|
Miltenyi Biotec
oct3 4 apc Oct3 4 Apc, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oct3 4 apc/product/Miltenyi Biotec Average 94 stars, based on 1 article reviews
oct3 4 apc - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
|
Sino Biological
nanog Nanog, supplied by Sino Biological, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nanog/product/Sino Biological Average 92 stars, based on 1 article reviews
nanog - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pgl3 human oct4 pe sv40 luc ![]() Pgl3 Human Oct4 Pe Sv40 Luc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgl3 human oct4 pe sv40 luc/product/Addgene inc Average 93 stars, based on 1 article reviews
pgl3 human oct4 pe sv40 luc - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Addgene inc
oct4 ![]() Oct4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oct4/product/Addgene inc Average 92 stars, based on 1 article reviews
oct4 - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
Novus Biologicals
recombinant protein oct4 ![]() Recombinant Protein Oct4, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant protein oct4/product/Novus Biologicals Average 90 stars, based on 1 article reviews
recombinant protein oct4 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Addgene inc
human oct4 ![]() Human Oct4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human oct4/product/Addgene inc Average 93 stars, based on 1 article reviews
human oct4 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
OriGene
oct4 ![]() Oct4, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oct4/product/OriGene Average 93 stars, based on 1 article reviews
oct4 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
OriGene
shrna lentivirusoct 4 ![]() Shrna Lentivirusoct 4, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna lentivirusoct 4/product/OriGene Average 90 stars, based on 1 article reviews
shrna lentivirusoct 4 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
OriGene
human oct4 no tr310267 gene ![]() Human Oct4 No Tr310267 Gene, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human oct4 no tr310267 gene/product/OriGene Average 90 stars, based on 1 article reviews
human oct4 no tr310267 gene - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
human oct4 ![]() Human Oct4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human oct4/product/Cell Signaling Technology Inc Average 91 stars, based on 1 article reviews
human oct4 - by Bioz Stars,
2026-06
91/100 stars
|
Buy from Supplier |
|
OriGene
pou5f1 overexpression lysate ![]() Pou5f1 Overexpression Lysate, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pou5f1 overexpression lysate/product/OriGene Average 91 stars, based on 1 article reviews
pou5f1 overexpression lysate - by Bioz Stars,
2026-06
91/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Discover Oncology
Article Title: Quercetin suppresses endometrial cancer stem cells via ERα-mediated inhibition of STAT3 signaling
doi: 10.1007/s12672-025-03863-8
Figure Lengend Snippet: Enrichment of CSCs derived from endometrial carcinoma cells. A Representative images of spheres formed in serum-free medium on days 3, 6, 9, and 12. B , C Western blot analysis of stemness markers (ALDH1A1, c-Myc, Nanog, and Oct4) in parental cells (PCs) cultured in serum-supplemented medium and CSCs maintained in serum-free medium for 12 days. Different letters (a, b) indicate significant differences ( P < 0.05) between groups. All cytological experiments were independently repeated at least three times
Article Snippet:
Techniques: Derivative Assay, Western Blot, Cell Culture
Journal: Discover Oncology
Article Title: Quercetin suppresses endometrial cancer stem cells via ERα-mediated inhibition of STAT3 signaling
doi: 10.1007/s12672-025-03863-8
Figure Lengend Snippet: The effects of Quercetin treatment on sphere formation and maintenance of stemness in CSCs. A 1 × 10 4 cells were treated with 25 or 50 µmol/L Quercetin for 12 days, and spheres were imaged. B 100 spheres with diameter > 50 μm were treated with 50 µmol/L Quercetin for 72 h, and then imaged. C 1 × 10 5 cells were treated with 25 or 50 µmol/L Quercetin for 12 days, and total protein was extracted for western blot analysis of stemness markers (ALDH1A1, c-Myc, Nanog, and Oct4). Different letters (a, b, c) indicate significant differences ( P < 0.05) between groups. All cytological experiments were independently repeated at least three times
Article Snippet:
Techniques: Western Blot
Journal: Discover Oncology
Article Title: Quercetin suppresses endometrial cancer stem cells via ERα-mediated inhibition of STAT3 signaling
doi: 10.1007/s12672-025-03863-8
Figure Lengend Snippet: Quercetin inhibits STAT3’s transcriptional activity in the presence of ERα. A Luciferase reporter assay was used to evaluate the inhibitory effect of Quercetin on STAT3-mediated Oct4 promoter activity. Different letters (a, b) indicate significant differences ( P < 0.05) between groups. B mRNA expression of Oct4, Nanog, Twist, and Snai1 was measured by qPCR after Quercetin treatment. Different letters (a, b, c) indicate significant differences ( P < 0.05) between groups. The effects of Quercetin on sphere formation ( C ) and invasion ( D ) were assessed in the presence or absence of ERα. All cytological experiments were independently repeated at least three times
Article Snippet:
Techniques: Activity Assay, Luciferase, Reporter Assay, Expressing
Journal: Nature cell biology
Article Title: A PAX5-OCT4-PRDM1 developmental switch specifies human primordial germ cells.
