the presence of antioxidant. (c) Clonogenic survival comparing representative survival of cell lines treated with 8 μM mtDox. KO-1 and KO-2 represent two monoclonal WRNIP1 KO lines of HCT116 TP53 (-/-) (WT). The reintroduction of a WRNIP1 construct shows partial but incomplete recovery of the monoclonal KO lines to WT standard (n = 4, p -values are compared to WT, * p < 0.00001, ** p < 0.009) All p -values determined using unpaired t -test. Data represented as mean ± s.d.
Ifit3 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/pmc03457001-211-0-2?v=OriGene
Average 90 stars, based on 1 article reviews
ifit3 cdna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
pcmv6 ac gfp ddx58  (OriGene)
90
OriGene pcmv6 ac gfp ddx58
(a) Comet assay detecting basal nuclear DNA damage in WRNIP1 KO cells versus WT. Quantification of comet tail DNA % is measured by ImageJ using microscopy images (n = 3 discrete replicates). Data points represent each individual cell analyzed. (b) Detection of γH2AX foci representing nuclear DNA damage in Dox and mtDox treated cells. Microscopy images comparing 24-hour treatment of <t>HCT116</t> <t>TP53</t> (-/-) cells with 8 µM mtDox and 25 nM Dox with and without 10 mM N -acetyl cysteine (NAC) antioxidant treatment. Moderate γH2AX detection in mtDox treated cells is attenuated by antioxidant treatment, while cells treated with Dox still display pronounced nuclear DNA damage in the presence of antioxidant. (c) Clonogenic survival comparing representative survival of cell lines treated with 8 μM mtDox. KO-1 and KO-2 represent two monoclonal WRNIP1 KO lines of HCT116 TP53 (-/-) (WT). The reintroduction of a WRNIP1 construct shows partial but incomplete recovery of the monoclonal KO lines to WT standard (n = 4, p -values are compared to WT, * p < 0.00001, ** p < 0.009) All p -values determined using unpaired t -test. Data represented as mean ± s.d.
Pcmv6 Ac Gfp Ddx58, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/pmc07072305-128-7-27?v=OriGene
Average 90 stars, based on 1 article reviews
pcmv6 ac gfp ddx58 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
homo sapiens dickkopf homolog 3  (OriGene)
90
OriGene homo sapiens dickkopf homolog 3
(a) Comet assay detecting basal nuclear DNA damage in WRNIP1 KO cells versus WT. Quantification of comet tail DNA % is measured by ImageJ using microscopy images (n = 3 discrete replicates). Data points represent each individual cell analyzed. (b) Detection of γH2AX foci representing nuclear DNA damage in Dox and mtDox treated cells. Microscopy images comparing 24-hour treatment of <t>HCT116</t> <t>TP53</t> (-/-) cells with 8 µM mtDox and 25 nM Dox with and without 10 mM N -acetyl cysteine (NAC) antioxidant treatment. Moderate γH2AX detection in mtDox treated cells is attenuated by antioxidant treatment, while cells treated with Dox still display pronounced nuclear DNA damage in the presence of antioxidant. (c) Clonogenic survival comparing representative survival of cell lines treated with 8 μM mtDox. KO-1 and KO-2 represent two monoclonal WRNIP1 KO lines of HCT116 TP53 (-/-) (WT). The reintroduction of a WRNIP1 construct shows partial but incomplete recovery of the monoclonal KO lines to WT standard (n = 4, p -values are compared to WT, * p < 0.00001, ** p < 0.009) All p -values determined using unpaired t -test. Data represented as mean ± s.d.
Homo Sapiens Dickkopf Homolog 3, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/pm23538390-62-8-25?v=OriGene
Average 90 stars, based on 1 article reviews
homo sapiens dickkopf homolog 3 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
human plasmids  (OriGene)
90
OriGene human plasmids
(a) Comet assay detecting basal nuclear DNA damage in WRNIP1 KO cells versus WT. Quantification of comet tail DNA % is measured by ImageJ using microscopy images (n = 3 discrete replicates). Data points represent each individual cell analyzed. (b) Detection of γH2AX foci representing nuclear DNA damage in Dox and mtDox treated cells. Microscopy images comparing 24-hour treatment of <t>HCT116</t> <t>TP53</t> (-/-) cells with 8 µM mtDox and 25 nM Dox with and without 10 mM N -acetyl cysteine (NAC) antioxidant treatment. Moderate γH2AX detection in mtDox treated cells is attenuated by antioxidant treatment, while cells treated with Dox still display pronounced nuclear DNA damage in the presence of antioxidant. (c) Clonogenic survival comparing representative survival of cell lines treated with 8 μM mtDox. KO-1 and KO-2 represent two monoclonal WRNIP1 KO lines of HCT116 TP53 (-/-) (WT). The reintroduction of a WRNIP1 construct shows partial but incomplete recovery of the monoclonal KO lines to WT standard (n = 4, p -values are compared to WT, * p < 0.00001, ** p < 0.009) All p -values determined using unpaired t -test. Data represented as mean ± s.d.
Human Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+rig/pm29368982-189-33-38?v=OriGene
Average 90 stars, based on 1 article reviews
human plasmids - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


FIGURE 5 PAI-1 induced p53 upregulation is critical for the subsequent maladaptive response. A, Western blot assessments for total and p-p53 protein levels between CMV-Con and CMV-PAI-1 populations. B-C, Histograms depicting the relative expression of p53 levels (mean ± SD) for three independent studies, n = 3. D-G, Lysates of CMV-PAI-1+Con-shRNA and CMV-PAI-1+p53-shRNA double transductants are immunoblotted for p53 (D, E; P < .001), p21 (D, F; P < .01), p-H3 (D, G; P < .01), fibronectin (H, I; P < .01), collagen-1 (H, J; P < .01). Histograms in (E-G) and (I-J) depict the relative expression (mean ± SD) for indicated proteins from the immunoblots in (D) and (H), shown as biological triplicates for three independent studies (n = 3). K, Confluent monolayers of CMV-PAI-1+Con-shRNA and CMV-PAI-1+p53- shRNA HK2 cultures are serum-starved for 6 days. Phase contrast and crystal violet images are taken on day 0 and day 6 to assess cell monolayer detachment. Scale bar = 400 µm. L, Western blot analysis for FAK and p-ERK1/2 protein levels between CMV-Con and CMV-PAI-1 cultures, with ERK2 serving as a loading control, (n = 3). *P < .05, **P < .01, ***P < .001

Journal: The FASEB Journal

Article Title: PAI‐1 induction during kidney injury promotes fibrotic epithelial dysfunction via deregulation of klotho, p53, and TGF‐β1‐receptor signaling

doi: 10.1096/fj.202002652rr

Figure Lengend Snippet: FIGURE 5 PAI-1 induced p53 upregulation is critical for the subsequent maladaptive response. A, Western blot assessments for total and p-p53 protein levels between CMV-Con and CMV-PAI-1 populations. B-C, Histograms depicting the relative expression of p53 levels (mean ± SD) for three independent studies, n = 3. D-G, Lysates of CMV-PAI-1+Con-shRNA and CMV-PAI-1+p53-shRNA double transductants are immunoblotted for p53 (D, E; P < .001), p21 (D, F; P < .01), p-H3 (D, G; P < .01), fibronectin (H, I; P < .01), collagen-1 (H, J; P < .01). Histograms in (E-G) and (I-J) depict the relative expression (mean ± SD) for indicated proteins from the immunoblots in (D) and (H), shown as biological triplicates for three independent studies (n = 3). K, Confluent monolayers of CMV-PAI-1+Con-shRNA and CMV-PAI-1+p53- shRNA HK2 cultures are serum-starved for 6 days. Phase contrast and crystal violet images are taken on day 0 and day 6 to assess cell monolayer detachment. Scale bar = 400 µm. L, Western blot analysis for FAK and p-ERK1/2 protein levels between CMV-Con and CMV-PAI-1 cultures, with ERK2 serving as a loading control, (n = 3). *P < .05, **P < .01, ***P < .001