doi: 10.1038/s41556-018-0094-3
Figure Lengend Snippet: Fig. 1 | Global redistribution of OCT4 binding in PGCs compared with ESCs. a, Cross-section of a human fetal testis (22 weeks) immunostained for OCT4. The panel on the right is an enlargement of the region enclosed within the white broken lines of the left panel. Scale bars, 50 µm; inset, 100 μm. Immunostaining experiments were independently repeated a minimum of three times and similar results were obtained. b, Left panel: heatmap visualization of OCT4 ChIP–seq data, depicting all binding events centred on the peak region within a 5 kb window around the peak. Right panel: distribution and peak heights of OCT4 peaks around the transcription start site (TSS). Peak heights are reported in reads per million. c, Scatterplot comparing OCT4 binding in PGCs and ESCs. Selected genes known to be associated with pluripotency are highlighted in blue, and those highly expressed in the germline are highlighted in red. d, Genome browser representation of ChIP–seq tracks for OCT4 in ESCs (red) and PGCs (yellow) at the OCT4 and PIWIL1 loci. Regions that were bound exclusively by OCT4 in ESCs or PGCs are highlighted by pink shaded boxes. Y-axes represent ChIP-seq signals in units of SPMR (signals per million reads). ChIP–seq were independently repeated twice and similar results were obtained. e, Venn diagram of unique and shared genes bound by OCT4 in ESCs and PGCs. GO analysis results are shown to the right and bottom of the venn diagram. Y-axes represent each category of molecular functions and biological processes. The analysis was performed twice and similar results were obtained based on two independent ChIP–seq data.
Article Snippet: The
Techniques: Binding Assay, Immunostaining, ChIP-sequencing
Journal: Nature cell biology
Article Title: A PAX5-OCT4-PRDM1 developmental switch specifies human primordial germ cells.
doi: 10.1038/s41556-018-0094-3
Figure Lengend Snippet: Fig. 2 | Co-occurrence of OCT4 with PAX5 and PRDM1 in PGCs. a, The position weight matrix of an enriched motif found in OCT4 ChIP–seq data from PGCs. The motif resembles the binding motifs for PRDM1 and PAX5. b, Cross-section of a human fetal testis (22 weeks). Upper panel: immunostained for PAX5 (red) and OCT4 (green), and DAPI stained for nuclei (blue). Lower panel: immunostained for PRDM1 (red) and OCT4 (green), and DAPI stained for nuclei (blue). Enlarged panels on the right represent the region enclosed within the white broken lines of the far left panel. White arrows indicate co-localization of PAX5 and OCT4 or PRDM1 and OCT4. Scale bars (orignal images), 100 µm; (expanded images) 50 µm. Immunostaining experiments were independently repeated a minimum of three times and similar results were obtained. c, Venn diagram of unique and shared genes bound by OCT4, PRDM1 and PAX5 in PGCs. The number of genes bound exclusively by each transcription factor or co-bound by multiple transcription factors are labelled. d, Genome browser representation of ChIP–seq tracks for OCT4 (yellow), PAX5 (blue) and PRDM1 (green) at the TBX3 and PIWIL1 loci. Regions that are bound collectively by OCT4, PAX5 and PRDM1 in PGCs are highlighted by pink shaded boxes. Y-axes represent ChIP-seq signals in units of SPMR (signals per million reads). ChIP–seq were independently repeated twice and similar results were obtained. e, GO analysis of co-bound genes. The analysis was performed twice and similar results were obtained. f, GST pull-down assay performed using OCT4 and PAX5 recombinant proteins. Pull-down was repeated three times and similar results were obtained. Unprocessed scans of western blots are shown in Supplementary Fig. 8.
Article Snippet: The
Techniques: ChIP-sequencing, Binding Assay, Staining, Immunostaining, Pull Down Assay, Recombinant, Western Blot
Journal: Nature cell biology
Article Title: A PAX5-OCT4-PRDM1 developmental switch specifies human primordial germ cells.
doi: 10.1038/s41556-018-0094-3
Figure Lengend Snippet: Fig. 5 | PAX5 acts upstream of OCT4. a, Genome browser representation of ChIP–seq tracks at the OCT4 locus. Enhancer regions are highlighted by pink shaded boxes. Y-axes represent ChIP-seq signals in units of SPMR. ChIP–seq was independently repeated twice and similar results were obtained. b, OCT4 expression in hESCs, control cells and cells overexpressing PAX5 during in vitro differentiation. Data represent the mean ± s.d. of n = 3 independent replicates. P values were calculated by two-tailed Student’s t-test. c, Mouse testis xenografts immunostained for GFP and c-KIT. Scale bar, 50 µm. Immunostaining experiments were independently repeated a minimum of three times and similar results were obtained. DAPI stained for nuclei. d, Flow cytometry analysis for GFP and c-KIT of mouse testis xenografts. e, RT-qPCR analysis of OCT4 expression in hPGCs formed in mouse seminiferous tubules by cells overexpressing PAX5, PAX5 knockout cells or control hESCs. Data represent the mean ± s.d. of n = 3 independent replicates. P values were calculated by two-tailed Student’s t-test. f, Reporter construct used for measuring OCT4 enhancer activity is shown. The genomic fragment bound by PAX5 and OCT4 (red) was inserted upstream of a luciferase gene driven by a minimal promoter. The y axis represents the fold enrichment of luciferase activity. Data represent the mean ± s.d. of n = 3 independent replicates. Source data for b, e and f are provided in Supplementary Table 2.
Article Snippet: The
Techniques: ChIP-sequencing, Expressing, Control, In Vitro, Two Tailed Test, Immunostaining, Staining, Flow Cytometry, Quantitative RT-PCR, Knock-Out, Construct, Activity Assay, Luciferase
Journal: Nature cell biology
Article Title: A PAX5-OCT4-PRDM1 developmental switch specifies human primordial germ cells.
doi: 10.1038/s41556-018-0094-3
Figure Lengend Snippet: Fig. 6 | PAX5 and OCT4 act upstream of PRDM1. a, Genome browser representation of ChIP–seq tracks at the PRDM1 locus. Enhancer regions bound by OCT4 and PAX5 in PGCs are highlighted by pink shaded boxes. Y-axes represent ChIP-seq signals in units of SPMR. ChIP–seq was independently repeated twice and similar results were obtained. b, PRDM1 expression in control cells, cells overexpressing PAX5 and PAX5 knockout cells during in vitro differentiation. Data are represented as mean ± s.d. of n = 3 independent replicates. P values were calculated by two-tailed Student’s t-test. c, RT-qPCR analysis of PRDM1 expression in hPGCs formed in the mouse seminiferous tubules by PAX5 overexpressing, PAX5 knockout and control hESCs. Data are represented as mean ± s.d. of n = 3 independent replicates. P values were calculated by two-tailed Student’s t-test. d, Reporter construct used for measuring PRDM1 enhancer activity is shown. The genomic fragment bound by PAX5 and OCT4 (red) was inserted upstream of a luciferase gene driven by a minimal promoter. The y axis represents the fold enrichment of luciferase activity. Data represent the mean ± s.d. of n = 3 independent replicates. e, RT-qPCR analysis of the expression of genes associated with germline programming. Data represent the mean ± S.D. of n = 3 independent replicates. P values were calculated by two-tailed Student’s t-test. f, Model for gene regulation in pluripotency and germline programmes. In pluripotent stem cells, OCT4, together with other transcription factors (TFs) and cofactors, binds to its own enhancer to activate and maintain its high expression. While differentiating towards germline cells, PAX5 replaces OCT4 and binds to the enhancer of OCT4 to maintain a moderate expression of OCT4. Meanwhile, PAX5 and OCT4 bind to the enhancer of PRDM1 and activate its expression to initiate the germline programme. Source data for b, c, d and e are provided in Supplementary Table 2.