Article Snippet: Overnight incubation at 4°C utilized the following primary antibodies; rabbit anti- PAI- 1 (1:3000) and rabbit anti- collagen- 1 (1:5000) as previously described,15 rat anti- klotho (1:5000; Transgenic Inc.- KM2119), rabbit anti- SMAD3 (1:1000; Cell Signaling- 9523), rabbit anti- p- Histone3 (1:1000; Cell Signaling- 9701), rabbit anti- p21 (1:1000; Cell Signaling- 2947), rabbit anti- caspase- 9 (1:1000; Cell Signaling- 9502), rabbit anti- c- caspase- 3 (1:1000; Cell Signaling- 9661), rabbit antiSnail1 (1:1000; Cell Signaling- 38798s), rabbit anti- α- SMA (1:1000; Abcam- ab32575), rabbit anti- phospho- SMAD3 (1:1000; Abcam- ab52903), rabbit anti- fibronectin (1:100,000; Abcam- ab2413), rabbit anti- LOXL2 (1:1000; Abcam- ab96233), rabbit anti- MMP- 9 (1:1000; Abcam- ab38898), rabbit antiMMP- 2 (1:1000; Abcam- ab97779), rabbit anti- VEGF- C (1:1000; Abcam- ab9546), rabbit anti- endothelin- 1 (1:1000; 18201- IBL America, Minneapolis, MN, USA), rabbit antivimentin (1:10,000; Santa Cruz- sc5565), rabbit anti- GAPDH (1:5000; Santa Cruz- sc25778), goat anti- CCN2 (1:500; Santa Cruz- sc14939), rabbit anti- TGF- βRI (1:1000; Santa Cruz- sc9048), rabbit anti- TGF- βRII (1:1000; Santa Cruz- sc220), mouse anti- p53 (1:1000; Santa Cruz- sc126), mouse anti- Ecadherin (1:1000; BD Biosciences- 610181), and rabbit antip- p53 (1:1000; AF1043- R&D systems, Minneapolis, MN, USA).

Techniques: Western Blot, Expressing, shRNA, Control

FIGURE 6 Klotho downregulation consequent to PAI-1 induction contributes to epithelial dysfunction. A-C, Immunoblot analysis of CMV- Con and CMV-PAI-1 cell lysates for PAI-1 (A, B; P < .001) and klotho (A, C; P < .01) expression. Histograms in (B-C) represent the relative expression of the indicated proteins as (mean ± SD) for three independent studies (n = 3). D-I, Protein extracts of CMV-PAI-1+CMV-Con and CMV-PAI-1+CMV-Klotho double transgenic cultures are immunoblotted for klotho (D, E; P < .001), CCN2 (D, F; P < .001), p21 (D, G; P < .01), p53 (D, H; P < .001), p-SMAD3 (D, I; P < .01). GAPDH serves as loading control. Histograms in (E-I) depict the relative levels (mean ± SD) of the indicated proteins for three separate experiments (n = 3). **P < .01, ***P < .001

Journal: The FASEB Journal

Article Title: PAI‐1 induction during kidney injury promotes fibrotic epithelial dysfunction via deregulation of klotho, p53, and TGF‐β1‐receptor signaling

doi: 10.1096/fj.202002652rr

Figure Lengend Snippet: FIGURE 6 Klotho downregulation consequent to PAI-1 induction contributes to epithelial dysfunction. A-C, Immunoblot analysis of CMV- Con and CMV-PAI-1 cell lysates for PAI-1 (A, B; P < .001) and klotho (A, C; P < .01) expression. Histograms in (B-C) represent the relative expression of the indicated proteins as (mean ± SD) for three independent studies (n = 3). D-I, Protein extracts of CMV-PAI-1+CMV-Con and CMV-PAI-1+CMV-Klotho double transgenic cultures are immunoblotted for klotho (D, E; P < .001), CCN2 (D, F; P < .001), p21 (D, G; P < .01), p53 (D, H; P < .001), p-SMAD3 (D, I; P < .01). GAPDH serves as loading control. Histograms in (E-I) depict the relative levels (mean ± SD) of the indicated proteins for three separate experiments (n = 3). **P < .01, ***P < .001