Article Snippet: The
Techniques: ChIP-sequencing, Expressing, Control, Knock-Out, In Vitro, Two Tailed Test, Quantitative RT-PCR, Construct, Activity Assay, Luciferase
Journal: bioRxiv
Article Title: Defining transcription factor nucleosome binding with Pioneer-seq
doi: 10.1101/2022.11.11.516133
Figure Lengend Snippet: The TFBS is positioned across all possible locations along the 601 nucleosome with TFBSs in the left and right linkers to generate a total of 149 unique nucleosomes per TFBS. The relative supershift for each nucleosome is determined by counting the frequency of each sequence within the shifted band in the electrophoretic mobility shift assay and comparing it to that for nonspecific binding (i.e., binding to a sequence without the TFBS for that particular TF). This value is then normalized to the input ratio of nucleosomes (see ). Shading around each line is SEM. Binding for KLF4 ( a ), SOX2 ( b ), OCT4 ( c ), and MYC ( d ) is shown for nucleosomes with their specific TFBSs along with binding to a nonspecific TFBS nucleosome sequence (shown in gray). Breaks in the trace for Klf4-2 TFBS indicate missing data as a result of inefficient nucleosome formation. RC, reverse complement.
Article Snippet: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691),
Techniques: Sequencing, Electrophoretic Mobility Shift Assay, Binding Assay
Journal: bioRxiv
Article Title: Defining transcription factor nucleosome binding with Pioneer-seq
doi: 10.1101/2022.11.11.516133
Figure Lengend Snippet: The TFBSs were positioned across all possible locations along the 5S ( a-d ) and MMTV ( e–h ) nucleosomes, with TFBSs in the left and right linkers. Relative supershifts for KLF4 ( a , e ), SOX2 ( b , f ), OCT4 ( c , g ), and MYC ( d , h ) are shown for their specific TFBSs along with binding to a nonspecific TFBS nucleosome sequence (shown in gray). Breaks in the trace for Klf4-2 TFBS in panels a and e indicate missing data as a result of inefficient nucleosome formation.
Article Snippet: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691),
Techniques: Binding Assay, Sequencing
Journal: bioRxiv
Article Title: Defining transcription factor nucleosome binding with Pioneer-seq
doi: 10.1101/2022.11.11.516133
Figure Lengend Snippet: a , Relative supershifts for SOX2 binding to the Oct4-Sox2 TFBS (CTTTGTTATGCAAAT) within the 5S, MMTV, and 601 nucleosomes. B , Relative supershifts for KLF4 binding to Klf4-1 (CCCCACCC), Klf4-1RC (GGGTGGGG), and p53-1 (GGGCATGTCCGGGCATGTCC) within the 601 nucleosome; “*” indicates the nucleosome validated in DNase I footprinting experiments. RC, reverse complement. c , DNase I footprinting of nucleosomes containing the p53-1 TFBS at SHL −2; an additional footprint observed on the neighboring gyre is indicated with the dashed-line box. Nuc, DNase I digestion. d , Model of the 601 nucleosome with the p53-1 motif highlighted in yellow, the two GGGC in blue, and the additional footprinted region in red.
Article Snippet: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691),
Techniques: Binding Assay, Footprinting
Journal: bioRxiv
Article Title: Defining transcription factor nucleosome binding with Pioneer-seq
doi: 10.1101/2022.11.11.516133
Figure Lengend Snippet: The locations of TFBSs with MNase protection for in vivo -targeted nucleosomes (ITNs) are shown (red color scale at bottom). MNase protection was measured as the percentage of nucleosome bases that were protected from MNase digestion and calculated for each base pair as the ratio of base pair coverage to the total reads for that specific nucleosome: a , Lin28B nucleosome sequence bound with O; b , ITN bound with O, S, K, and M. c–d , ITN bound with O, S, and K; e, ITN bound with O and S. O, OCT4; S, SOX2; K, KLF4; M, MYC. The relative supershifts for each nucleosome are shown for KLF4, MYC, OCT4, and SOX2 binding on the right.
Article Snippet: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691),
Techniques: In Vivo, Sequencing, Binding Assay
Journal: bioRxiv
Article Title: Defining transcription factor nucleosome binding with Pioneer-seq
doi: 10.1101/2022.11.11.516133
Figure Lengend Snippet: a , Violin plot showing relative supershifts for KLF4, MYC, OCT4, and SOX2 binding to in vivo- targeted nucleosomes (ITNs) containing their transcription factor binding sites (TFBSs). b–e , Relative supershifts for binding to ITNs compared to the distance of the TFBS distance from the center of MNase protection.
Article Snippet: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691),
Techniques: Binding Assay, In Vivo
Journal: Cancer Management and Research
Article Title: OCT4 accelerates tumorigenesis through activating JAK/STAT signaling in ovarian cancer side population cells
doi: 10.2147/CMAR.S180418
Figure Lengend Snippet: OCT4 was overexpressed in the SP of ovarian cancer cells. Notes: ( A–C ) Western blotting and RT-PCR were carried out to analyze the protein and mRNA expressions of OCT4 in the SP and NSP population of SKOV3 and A2780 cells. ** P < 0.01; *** P <0.001. Abbreviations: NSP, non-SP; SP, side population.
Article Snippet: For knockdown of the expression of OCT4 stably, the shR-NAs targeting
Techniques: Western Blot, Reverse Transcription Polymerase Chain Reaction
Journal: Cancer Management and Research
Article Title: OCT4 accelerates tumorigenesis through activating JAK/STAT signaling in ovarian cancer side population cells
doi: 10.2147/CMAR.S180418
Figure Lengend Snippet: Downregulation of OCT4 reduced cell drug resistance and inhibited cell proliferation and tumorigenesis in the SP of ovarian cancer cells. Notes: ( A , B ) Western blotting analysis of the knockdown efficiency of OCT4 after 48 hours of the cells were transfected with sh-OCT4. ( C , D ) Different concentrations of DDP were added in the SP of SKOV3 and A2780 cells after 48 hours of the cells were transfected with sh-OCT4, then CCK-8 assay was performed to assess cell viability. ( E , F ) CCK-8 analysis of cell viability after 48 hours of cell treatments. ( G , H ) Flow cytometry analysis of cell cycle after 48 hours of cell treatments. ( I , J ) In vivo xenograft model was carried out to analyze the effect of sh-OCT4 on tumorigenesis in the SP cells. The data presented are the mean ± standard error and represent three independent experiments (* P <0.05; ** P <0.01). Effects of downregulation of OCT4 on cell viability and cycle in the SP population of SKOV3 cells. Abbreviations: CCK-8, cell counting kit-8; SP, side population.
Article Snippet: For knockdown of the expression of OCT4 stably, the shR-NAs targeting
Techniques: Western Blot, Transfection, CCK-8 Assay, Flow Cytometry, In Vivo, Cell Counting
Journal: Cancer Management and Research
Article Title: OCT4 accelerates tumorigenesis through activating JAK/STAT signaling in ovarian cancer side population cells
doi: 10.2147/CMAR.S180418
Figure Lengend Snippet: Effects of OCT4 overexpression on cell functions and drug resistance in the NSP of SKOV3 and A2780 cells. Notes: ( A , B ) Western blotting was carried out to analyze the protein expressions of OCT4 after 48 hours of the SP cells were treated with Lentiv-OCT4 or Lentiv-NC, respectively. ( C , D ) Different concentrations of DDP were added in the NSP of SKOV3 and A2780 cells after 48 hours of the cells were treated with Lentiv-OCT4 or Lentiv-NC, and then CCK-8 assay was performed to assess cell viability. ( E , F ) CCK-8 analysis of cell proliferation after 48 hours of the NSP cells was infected with Lentiv-OCT4 or Lentiv-NC. ( G , H ) Flow cytometry was used to assess cell cycle after 48 hours of the NSP cells were infected with Lentiv-OCT4 or Lentiv-NC. The data presented are the mean ± standard error and represent three independent experiments (* P <0.05; ** P <0.01). Abbreviations: CCK-8, cell counting kit-8; NSP, non-SP; SP, side population.