Article Snippet: Overnight incubation at 4°C utilized the following primary antibodies; rabbit anti- PAI- 1 (1:3000) and rabbit anti- collagen- 1 (1:5000) as previously described,15 rat anti- klotho (1:5000; Transgenic Inc.- KM2119), rabbit anti- SMAD3 (1:1000; Cell Signaling- 9523), rabbit anti- p- Histone3 (1:1000; Cell Signaling- 9701), rabbit anti- p21 (1:1000; Cell Signaling- 2947), rabbit anti- caspase- 9 (1:1000; Cell Signaling- 9502), rabbit anti- c- caspase- 3 (1:1000; Cell Signaling- 9661), rabbit antiSnail1 (1:1000; Cell Signaling- 38798s), rabbit anti- α- SMA (1:1000; Abcam- ab32575), rabbit anti- phospho- SMAD3 (1:1000; Abcam- ab52903), rabbit anti- fibronectin (1:100,000; Abcam- ab2413), rabbit anti- LOXL2 (1:1000; Abcam- ab96233), rabbit anti- MMP- 9 (1:1000; Abcam- ab38898), rabbit antiMMP- 2 (1:1000; Abcam- ab97779), rabbit anti- VEGF- C (1:1000; Abcam- ab9546), rabbit anti- endothelin- 1 (1:1000; 18201- IBL America, Minneapolis, MN, USA), rabbit antivimentin (1:10,000; Santa Cruz- sc5565), rabbit anti- GAPDH (1:5000; Santa Cruz- sc25778), goat anti- CCN2 (1:500; Santa Cruz- sc14939), rabbit anti- TGF- βRI (1:1000; Santa Cruz- sc9048), rabbit anti- TGF- βRII (1:1000; Santa Cruz- sc220), mouse anti- p53 (1:1000; Santa Cruz- sc126), mouse anti- Ecadherin (1:1000; BD Biosciences- 610181), and rabbit antip- p53 (1:1000; AF1043- R&D systems, Minneapolis, MN, USA).

Techniques: Western Blot, Expressing, Transgenic Assay, Control

FIGURE 8 Dysfunction driven by PAI-1 overexpression is independent of TGF-β1 ligand synthesis or release. A, ELISA analysis for active TGF-β1 ligand concentrations in the conditioned media isolated from serum-starved CMV-Con and CMV-PAI-1 cultures. n = 3. B-D, Cytokine protein array analysis of CMV-Con and CMV-PAI-1 conditioned media for active TGF-β1 (B), TGF-β2 (C), and TGF-β3 (D). Graphs depict the relative levels of secreted ligands (mean ± SD), n = 3. E, Immunoblot comparison of fibrotic responses in the cellular lysates of TGF-β1 stimulated or unstimulated CMV-Con and untreated CMV-PAI-1 culture extracted in parallel. F, CMV-Con HK2 cells pretreated with 20 μg/mL of TGF-β1 neutralizing antibody or 20 μg/mL IgY control antisera are stimulated with 2 ng/mL TGF-β1. Cells are harvested after 24 hours and expression of p-SMAD3, fibronectin and E-cadherin are analyzed by western blot. n = 3. G, Equally seeded CMV-PAI-1 HK2s are treated with various concentrations of TGF-β1 neutralizing antibody (0, 20, 40, 60 μg/mL) or 60 μg/mL IgY control antisera for 24 hours prior to western blot analysis of extracts for p-SMAD3, fibronectin, collagen-1, vimentin, p53 and p21, with GAPDH is serving as a loading marker. n = 3, *P < .05, **P < .01, ***P < .001, n.s., not significant. H, Western blot analysis of cell lysate extracts from CMV-PAI-1+Con shRNA and CMV-PAI-1+TGF-β1 shRNA HK2 cells for the indicated fibrotic markers. Cytokine protein array analysis of whole cell lysates (I) and conditioned media (J) used to validate TGF-β1 knockdown