Article Snippet: For knockdown of the expression of OCT4 stably, the shR-NAs targeting
Techniques: Over Expression, Western Blot, CCK-8 Assay, Infection, Flow Cytometry, Cell Counting
Journal: Cancer Management and Research
Article Title: OCT4 accelerates tumorigenesis through activating JAK/STAT signaling in ovarian cancer side population cells
doi: 10.2147/CMAR.S180418
Figure Lengend Snippet: Evaluation of the effect of OCT4 on JAK/STAT signaling pathway activation in the NSP of SKOV3 and A2780 cells. Notes: ( A , B ) Western blotting analysis of the protein expressions of phosphorylated JAK1 (p-JAK1), p-STAT6, p-AKT, and p-NF-κB after 48 hours of the NSP cells was infected with Lentiv-OCT4 or Lentiv-NC. ( C , D ) Western blotting analysis of the protein expressions of p-JAK1, p-JAK2, p-JAK3, and p-Tyk2 after 48 hours of the NSP cells was infected with Lentiv-OCT4 or Lentiv-NC. ( E , F ) Western blotting analysis of the protein expressions of p-STAT1, p-STAT2, p-STAT3, p-STAT4, p-STAT5, and p-STAT6 after 48 hours of the NSP cells was treated with Lentiv-OCT4 or Lentiv-NC. ( G , H ) Immunofluorescence staining was used to determine the subcellular location of STAT6 after 48 hours of the SP SKOV3 cells were transfected Lentiv-OCT4. ( I , J ) Western blotting analysis of the expression of Cyclin D1, c-Myc, and Bcl-2 after 48 hours of the NSP cells was treated with Lentiv-OCT4 or Lentiv-NC. The data presented are the mean ± standard error and represent three independent experiments (* , # P <0.05). Abbreviation: NSP, nonside population.
Article Snippet: For knockdown of the expression of OCT4 stably, the shR-NAs targeting
Techniques: Activation Assay, Western Blot, Infection, Immunofluorescence, Staining, Transfection, Expressing
Journal: Cancer Management and Research
Article Title: OCT4 accelerates tumorigenesis through activating JAK/STAT signaling in ovarian cancer side population cells
doi: 10.2147/CMAR.S180418
Figure Lengend Snippet: Assessment of the effects of OCT4/JAK/STAT on cell functions in the NSP of SKOV3 and A2780 cells. Notes: ( A, B ) Western blotting analysis of the protein levels of JAK1 and caspase-3 in different treated NSP cells: Lentiv-NC (48 hours), Lentiv-OCT4 (48 hours), and peficitinib (4.8 nM, 2 hours) + Lentiv-OCT4 (48 hours). ( C , D ) Flow cytometry was performed to assess the apoptosis of the NSP cells with different treatments: Lentiv-NC (48 hours), Lentiv-OCT4 (48 hours), and peficitinib (4.8 nM, 2 hours) + Lentiv-OCT4 (48 hours). ( E , F ) CCK-8 and clone formation assays were performed to assess cell viability in the SP cells with different treatments: Lentiv-NC (48 hours), Lentiv-OCT4 (48 hours), and peficitinib (4.8 nM, 2 hours) + Lentiv-OCT4 (48 hours). ( G , H ). Transwell assay was used to evaluate the invasion of the NSP cells with different treatments: Lentiv-NC (48 hours), Lentiv-OCT4 (48 hours), and peficitinib (4.8 nM, 2 hours) + Lentiv-OCT4 (48 hours). The data presented are the mean ± standard error and represent three independent experiments (* , # P <0.05). Abbreviations: CCK-8, cell counting kit-8; NSP, nonside population.
Article Snippet: For knockdown of the expression of OCT4 stably, the shR-NAs targeting
Techniques: Western Blot, Flow Cytometry, CCK-8 Assay, Transwell Assay, Cell Counting
Journal: Cancer Management and Research
Article Title: OCT4 accelerates tumorigenesis through activating JAK/STAT signaling in ovarian cancer side population cells
doi: 10.2147/CMAR.S180418
Figure Lengend Snippet: Detection of the effect of OCT4/JAK/STAT on the tumorigenesis of the NSP of SKOV3 and A2780 cells. Notes: In vivo xenograft model analysis of the effect of OCT4/JAK/STAT on tumorigenesis. The data presented are the mean ± standard error and represent three independent experiments (* , # P <0.05). Abbreviation: NSP, nonside population.
Article Snippet: For knockdown of the expression of OCT4 stably, the shR-NAs targeting
Techniques: In Vivo
Journal: Cancer Management and Research
Article Title: OCT4 accelerates tumorigenesis through activating JAK/STAT signaling in ovarian cancer side population cells
doi: 10.2147/CMAR.S180418
Figure Lengend Snippet: Graphical abstract of this study. Notes: OCT4 activates JAK/STAT signaling, then promotes the expression of Cyclin D1, c-Myc, and Bcl-2, accelerating the tumorigenesis of NSP cells in ovarian cancer. Abbreviation: NSP, nonside population.