Journal: The FASEB Journal

Article Title: PAI‐1 induction during kidney injury promotes fibrotic epithelial dysfunction via deregulation of klotho, p53, and TGF‐β1‐receptor signaling

doi: 10.1096/fj.202002652rr

Figure Lengend Snippet: FIGURE 8 Dysfunction driven by PAI-1 overexpression is independent of TGF-β1 ligand synthesis or release. A, ELISA analysis for active TGF-β1 ligand concentrations in the conditioned media isolated from serum-starved CMV-Con and CMV-PAI-1 cultures. n = 3. B-D, Cytokine protein array analysis of CMV-Con and CMV-PAI-1 conditioned media for active TGF-β1 (B), TGF-β2 (C), and TGF-β3 (D). Graphs depict the relative levels of secreted ligands (mean ± SD), n = 3. E, Immunoblot comparison of fibrotic responses in the cellular lysates of TGF-β1 stimulated or unstimulated CMV-Con and untreated CMV-PAI-1 culture extracted in parallel. F, CMV-Con HK2 cells pretreated with 20 μg/mL of TGF-β1 neutralizing antibody or 20 μg/mL IgY control antisera are stimulated with 2 ng/mL TGF-β1. Cells are harvested after 24 hours and expression of p-SMAD3, fibronectin and E-cadherin are analyzed by western blot. n = 3. G, Equally seeded CMV-PAI-1 HK2s are treated with various concentrations of TGF-β1 neutralizing antibody (0, 20, 40, 60 μg/mL) or 60 μg/mL IgY control antisera for 24 hours prior to western blot analysis of extracts for p-SMAD3, fibronectin, collagen-1, vimentin, p53 and p21, with GAPDH is serving as a loading marker. n = 3, *P < .05, **P < .01, ***P < .001, n.s., not significant. H, Western blot analysis of cell lysate extracts from CMV-PAI-1+Con shRNA and CMV-PAI-1+TGF-β1 shRNA HK2 cells for the indicated fibrotic markers. Cytokine protein array analysis of whole cell lysates (I) and conditioned media (J) used to validate TGF-β1 knockdown

Article Snippet: Overnight incubation at 4°C utilized the following primary antibodies; rabbit anti- PAI- 1 (1:3000) and rabbit anti- collagen- 1 (1:5000) as previously described,15 rat anti- klotho (1:5000; Transgenic Inc.- KM2119), rabbit anti- SMAD3 (1:1000; Cell Signaling- 9523), rabbit anti- p- Histone3 (1:1000; Cell Signaling- 9701), rabbit anti- p21 (1:1000; Cell Signaling- 2947), rabbit anti- caspase- 9 (1:1000; Cell Signaling- 9502), rabbit anti- c- caspase- 3 (1:1000; Cell Signaling- 9661), rabbit antiSnail1 (1:1000; Cell Signaling- 38798s), rabbit anti- α- SMA (1:1000; Abcam- ab32575), rabbit anti- phospho- SMAD3 (1:1000; Abcam- ab52903), rabbit anti- fibronectin (1:100,000; Abcam- ab2413), rabbit anti- LOXL2 (1:1000; Abcam- ab96233), rabbit anti- MMP- 9 (1:1000; Abcam- ab38898), rabbit antiMMP- 2 (1:1000; Abcam- ab97779), rabbit anti- VEGF- C (1:1000; Abcam- ab9546), rabbit anti- endothelin- 1 (1:1000; 18201- IBL America, Minneapolis, MN, USA), rabbit antivimentin (1:10,000; Santa Cruz- sc5565), rabbit anti- GAPDH (1:5000; Santa Cruz- sc25778), goat anti- CCN2 (1:500; Santa Cruz- sc14939), rabbit anti- TGF- βRI (1:1000; Santa Cruz- sc9048), rabbit anti- TGF- βRII (1:1000; Santa Cruz- sc220), mouse anti- p53 (1:1000; Santa Cruz- sc126), mouse anti- Ecadherin (1:1000; BD Biosciences- 610181), and rabbit antip- p53 (1:1000; AF1043- R&D systems, Minneapolis, MN, USA).