Article Snippet: For knockdown of the expression of OCT4 stably, the shR-NAs targeting
Techniques: Expressing
Journal: bioRxiv
Article Title: Bone morphogenetic protein 4 reduces global H3K4me3 to inhibit proliferation and promote differentiation of human neural stem cells
doi: 10.1101/2020.01.22.915934
Figure Lengend Snippet: A. Gross anatomy of partial fetal SVZ architecture and localization of H3K4me3 positive cells. View of fetal brain in the area of the lateral ventricle (LV), showing the SVZ with H3K4me3 positive cells. Top panel: H&E staining (LV and SVZ are separated by a green dashed line). Bottom panel: immunostaining with H3K4me3 antibody (LV and SVZ are separated by a red dashed line). B. Immunofluorescence of human StemPro® NSC neurospheres positive for NESTIN, SOX2, CD133 and OCT4 and differentiated cells positive for MUSHASHI, GFAP, TUJ1 and O4. C. Real-time PCR showing hSETD1A and WDR82 expression in spheres and differentiated human StemPro® NSCs. D. Western blots using total protein extracts and histone from un- (UD) and -differentiated (Diff) cells. Error bars show the standard error of three independent experiments (** p<0.01).
Article Snippet:
Techniques: Staining, Immunostaining, Immunofluorescence, Real-time Polymerase Chain Reaction, Expressing, Western Blot
Journal: bioRxiv
Article Title: Bone morphogenetic protein 4 reduces global H3K4me3 to inhibit proliferation and promote differentiation of human neural stem cells
doi: 10.1101/2020.01.22.915934
Figure Lengend Snippet: A. Experimental design for sample collection. B-E Real-time PCR (B and D) and western blots (C and E) showing OCT4 and NESTIN mRNA and protein in undifferentiated spheres (Sphere) and spontaneously differentiated (Diff) human StemPro® NSCs. F. Chromatin-immunoprecipitation (ChIP) with rabbit IgG and H3K4me3 and detected with real-time PCR using promoter primers. Error bars show the standard error of three independent experiments (* p<0.05, ** p<0.01).
Article Snippet:
Techniques: Real-time Polymerase Chain Reaction, Western Blot, Chromatin Immunoprecipitation
Journal: bioRxiv
Article Title: Bone morphogenetic protein 4 reduces global H3K4me3 to inhibit proliferation and promote differentiation of human neural stem cells
doi: 10.1101/2020.01.22.915934
Figure Lengend Snippet: A. Western blots shows WDR82 and human SETD1A/B expression following 100ng/ml BMP4 treatment. B. Representative images and quantitative graphs showing sphere formation in human StemPro® NSCs following treatment with siRNA for hSETD1A (siSETD1A) or shRNA for WDR82 (shWDR82) vectors versus controls (control siRNA, siCtrl and scrambled shRNA, scrCtrl). C and D. Real-time PCR (C) and western blots (D) showing expression of hSETD1A, WDR82, OCT4, CCND1 and NESTIN, following treatments as in B. E. Real-time PCR using DNA from ChIP with rabbit IgG and H3K4me3 and detected with promoter primers for OCT4, CCND1 and NESTIN following treatment with siSETD1A, shWDR82 or siCtrl, scrCtrl, in StemPro® NSCs. Error bars show the standard error of three independent experiments. (* p<0.05, ** p<0.01)
Article Snippet:
Techniques: Western Blot, Expressing, shRNA, Control, Real-time Polymerase Chain Reaction
Journal: bioRxiv
Article Title: Bone morphogenetic protein 4 reduces global H3K4me3 to inhibit proliferation and promote differentiation of human neural stem cells
doi: 10.1101/2020.01.22.915934
Figure Lengend Snippet: A. Representative images and quantitative graphs show sphere formation from HAs following transfection with WDR82 (pcDNA3-WDR82) or human SETD1A (pET28-hSETD1A-MHL) expression plasmids, in comparison to controls (pcDNA3 and pET28- MHL). B and C. Real-time PCR (B) and western blots (C) show expression of hSETD1A, WDR82, OCT4, CCND1 and NESTIN. D. ChIP with rabbit IgG and H3K4me3 combined with real-time PCR using promoter primers for OCT4, CCND1 and NESTIN following HA transfection. Error bars show the standard deviation of three independent experiments. (* p<0.05, ** p<0.01)
Article Snippet:
Techniques: Transfection, Expressing, Comparison, Real-time Polymerase Chain Reaction, Western Blot, Standard Deviation