Techniques: Over Expression, Enzyme-linked Immunosorbent Assay, Isolation, Protein Array, Western Blot, Comparison, Control, Expressing, Marker, shRNA, Knockdown

FIGURE 9 Model. PAI-1 upregulation leads to downregulation of klotho, upregulation of p53, and induction of TGF-β1 receptor signaling independent of the TGF-β1 ligand, resulting in expression and secretion of fibrotic markers, downregulation of E-cadherin and upregulation of vimentin, leading to dedifferentiation, and upregulation of p21, p-H3, causing G2/M cell cycle arrest and a propensity to cell death, collectively establishing a role for PAI-1 in tubular epithelial dysfunction. Klotho regulates both p53 and SMAD3 signaling, promoting PAI-1-mediated tubular maladaptive responses

Journal: The FASEB Journal

Article Title: PAI‐1 induction during kidney injury promotes fibrotic epithelial dysfunction via deregulation of klotho, p53, and TGF‐β1‐receptor signaling

doi: 10.1096/fj.202002652rr

Figure Lengend Snippet: FIGURE 9 Model. PAI-1 upregulation leads to downregulation of klotho, upregulation of p53, and induction of TGF-β1 receptor signaling independent of the TGF-β1 ligand, resulting in expression and secretion of fibrotic markers, downregulation of E-cadherin and upregulation of vimentin, leading to dedifferentiation, and upregulation of p21, p-H3, causing G2/M cell cycle arrest and a propensity to cell death, collectively establishing a role for PAI-1 in tubular epithelial dysfunction. Klotho regulates both p53 and SMAD3 signaling, promoting PAI-1-mediated tubular maladaptive responses

Article Snippet: Overnight incubation at 4°C utilized the following primary antibodies; rabbit anti- PAI- 1 (1:3000) and rabbit anti- collagen- 1 (1:5000) as previously described,15 rat anti- klotho (1:5000; Transgenic Inc.- KM2119), rabbit anti- SMAD3 (1:1000; Cell Signaling- 9523), rabbit anti- p- Histone3 (1:1000; Cell Signaling- 9701), rabbit anti- p21 (1:1000; Cell Signaling- 2947), rabbit anti- caspase- 9 (1:1000; Cell Signaling- 9502), rabbit anti- c- caspase- 3 (1:1000; Cell Signaling- 9661), rabbit antiSnail1 (1:1000; Cell Signaling- 38798s), rabbit anti- α- SMA (1:1000; Abcam- ab32575), rabbit anti- phospho- SMAD3 (1:1000; Abcam- ab52903), rabbit anti- fibronectin (1:100,000; Abcam- ab2413), rabbit anti- LOXL2 (1:1000; Abcam- ab96233), rabbit anti- MMP- 9 (1:1000; Abcam- ab38898), rabbit antiMMP- 2 (1:1000; Abcam- ab97779), rabbit anti- VEGF- C (1:1000; Abcam- ab9546), rabbit anti- endothelin- 1 (1:1000; 18201- IBL America, Minneapolis, MN, USA), rabbit antivimentin (1:10,000; Santa Cruz- sc5565), rabbit anti- GAPDH (1:5000; Santa Cruz- sc25778), goat anti- CCN2 (1:500; Santa Cruz- sc14939), rabbit anti- TGF- βRI (1:1000; Santa Cruz- sc9048), rabbit anti- TGF- βRII (1:1000; Santa Cruz- sc220), mouse anti- p53 (1:1000; Santa Cruz- sc126), mouse anti- Ecadherin (1:1000; BD Biosciences- 610181), and rabbit antip- p53 (1:1000; AF1043- R&D systems, Minneapolis, MN, USA).

Techniques: Expressing

Figure 5. Effect of RSV and/or cisplatin on p53 phosphorylation in FaDu cell line. Phosphorylated (phos-) and total p53 protein expression in FaDu cell line treated with RSV 50μM and/or CisPt 10μM for 24h in presence or absence of SB203580 inhibitor (A). The results were analyzed and used to calculate the phospho-p53 /total p53 ratios (B). Results are presented in graphics as mean ± standard errors from three independent experiments.

Journal: ROMANIAN BIOTECHNOLOGICAL LETTERS

Article Title: Role of p38-mitogen-activated protein kinase in modulation of the response to therapy in FaDu Human pharyngeal carcinoma cell

doi: 10.25083/rbl/24.1/118.128

Figure Lengend Snippet: Figure 5. Effect of RSV and/or cisplatin on p53 phosphorylation in FaDu cell line. Phosphorylated (phos-) and total p53 protein expression in FaDu cell line treated with RSV 50μM and/or CisPt 10μM for 24h in presence or absence of SB203580 inhibitor (A). The results were analyzed and used to calculate the phospho-p53 /total p53 ratios (B). Results are presented in graphics as mean ± standard errors from three independent experiments.

Article Snippet: The kits consisted of: DuoSet_IC Human Total p53 ELISA [Cat. No DYC1043]; DuoSet_IC Human Phospho-p53 (S15) ELISA [Cat. No DYC1839]; DuoSet_IC Human/Mouse/Rat Total p38 ELISA [Cat. No DYC8691B] DuoSet_IC Human/ Mouse/ Rat Phospho-p38α (T180/Y182) ELISA [Cat. No DYC869B], and were purchased from R&D Systems Inc. (USA).

Techniques: Phospho-proteomics, Expressing

Primers

Journal: Journal of Neuroinflammation

Article Title: Neuronal c-Abl activation leads to induction of cell cycle and interferon signaling pathways

doi: 10.1186/1742-2094-9-208

Figure Lengend Snippet: Primers

Article Snippet: IFIT3 , F: GCTCAGGCTTACGTTGACAAGG , OriGene.

Techniques:

(a) Comet assay detecting basal nuclear DNA damage in WRNIP1 KO cells versus WT. Quantification of comet tail DNA % is measured by ImageJ using microscopy images (n = 3 discrete replicates). Data points represent each individual cell analyzed. (b) Detection of γH2AX foci representing nuclear DNA damage in Dox and mtDox treated cells. Microscopy images comparing 24-hour treatment of HCT116 TP53 (-/-) cells with 8 µM mtDox and 25 nM Dox with and without 10 mM N -acetyl cysteine (NAC) antioxidant treatment. Moderate γH2AX detection in mtDox treated cells is attenuated by antioxidant treatment, while cells treated with Dox still display pronounced nuclear DNA damage in the presence of antioxidant. (c) Clonogenic survival comparing representative survival of cell lines treated with 8 μM mtDox. KO-1 and KO-2 represent two monoclonal WRNIP1 KO lines of HCT116 TP53 (-/-) (WT). The reintroduction of a WRNIP1 construct shows partial but incomplete recovery of the monoclonal KO lines to WT standard (n = 4, p -values are compared to WT, * p < 0.00001, ** p < 0.009) All p -values determined using unpaired t -test. Data represented as mean ± s.d.

Journal: bioRxiv

Article Title: CRISPR Screening in Tandem with Targeted mtDNA Damage Reveals WRNIP1 Essentiality

doi: 10.1101/2023.10.03.560559

Figure Lengend Snippet: (a) Comet assay detecting basal nuclear DNA damage in WRNIP1 KO cells versus WT. Quantification of comet tail DNA % is measured by ImageJ using microscopy images (n = 3 discrete replicates). Data points represent each individual cell analyzed. (b) Detection of γH2AX foci representing nuclear DNA damage in Dox and mtDox treated cells. Microscopy images comparing 24-hour treatment of HCT116 TP53 (-/-) cells with 8 µM mtDox and 25 nM Dox with and without 10 mM N -acetyl cysteine (NAC) antioxidant treatment. Moderate γH2AX detection in mtDox treated cells is attenuated by antioxidant treatment, while cells treated with Dox still display pronounced nuclear DNA damage in the presence of antioxidant. (c) Clonogenic survival comparing representative survival of cell lines treated with 8 μM mtDox. KO-1 and KO-2 represent two monoclonal WRNIP1 KO lines of HCT116 TP53 (-/-) (WT). The reintroduction of a WRNIP1 construct shows partial but incomplete recovery of the monoclonal KO lines to WT standard (n = 4, p -values are compared to WT, * p < 0.00001, ** p < 0.009) All p -values determined using unpaired t -test. Data represented as mean ± s.d.

Article Snippet: HCT116 TP53 (-/-) cells were transfected with a FLAG-tagged RIG-I expression vector purchased from Origene (RC217615) using Lipofectamine 3000 in six 150 mm dishes plated to 90% confluency the day before.

Techniques: Single Cell Gel Electrophoresis, Microscopy, Construct